MRNA vaccine for preventing and / or treating rabies and application thereof
By optimizing the rabies virus G protein antigen sequence and combining it with a tag protein, a high-secretion-level mRNA vaccine was constructed, solving the problems of flexibility and high production cost of existing vaccines and achieving efficient and safe rabies prevention and control.
Patent Information
- Application Number
- CN202411802064.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-09
- Publication Date
- 2025-11-21
AI Technical Summary
Existing technologies lack flexibility and efficiency, making it difficult to quickly respond to the diversity and mutations of rabies viruses. Furthermore, veterinary rabies vaccines are limited in variety, and their production process is complex and costly.
An mRNA vaccine was designed by optimizing the rabies virus G protein antigen sequence and combining it with tag proteins Fc or Folden, adding elements such as signal peptides and UTRs, to construct a high-secretion mRNA vaccine, improve translation efficiency and stability, and induce the production of high levels of neutralizing antibodies.
This mRNA vaccine can effectively induce the production of rabies virus neutralizing antibodies, has a better immune effect than inactivated vaccines, good safety, is suitable for humans and animals, and has a good protective effect.
Smart Images

Figure CN120989100A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of viral vaccine technology, specifically relating to an mRNA vaccine for the prevention and / or treatment of rabies and its application. Background Technology
[0002] Rabies is an acute infectious disease caused by the rabies virus, primarily transmitted through contact between animals and humans. The virus is mainly transmitted to humans through the saliva of infected animals, usually via bites or scratches. Once inside the human body, the rabies virus spreads through the nervous system to the central nervous system, leading to severe neurological disorders and ultimately death. Rabies is primarily transmitted among animals such as dogs, foxes, and wolves, which often live in the wild. Unvaccinated pet dogs can also be a source of transmission. Therefore, rabies is a disease that can be transmitted through both wild animals and pet dogs, posing a significant threat to humans.
[0003] Rabies vaccination is crucial for effective rabies prevention. Currently, only inactivated rabies vaccines are available for veterinary use in China; mRNA vaccines are not yet available, resulting in a limited range of vaccine options. mRNA vaccines, by encapsulating viral antigen coding information within mRNA molecules, directly transcribe and translate it into antigen proteins, effectively activating the host's immune system to produce specific antibodies and an immune response. Compared to traditional vaccines, mRNA vaccines can induce an immune response more rapidly, providing faster and longer-lasting immune protection. Furthermore, mRNA vaccines offer greater flexibility, allowing for rapid adjustment and design of different antigen protein coding sequences based on the diversity and variation of the rabies virus. This flexibility enables mRNA vaccines to quickly address the challenges of new viral strains or mutant strains, ensuring vaccine efficacy and adaptability. Since mRNA vaccines do not require live virus culture and inactivation processes, the production process is simpler and more cost-effective. Simultaneously, the high degree of scalability and automation in production facilitates large-scale production and supply. Therefore, rabies mRNA vaccines offer advantages such as high efficiency, safety, flexibility, strong immunogenicity, low production cost, and wide applicability.
[0004] In conclusion, the development of an mRNA vaccine against rabies would greatly benefit the treatment and prevention of rabies, promote innovation and progress in the vaccine field, and make a positive contribution to improving animal health, reducing disease transmission, and promoting shared health between humans and animals. Summary of the Invention
[0005] The purpose of this invention is to provide an mRNA vaccine for the prevention and / or treatment of rabies and its application. By optimizing the sequence of the G protein antigen and attempting to link the optimized G protein antigen sequence with a tag protein, the resulting mRNA vaccine can effectively immunize and protect the host from rabies virus infection, and has good safety.
[0006] To achieve the above objectives, a specific embodiment of the present invention provides the following technical solution:
[0007] On one hand, the present invention provides a polynucleotide comprising at least one first nucleotide sequence encoding a rabies virus G protein or an immunogenic fragment thereof, wherein the amino acid sequence of the rabies virus G protein or the immunogenic fragment thereof has at least 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with SEQ ID NO: 1.
[0008] In one or more embodiments of the present invention, the sequence of the first nucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 2 or 3.
[0009] In one or more embodiments of the present invention, the polynucleotide further includes a second nucleotide encoding the tag protein Fc or Folden;
[0010] Preferably, when the second nucleotide encodes the tag protein Fc, the polynucleotide encodes the G-Fc protein or its immunogenic fragment, and the amino acid sequence of the G-Fc protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 4; or
[0011] When the second nucleotide encodes the tag protein Folden, the polynucleotide encodes the G-Folden protein or its immunogenic fragment, and the amino acid sequence of the G-Folden protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 5.
[0012] In one or more embodiments of the present invention, when the polynucleotide encodes the G-Fc protein or its immunogenic fragment, the polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 6 or 7; or
[0013] When the polynucleotide encodes the G-Folden protein or its immunogenic fragment, the polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 8 or 9.
[0014] In one or more embodiments of the present invention, the polynucleotide comprises two first nucleotide sequences encoding a rabies virus G protein or an immunogenic fragment thereof, the two first nucleotides being linked by a linker (L), the amino acid sequence of the L comprising one or more polypeptide fragments as shown in SEQ ID NO:18 (GGGGS), the polynucleotide encoding a GLG protein or an immunogenic fragment thereof, the amino acid sequence of the GLG protein or the immunogenic fragment thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to SEQ ID NO:10;
[0015] Preferably, the polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 11 or 12.
[0016] In one or more embodiments of the present invention, the 5' end of the polynucleotide is further connected to a third nucleotide sequence encoding a signal peptide;
[0017] Preferably, the signal peptide is tPA, IL-2, IL-6 or a neuropeptide, and the neuropeptide is preferably VIP, CGRP or NPY;
[0018] More preferably, the 5' end of the third nucleotide sequence is connected to a 5' UTR sequence, and the nucleotide sequence of the 5' UTR sequence is preferably as shown in SEQ ID NO: 13, or
[0019] The 3' end of the polynucleotide is further connected to a 3'UTR sequence, and the end of the 3'UTR sequence is further connected to a PolyA sequence. The nucleotide sequence of the 3'UTR sequence is preferably as shown in SEQ ID NO: 14.
[0020] Preferably, the 5' end of the 5' UTR sequence is further provided with a T7 promoter, the nucleotide sequence of which is shown in SEQ ID NO: 15, and the polynucleotide is preferably provided with a FLAG tag.
[0021] In one or more embodiments of the present invention, the polynucleotide is DNA or RNA;
[0022] Preferably, when the polynucleotide is RNA, the 5' end of the 5' UTR sequence of the RNA is further provided with a 5' capping structure, which is preferably Cap1 (methylation of the ribose of the neighboring nucleotide of m7GpppN), Cap2 (methylation of the ribose of the second nucleotide downstream of m7GpppN), Cap3 (methylation of the ribose of the third nucleotide downstream of m7GpppN), Cap4 (methylation of the ribose of the fourth nucleotide downstream of m7GpppN) or Cap 101.
[0023] On the other hand, the present invention also provides a carrier constructed from the above-mentioned polynucleotides.
[0024] In another aspect, the present invention also provides a cell derived from the above-described carrier combination.
[0025] In another aspect, the present invention also provides a composition for the prevention of rabies, comprising the above-mentioned polynucleotides or mRNA transcribed from the above-mentioned vector.
[0026] In one or more embodiments of the present invention, the composition is an mRNA vaccine, the mRNA vaccine comprising at least one selected from mRNA expressing rabies virus G protein or an immunogenic fragment thereof, G-Fc protein or an immunogenic fragment thereof, G-Folden protein or an immunogenic fragment thereof, and GLG protein or an immunogenic fragment thereof.
[0027] In one or more embodiments of the present invention, the sequence of the mRNA expressing the rabies virus G protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 2; or
[0028] The mRNA sequence expressing the G-Fc protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 7; or
[0029] The mRNA sequence expressing the G-Folden protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 9; or
[0030] The mRNA sequence expressing the GLG protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 12.
[0031] In one or more embodiments of the present invention, the composition further includes a pharmaceutically acceptable carrier, preferably a liposome, wherein the mRNA in the mRNA vaccine is encapsulated in liposome nanoparticles of the liposome, and the particle size of the liposome nanoparticles is preferably 50-200 nm.
[0032] Preferably, the liposome nanoparticles are selected from at least one of cationic lipids, distearate phosphatidylcholine (DSPC), cholesterol, and DMG-2000;
[0033] More preferably, the liposome nanoparticles are composed of the following components in parts by weight: 30-80 parts cationic lipids, 5-15 parts distearate phosphatidylcholine (DSPC), 24-52 parts cholesterol, and 1-2 parts DMG-2000.
[0034] More preferably, the liposome nanoparticles are composed of the following components in parts by weight: 50 parts cationic lipids, 10 parts distearate phosphatidylcholine (DSPC), 38.5 parts cholesterol, and 1.5 parts DMG-2000.
[0035] In one or more embodiments of the present invention, the composition may be an oral formulation, an injectable formulation, a spray formulation, or an embolic agent.
[0036] In another aspect, the present invention also provides the use of the above-mentioned polynucleotide, carrier or composition in the preparation of a medicament for the prevention and / or treatment of rabies.
[0037] In another aspect, the present invention also provides a method for using the above-mentioned polynucleotide, vector, composition or mRNA vaccine for the prevention and / or treatment of rabies, comprising administering an appropriate amount of polynucleotide, vector or composition to a desired host, said host may be a human or an animal such as a cat, dog, pig or other animal.
[0038] Specifically, it can be administered orally, parenterally, via inhalation spray, topically, rectally, nasally, orally, via vaginal, or through an implanted reservoir.
[0039] Compared with existing technologies, the mRNA vaccine for the prevention and / or treatment of rabies of the present invention is based on the rabies virus G protein antigen, which is further optimized. The gene sequence of the optimized antigen is further optimized through codon optimization to improve translation efficiency. Furthermore, attempts were made to add the tag sequence Fc or Folden to the nucleotide sequence of the optimized G protein antigen, resulting in mRNA vaccines encoding G-Fc or G-Folden protein, and an mRNA vaccine encoding GLG protein. Unexpectedly, it was found that all the rabies mRNA vaccines we designed could effectively induce the production of rabies virus neutralizing antibodies, and their immunogenicity was superior to that of existing inactivated rabies vaccines. Moreover, the mRNA vaccine encoding G-Folden protein showed the best immunogenicity, followed by the mRNA vaccine encoding G-Fc protein, while the mRNA vaccine encoding GLG protein showed a slightly weaker immunogenicity than the mRNA vaccine encoding G protein.
[0040] Furthermore, to obtain a superior mRNA vaccine, a signal peptide was added before the polynucleotide sequence encoding the protein to increase protein secretion. Additionally, a T7 promoter, a 5'UTR, and a 5' capping structure were added to the front of the signal peptide sequence, and a 3'UTR and a polyA tail were added to the rear of the polynucleotide sequence to improve the translation efficiency and stability of the mRNA vaccine, thus constructing a candidate mRNA vaccine expressing the antigen. Furthermore, a candidate mRNA vaccine with high secretion levels was constructed by expressing the rabies virus G protein and its fusion protein.
[0041] Furthermore, experiments showed that immunization of mice with the constructed rabies mRNA vaccine induced high levels of neutralizing antibodies against RV. Safety experiments demonstrated the safety of the prepared mRNA vaccine. Canine challenge experiments showed that the mRNA vaccine had good protective effects against rabies virus, indicating that the mRNA vaccine provides protection against rabies virus. Safety experiments verified that the four constructed rabies mRNA vaccines had good safety profiles. Attached Figure Description
[0042] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0043] Figure 1This is an agarose gel electrophoresis image of the mRNA transcribed in Example 2 of the present invention, where the marker is RNA marker6000, 1 is the mRNA of G protein; 2 is the mRNA of G-Folden protein; 3 is the mRNA of GLG protein; and 4 is the mRNA of G-Fc protein.
[0044] Figure 2 The figures shown are the protein expression verification results of the in vitro transcribed mRNA in Example 3 of this invention. A represents the protein expression verification results of G protein mRNA; B represents the protein expression verification results of GLG protein mRNA; C represents the protein expression verification results of G-Fc protein mRNA; and D represents the protein expression verification results of G-Folden protein mRNA. In each figure, the markers are protein markers, 1 represents the results of denaturing electrophoresis of the expressed protein, and 2 represents the results of non-denaturing electrophoresis of the expressed protein.
[0045] Figure 3 The following are particle size analysis results of the LNP-mRNA vaccine after packaging in Example 4 of the present invention: A is the particle size analysis result of the G protein mRNA-LNP vaccine; B is the particle size analysis result of the GLG protein mRNA-LNP vaccine; C is the particle size analysis result of the G-Fc protein mRNA-LNP vaccine; and D is the particle size analysis result of the G-Folden protein mRNA-LNP vaccine.
[0046] Figure 4 The graph shows the results of neutralizing antibody detection in mice immunized with the mRNA vaccine in Example 5 of the present invention. In the graph, #: compared with the blank control group; *: compared with the positive control group; ##: P<0.01; *: P<0.05; **: P<0.01;
[0047] Figure 5 The graph shows the results of neutralizing antibody detection in dogs immunized with the mRNA vaccine in Example 6 of this invention. In the graph, #: compared with the blank control group; *: compared with the positive control group; ##: P<0.01; *: P<0.05; **: P<0.01;
[0048] Figure 6 This is a tissue section image showing the results of the in vivo safety test of the mRNA vaccine in Example 7 of this invention. Detailed Implementation
[0049] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of the embodiments of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.
[0050] Unless otherwise specified, all reagents and materials used in this article are available from legitimate sources.
[0051] Unless otherwise specified, "G antigen" in this article refers to "G protein or its immunogenic fragment".
[0052] Unless otherwise specified, "GLG antigen" in this article refers to "GLG protein or its immunogenic fragment".
[0053] Unless otherwise specified, "G-Fc antigen" in this article refers to "G-Fc protein or its immunogenic fragment".
[0054] Unless otherwise specified, "G-Folden antigen" in this article refers to "G-Folden protein or its immunogenic fragment".
[0055] Unless otherwise specified, "G mRNA" in this article refers to "the mRNA of the G protein".
[0056] Unless otherwise specified, "GLG mRNA" in this article refers to "the mRNA of the GLG protein".
[0057] Unless otherwise specified, "G-Fc mRNA" in this article refers to "the mRNA of the G-Fc protein".
[0058] Unless otherwise specified, "G-Folden mRNA" in this article refers to "the mRNA of the G-Folden protein".
[0059] Example 1. Optimization of G protein antigen sequence and acquisition of antigen expression vector for mRNA vaccine
[0060] The sequence of the G protein antigen was optimized to obtain the optimized G protein antigen, the amino acid sequence of which is shown in SEQ ID NO:1. To further improve the translation efficiency of the obtained mRNA vaccine, the gene sequence of the optimized G protein antigen was further optimized by codons to obtain the optimized G protein antigen gene sequence, the first nucleotide sequence of which is shown in SEQ ID NO:2. In addition, based on the optimized G antigen, the tag sequences Fc and Folden were linked, and another G antigen sequence was linked to obtain mRNA vaccines encoding GLG protein, G-Fc protein, and G-Folden protein.
[0061] The designed sequences were then synthesized and the antigen expression vector for the mRNA vaccine was constructed. Specifically, the following gene sequences were synthesized by Shanghai Sangon Biotech Co., Ltd.: from 5' to 3' end, they were T7 promoter (SEQ ID NO: 15), 5'UTR (SEQ ID NO: 13), kozak sequence (GCCACC), tPA signal peptide sequence (SEQ ID NO: 17), DNA sequence of G protein (SEQ ID NO: 2) or GLG protein (SEQ ID NO: 11) or G-Fc protein (SEQ ID NO: 6) or G-Folden protein (SEQ ID NO: 8), 3'UTR (SEQ ID NO: 14), and polyA (SEQ ID NO: 16). A Bsa I restriction site was introduced after the polyA sequence to facilitate plasmid linearization. Using genetic engineering, the above target gene sequences were constructed into the cloning vector pUC57, and plasmids pUC57-G, pUC57-GLG, pUC57-G-Fc, and pUC57-G-Folden were constructed. These plasmids were then transformed into competent E. coli cells, and large-scale culture of the four bacteria and large-scale extraction of the four plasmids were performed to obtain the constructed plasmids pUC57-G, pUC57-GLG, pUC57-G-Fc, and pUC57-G-Folden.
[0062] The sequences designed and synthesized above, as well as the sequences of the antigen proteins, are as follows:
[0063] The DNA sequence of the 5' untranslated region (5'UTR) is shown in SEQ ID NO: 13:
[0064] GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCGCTAGCCTCG AG
[0065] The DNA sequence of the 3' untranslated region (3'UTR) is shown in SEQ ID NO: 14:
[0066] GATATCTGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCC CCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTG
[0067] Polyadenylate (polyA) has the sequence shown in SEQ ID NO: 16, containing 104 bases A:
[0068] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[0069] The DNA sequence of the T7 promoter is shown in SEQ ID NO: 15:
[0070] TAATACGACTCACTATAGG
[0071] The DNA sequence of the signal peptide tPA is shown in SEQ ID NO: 17.
[0072] ATGGACGCCATGAAGAGGGGGCTGTGCTGCGTGCTGCTGCTGTGCGGAGCCGTGTTCGTGAGCGCCTCC
[0073] The DNA sequence of the G antigen is shown in SEQ ID NO: 2:
[0074]
[0075] The amino acid sequence of the G antigen is shown in SEQ ID NO: 1 as follows:
[0076] MVPQALLLVPLLGFSLCFGKFPIYTIPDTLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGHISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDTRYEESLHSPYPDYHWLRTVKTTKESLVIISPSVANLDPYDNSLHSRVFPSGKCSGITVPSVYCSTNHDYTVWMPEILRLGTSCDIFTNSRGKRASKGSKTCGFVDERGLYKSLKGACKLKLCGVPGLRLMDGTWVAMQTSNETKWCPPGQLVNLHDLHSDEIEHLVVEELVKKREECLDALESIITTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEAEAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGPDGHVLIPEMQSSLLQQHIELLESSVIPLMHPLADPFTVFKDGDEIEDFVEVHLPDVHEQVSGVDLGLPNWGEYVLLSAGTLIALMLIIFLITCCKRVDRPESTQRSLRGTGRNVSVTSQSGKFIPSWESYKSGGETGLDYKDDDDK
[0077] The mRNA sequence of the G antigen is shown in SEQ ID NO: 3 as follows:
[0078]
[0079] The DNA sequence of the G-L-G antigen is shown in SEQ ID NO: 11:
[0080] ATGGTGCCCCAGGCCCTGCTGCTGGTGCCCCTGCTGGGATTCTCCCTGTGCTTCGGC
[0081] AAGTTCCCCATCTACACCATCCCCGACACCCTGGGCCCCTGGAGCCCTATCGACATCCAC
[0082] CACCTGTCCTGCCCCAATAACCTGGTGGTGGAAGACGAGGGCTGCACCAACCTGAGCG
[0083] GCTTCTCCTACATGGAACTGAAAGTGGGCCACATCTCCGCCATCAAAGTGAACGGCTTC
[0084] ACCTGCACCGGCGTGGTGACCGAAGCCGAAACATACACAAACTTCGTGGGCTACGTGA
[0085] CCACCACCTTCAAGAGAAAACACTTCAGACCCACCCCCGATGCCTGCCGGGCCGCTTAT
[0086] AACTGGAAGATGGCCGGAGACACCAGATACGAGGAGAGCCTGCACAGCCCCTACCCCG
[0087] ACTACCACTGGCTGAGAACCGTGAAGACCACCAAGGAAAGCCTGGTGATCATCTCTCCC
[0088] TCCGTGGCCAACCTGGACCCCTACGACAACAGCCTGCACTCCAGAGTGTTCCCCTCCGG
[0089] CAAGTGCTCCGGCATCACCGTGCCCAGCGTGTACTGTTCCACTAACCACGACTACACCG
[0090] TGTGGATGCCCGAGATCCTGAGACTGGGCACATCCTGCGACATCTTTACCAACAGCAGA
[0091] GGCAAGAGGGCTAGCAAAGGGTCTAAAACCTGCGGCTTCGTGGACGAGAGAGGCCTGT
[0092] ACAAGAGCCTGAAGGGCGCCTGCAAACTGAAGCTGTGTGGCGTGCCTGGCCTGAGACT
[0093] GATGGACGGAACCTGGGTGGCTATGCAGACAAGCAATGAGACGAAGTGGTGTCCTCCC
[0094] GGACAGCTGGTGAACCTGCATGACCTGCACTCAGACGAGATTGAGCACCTGGTGGTGG
[0095] AGGAGCTGGTGAAGAAGAGGGAGGAGTGCCTGGACGCCCTGGAGAGCATCATCACAA
[0096] CCAAGAGCGTGAGTTTCAGAAGACTGAGCCACCTGAGAAAGCTGGTGCCAGGCTTCGG
[0097] CAAGGCCTACACCATCTTCAACAAGACACTGATGGAGGCCGAGGCCCACTACAAGAGC
[0098] GTGAGAACATGGAACGAGATCATCCCCAGCAAAGGCTGCCTGCGCGTGGGCGGACGGT
[0099] GCCACCCTCATGTGAACGGGGTGTTCTTCAACGGCATCATCCTGGGACCCGACGGCCAC
[0100] GTGCTGATCCCCGAAATGCAGAGCAGCCTGCTGCAGCAGCACATTGAGCTGCTGGAGTC
[0101] CTCCGTGATCCCCCTGATGCATCCCCTGGCCGACCCATTCACCGTGTTCAAGGACGGCGA
[0102] TGAAATTGAAGACTTCGTGGAAGTGCACCTGCCCGACGTGCACGAGCAGGTGAGCGGC
[0103] GTGGATCTGGGCCTGCCTAACTGGGGCGAATATGTGCTGCTGAGTGCCGGCACACTGAT
[0104] TGCCCTGATGCTGATCATTTTTCTGATCACCTGTTGTAAGAGAGTGGACCGGCCAGAGA
[0105] GTACCCAGAGATCCCTGAGAGGGACAGGCAGGAACGTGAGCGTGACCAGCCAGAGCG
[0106] GGAAGTTCATCCCCAGCTGGGAGAGCTACAAGAGCGGGGGCGAGACAGGACTGGGCG
[0107] GAGGAGGAAGCATGGTGCCCCAGGCCCTGCTGCTGGTGCCCCTGCTGGGATTCTCCCTG
[0108] TGCTTCGGCAAGTTCCCCATCTACACCATCCCCGACACCCTGGGCCCCTGGAGCCCTATC
[0109] GACATCCACCACCTGTCCTGCCCCAATAACCTGGTGGTGGAAGACGAGGGCTGCACCA
[0110] ACCTGAGCGGCTTCTCCTACATGGAACTGAAAGTGGGCCACATCTCCGCCATCAAAGTG
[0111] AACGGCTTCACCTGCACCGGCGTGGTGACCGAAGCCGAAACATACACAAACTTCGTGG
[0112] GCTACGTGACCACCACCTTCAAGAGAAAACACTTCAGACCCACCCCCGATGCCTGCCG
[0113] GGCCGCTTATAACTGGAAGATGGCCGGAGACACCAGATACGAGGAGAGCCTGCACAGC
[0114] CCCTACCCCGACTACCACTGGCTGAGAACCGTGAAGACCACCAAGGAAAGCCTGGTGA
[0115] TCATCTCTCCCTCCGTGGCCAACCTGGACCCCTACGACAACAGCCTGCACTCCAGAGTG
[0116] TTCCCCTCCGGCAAGTGCTCCGGCATCACCGTGCCCAGCGTGTACTGTTCCACTAACCA
[0117] CGACTACACCGTGTGGATGCCCGAGATCCTGAGACTGGGCACATCCTGCGACATCTTTA
[0118] CCAACAGCAGAGGCAAGAGGGCTAGCAAAGGGTCTAAAACCTGCGGCTTCGTGGACG
[0119] AGAGAGGCCTGTACAAGAGCCTGAAGGGCGCCTGCAAACTGAAGCTGTGTGGCGTGCC
[0120] TGGCCTGAGACTGATGGACGGAACCTGGGTGGCTATGCAGACAAGCAATGAGACGAAG
[0121] TGGTGTCCTCCCGGACAGCTGGTGAACCTGCATGACCTGCACTCAGACGAGATTGAGCA
[0122] CCTGGTGGTGGAGGAGCTGGTGAAGAAGAGGGAGGAGTGCCTGGACGCCCTGGAGAG
[0123] CATCATCACAACCAAGAGCGTGAGTTTCAGAAGACTGAGCCACCTGAGAAAGCTGGTG
[0124] CCAGGCTTCGGCAAGGCCTACACCATCTTCAACAAGACACTGATGGAGGCCGAGGCCC
[0125] ACTACAAGAGCGTGAGAACATGGAACGAGATCATCCCCAGCAAAGGCTGCCTGCGCGT
[0126] GGGCGGACGGTGCCACCCTCATGTGAACGGGGTGTTCTTCAACGGCATCATCCTGGGAC
[0127] CCGACGGCCACGTGCTGATCCCCGAAATGCAGAGCAGCCTGCTGCAGCAGCACATTGA
[0128] GCTGCTGGAGTCCTCCGTGATCCCCCTGATGCATCCCCTGGCCGACCCATTCACCGTGTT
[0129] CAAGGACGGCGATGAAATTGAAGACTTCGTGGAAGTGCACCTGCCCGACGTGCACGAG
[0130] CAGGTGAGCGGCGTGGATCTGGGCCTGCCTAACTGGGGCGAATATGTGCTGCTGAGTGC
[0131] CGGCACACTGATTGCCCTGATGCTGATCATTTTTCTGATCACCTGTTGTAAGAGAGTGGA
[0132] CCGGCCAGAGAGTACCCAGAGATCCCTGAGAGGGACAGGCAGGAACGTGAGCGTGAC
[0133] CAGCCAGAGCGGGAAGTTCATCCCCAGCTGGGAGAGCTACAAGAGCGGGGGCGAGAC
[0134] AGGACTGGACTACAAGGATGATGACGATAAATAA
[0135] The amino acid sequence of the G-L-G antigen is shown in SEQ ID NO.10:
[0136] MVPQALLLVPLLGFSLCFGKFPIYTIPDTLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGHISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDTRYEESLHSPYPDYHWLRTVKTKESLVIISPSVANLDPYDNSLHSRVFPSGKCSGITVPSVYCSTNHDYTVWMPEIRLGTSCDIFTNSRGKRASKGSKTCGFVDERGLYKSLKGACKLKLCGVPGLRLMDGTWVAMQTSNETKWCPPGQLVNLHDLHSDEIEHLVVEELVKKREECLDALESIITTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEAEAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGPDGHVLIPEMQSSLLQQHIELLESSVIPLMHPLADPFTVFKDGDEIEDFVEVHLPDVHEQVSGVDLGLPNWGEYVLLSAGTLIALMLIIFLITCCKRVDRPESTQRSLRGTGRNVSVTSQSGKFIPSWESYKSGGETGL GGGGSMVPQALLLVPLLGFSLCFGKFPIYTIPDTLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGHISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDTRYEESLHSPYPDYHWLRTVKTTKESLVIISPSVANLDPYDNSLHSRVFPSGKCSGITVPSVYCSTNHDYTVWMPEILRLGTSCDIFTNSRGKRASKGSKTCGFVDERGLYKSLKGACKLKLCGVPGLRLMDGTWVAMQTSNETKWCPPGQLVNLHDLHSDEIEHLVVEELVKKREECLDALESIITTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEAEAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGPDGHVLIPEMQSSLLQQHIELLESSVIPLMHPLADPFTVFKDGDEIEDFVEVHLPDVHEQVSGVDLGLPNWGEYVLLSAGTLIALMLIIFLITCCKRVDRPESTQRSLRGTGRNVSVTSQSGKFIPSWESYKSGGETGLDYKDDDDK, where the bold and underlined part is L, SEQ ID NO: 18.
[0137] The mRNA sequence of the G-L-G antigen is as shown in SEQ ID NO: 12:
[0138]
[0139] The DNA sequence of the G-Fc antigen is shown in SEQ ID NO: 6:
[0140] ATGGTGCCCCAGGCCCTGCTGCTGGTGCCCCTGCTGGGATTCTCCCTGTGCTTCGGCAA
[0141] GTTCCCCATCTACACCATCCCCGACACCCTGGGCCCCTGGAGCCCTATCGACATCCACCA
[0142] CCTGTCCTGCCCCAATAACCTGGTGGTGGAAGACGAGGGCTGCACCAACCTGAGCGGC
[0143] TTCTCCTACATGGAACTGAAAGTGGGCCACATCTCCGCCATCAAAGTGAACGGCTTCAC
[0144] CTGCACCGGCGTGGTGACCGAAGCCGAAACATACACAAACTTCGTGGGCTACGTGACC
[0145] ACCACCTTCAAGAGAAAACACTTCAGACCCACCCCCGATGCCTGCCGGGCCGCTTATAA
[0146] CTGGAAGATGGCCGGAGACACCAGATACGAGGAGAGCCTGCACAGCCCCTACCCCGAC
[0147] TACCACTGGCTGAGAACCGTGAAGACCACCAAGGAAAGCCTGGTGATCATCTCTCCCTC
[0148] CGTGGCCAACCTGGACCCCTACGACAACAGCCTGCACTCCAGAGTGTTCCCCTCCGGCA
[0149] AGTGCTCCGGCATCACCGTGCCCAGCGTGTACTGTTCCACTAACCACGACTACACCGTG
[0150] TGGATGCCCGAGATCCTGAGACTGGGCACATCCTGCGACATCTTTACCAACAGCAGAGG
[0151] CAAGAGGGCTAGCAAAGGGTCTAAAACCTGCGGCTTCGTGGACGAGAGAGGCCTGTAC
[0152] AAGAGCCTGAAGGGCGCCTGCAAACTGAAGCTGTGTGGCGTGCCTGGCCTGAGACTGA
[0153] TGGACGGAACCTGGGTGGCTATGCAGACAAGCAATGAGACGAAGTGGTGTCCTCCCGG
[0154] ACAGCTGGTGAACCTGCATGACCTGCACTCAGACGAGATTGAGCACCTGGTGGTGGAG
[0155] GAGCTGGTGAAGAAGAGGGAGGAGTGCCTGGACGCCCTGGAGAGCATCATCACAACC
[0156] AAGAGCGTGAGTTTCAGAAGACTGAGCCACCTGAGAAAGCTGGTGCCAGGCTTCGGCA
[0157] AGGCCTACACCATCTTCAACAAGACACTGATGGAGGCCGAGGCCCACTACAAGAGCGT
[0158] GAGAACATGGAACGAGATCATCCCCAGCAAAGGCTGCCTGCGCGTGGGCGGACGGTGC
[0159] CACCCTCATGTGAACGGGGTGTTCTTCAACGGCATCATCCTGGGACCCGACGGCCACGT
[0160] GCTGATCCCCGAAATGCAGAGCAGCCTGCTGCAGCAGCACATTGAGCTGCTGGAGTCCT
[0161] CCGTGATCCCCTGATGCATCCCCTGGCCGACCCATTCACCGTGTTCAAGGACGGCGAT
[0162] GAAATTGAAGACTTCGTGGAAGTGCACCTGCCCGACGTGCACGAGCAGGTGAGCGGCG
[0163] TGGATCTGGGCCTGCCTAACTGGGGCGAATATGTGCTGCTGAGTGCCGGCACACTGATT
[0164] GCCCTGATGCTGATCATTTTTCTGATCACCTGTTGTAAGAGAGTGGACCGGCCAGAGAGT
[0165] ACCCAGAGATCCCTGAGAGGGACAGGCAGGAACGTGAGCGTGACCAGCCAGAGCGGG
[0166] AAGTTCATCCCCAGCTGGGAGAGCTACAAGAGCGGGGGCGAGACAGGACTGGGCGGA
[0167] GGAGGAAGCGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGG
[0168] GACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACC
[0169] CCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCA
[0170] ACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCA
[0171] GTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGA
[0172] ATGGCAAGGAGTACAAGTGCAAGGTGTCCAACAAAGCCCTCCCAGCCCCCATCGAGAA
[0173] AACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCA
[0174] TCCCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCT
[0175] ATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAA
[0176] GACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCG
[0177] TGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCACGAGGC
[0178] TCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAAGACTACAAGG
[0179] ATGATGACGATAAATGA
[0180] The amino acid sequence of the G-Fc antigen is shown in SEQ ID NO: 4:
[0181] MVPQALLLVPLLGFSLCFGKFPIYTIPDTLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGHISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDTRYEESLHSPYPDYHWLRTVKTTKESLVIISPSVANLDPYDNSLHSRVFPSGKCSGITVPSVYCSTNHDYTVWMPEILRLGTSCDIFTNSRGKRASKGSKTCGFVDERGLYKSLKGACKLKLCGVPGLRLMDGTWVAMQTSNETKWCPPGQLVNLHDLHSDEIEHLVVEELVKKREECLDALESIITTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEAEAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGPDGHVLIPEMQSSLLQQHIELLESSVIPLMHPLADPFTVFKDGDEIEDFVEVHLPDVHEQVSGVDLGLPNWGEYVLLSAGTLIALMLIIFLITCCKRVDRPESTQRSLRGTGRNVSVTSQSGKFIPSWESYKSGGETGLGGGGSDKTHTCPPCPAPELLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSHEDPEVKFNWYVDGVEVHNAKTKPREEQYNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKALPAPIEKTISKAKGQPREPQVYTLPPSREEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSKLTVDKSRWQQGNVFSCSVMHEALHNHYTQKSLSLSPGKDYKDDDDK
[0182] The mRNA sequence of the G-Fc antigen is shown in SEQ ID NO: 7:
[0183]
[0184] The DNA sequence of the G-Folden antigen is shown in SEQ ID NO: 8:
[0185] ATGGTGCCCCAGGCCCTGCTGCTGGTGCCCCTGCTGGGATTCTCCCTGTGCTTCGGC
[0186] AAGTTCCCCATCTACACCATCCCCGACACCCTGGGCCCCTGGAGCCCTATCGACATCCAC
[0187] CACCTGTCCTGCCCCAATAACCTGGTGGTGGAAGACGAGGGCTGCACCAACCTGAGCG
[0188] GCTTCTCCTACATGGAACTGAAAGTGGGCCACATCTCCGCCATCAAAGTGAACGGCTTC
[0189] ACCTGCACCGGCGTGGTGACCGAAGCCGAAACATACACAAACTTCGTGGGCTACGTGA
[0190] CCACCACCTTCAAGAGAAAACACTTCAGACCCACCCCCGATGCCTGCCGGGCCGCTTAT
[0191] AACTGGAAGATGGCCGGAGACACCAGATACGAGGAGAGCCTGCACAGCCCCTACCCCG
[0192] ACTACCACTGGCTGAGAACCGTGAAGACCACCAAGGAAAGCCTGGTGATCATCTCTCCC
[0193] TCCGTGGCCAACCTGGACCCCTACGACAACAGCCTGCACTCCAGAGTGTTCCCCTCCGG
[0194] CAAGTGCTCCGGCATCACCGTGCCCAGCGTGTACTGTTCCACTAACCACGACTACACCG
[0195] TGTGGATGCCCGAGATCCTGAGACTGGGCACATCCTGCGACATCTTTACCAACAGCAGA
[0196] GGCAAGAGGGCTAGCAAAGGGTCTAAAACCTGCGGCTTCGTGGACGAGAGAGGCCTGT
[0197] ACAAGAGCCTGAAGGGCGCCTGCAAACTGAAGCTGTGTGGCGTGCCTGGCCTGAGACT
[0198] GATGGACGGAACCTGGGTGGCTATGCAGACAAGCAATGAGACGAAGTGGTGTCCTCCC
[0199] GGACAGCTGGTGAACCTGCATGACCTGCACTCAGACGAGATTGAGCACCTGGTGGTGG
[0200] AGGAGCTGGTGAAGAAGAGGGAGGAGTGCCTGGACGCCCTGGAGAGCATCATCACAA
[0201] CCAAGAGCGTGAGTTTCAGAAGACTGAGCCACCTGAGAAAGCTGGTGCCAGGCTTCGG
[0202] CAAGGCCTACACCATCTTCAACAAGACACTGATGGAGGCCGAGGCCCACTACAAGAGC
[0203] GTGAGAACATGGAACGAGATCATCCCCAGCAAAGGCTGCCTGCGCGTGGGCGGACGGT
[0204] GCCACCCTCATGTGAACGGGGTGTTCTTCAACGGCATCATCCTGGGACCCGACGGCCAC
[0205] GTGCTGATCCCCGAAATGCAGAGCAGCCTGCTGCAGCAGCACATTGAGCTGCTGGAGTC
[0206] CTCCGTGATCCCCCTGATGCATCCCCTGGCCGACCCATTCACCGTGTTCAAGGACGGCGA
[0207] TGAAATTGAAGACTTCGTGGAAGTGCACCTGCCCGACGTGCACGAGCAGGTGAGCGGC
[0208] GTGGATCTGGGCCTGCCTAACTGGGGCGAATATGTGCTGCTGAGTGCCGGCACACTGAT
[0209] TGCCCTGATGCTGATCATTTTTCTGATCACCTGTTGTAAGAGAGTGGACCGGCCAGAGA
[0210] GTACCCAGAGATCCCTGAGAGGGACAGGCAGGAACGTGAGCGTGACCAGCCAGAGCG
[0211] GGAAGTTCATCCCCAGCTGGGAGAGCTACAAGAGCGGGGGCGAGACAGGACTGGGCG
[0212] GAGGAGGAAGCGGCTATATCCCAGAGGCCCCCAGAGACGGACAGGCTTACGTGAGAAA
[0213] GGACGGCGAGTGGGTGCTGCTGAGCACATTCCTGGACTACAAGGATGATGACGATAAAT
[0214] GA
[0215] The amino acid sequence of the G-Folden antigen is shown in SEQ ID NO: 5:
[0216] MVPQALLLVPLLGFSLCFGKFPIYTIPDTLGPWSPIDIHHLSCPNNLVVEDEGCTNLSGFSYMELKVGHISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDTRYEESLHSPYPDYHWLRTVKTTKESLVIISPSVANLDPYDNSLHSRVFPSGKCSGITVPSVYCSTNHDYTVWMPEILRLGTSCDIFTNSRGKRASKGSKTCGFVDERGLYKSLKGACKLKLCGVPGLRLMDGTWVAMQTSNETKWCPPGQLVNLHDLHSDEIEHLVVEELVKKREECLDALESIITTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEAEAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGPDGHVLIPEMQSSLLQQHIELLESSVIPLMHPLADPFTVFKDGDEIEDFVEVHLPDVHEQVSGVDLGLPNWGEYVLLSAGTLIALMLIIFLITCCKRVDRPESTQRSLRGTGRNVSVTSQSGKFIPSWESYKSGGETGLGGGGSGYIPEAPRDGQAYVRKDGEWVLLSTFLDYKDDDDK
[0217] The mRNA sequence of the G-Folden antigen is shown in SEQ ID NO: 9:
[0218] GAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCGCUAGCCU
[0219] CGAGGCCACCAUGGACGCCAUGAAGAGGGGGCUGUGCUGCGUGCUGCUGCUGUGCG
[0220] GAGCCGUGUUCGUGAGCGCCUCCAUGGACGCCAUGAAGAGGGGGCUGUGCUGCGUG
[0221] CUGCUGCUGUGCGGAGCCGUGUUCGUGAGCGCCUCCAUGGUGCCCCAGGCCCUGCUG
[0222] CUGGUGCCCCUGCUGGGAUUCUCCCUGUGCUUCGGCAAGUUCCCCAUCUACACCAUC
[0223] CCCGACACCCUGGGCCCCUGGAGCCCUAUCGACAUCCACCACCUGCCUGCCCCAAU
[0224] AACCUGGUGGGGGAAGCGAGGGCUGCACCAACCUGAGCGGCUUCUCCCUACAUGGA
[0225] ACUGAAAGUGGGCCACAUCUCCGCCCAUCAAAGUGAACGGCUUCACCUGCACCGGCGU
[0226] GGUGACCGAAGCCGAAACAUACACAAACUUCGUGGCUACGUGACCACCACCUUCA
[0227] AGAGAAAACACUCAUCAGACCCACCCCCGAUGCCCUGGCGGCCGCUUAAACUGGAAGA
[0228] UGGCCGGAGACACCAGUACGAGGAGAGCCUGCACAGCCCCUACCCCCGACUACCACU
[0229] GGCUGAGAACCGUGAAGACCACCAAGGAAAGCCUGGUGAUCAUCUCUCCCUCCGUG
[0230] GCCAACCUGGACCCCUACGACAACAGCCUGCACUCCAGAGUGUUCCCCUCCGGCAAG
[0231] UGCUCCGGCAUCACCGUGCCCAGCGUGUACUGUUCCACUAACCACGACUACACCGUG
[0232] UGGAUGCCCGAGAUCCUGAGACUGGGCACUCCUGCGACAUCUUUACCAACAGCAG
[0233] AGGCAAGAGGGCUAGCAAAGGGUCUAAAACCUGCGGCUUCGUGGACGAGAGAGGCC
[0234] UGUACAAGAGCCUGAAGGGCGCCUGCAAACUGAAGCUGUGUGGCGUGCCUGGCCUG
[0235] AGACUGAUGGACGGAACCUGGGUGGCUAUGCAGACAAGCAAUGAGACGAAGUGGUG
[0236] UCCUCCCGGACAGCUGGUGAACCUGCAUGACCUGCACUCAGACGAGAUUGAGCACCU
[0237] GGUGGUGGAGGAGCUGGUGAAGAAGAGGGAGGAGUGCCUGGACGCCCUGGAGAGCA
[0238] UCAUCACAACCAAGAGCGUGAGUUUCAGAAGACUGAGCCACCUGAGAAAGCUGGUG
[0239] CCAGGCUUCGGCAAGGCCUACACCAUCUUCAACAAGACACUGAUGGAGGCCGAGGCC
[0240] CACUACAAGAGCGUGAGAACAUGGAACGAGAUCAUCCCCAGCAAAGGCUGCCUGCG
[0241] CGUGGGCGGACGGUGCCACCCUCAUGUGAACGGGGUGUUCUUCAACGGCAUCAUCC
[0242] UGGGACCCGACGGCCACGUGCUGAUCCCCGAAAUGCAGAGCAGCCUGCUGCAGCAGC
[0243] ACAUUGAGCUGCUGGAGUCCUCCGUGAUCCCCCUGAUGCAUCCCCUGGCCGACCCAU
[0244] UCACCGUGUUCAAGGACGGCGAUGAAAUUGAAGACUUCGUGGAAGUGCACCUGCCC
[0245] GACGUGCACGAGCAGGUGAGCGGCGUGGAUCUGGGCCUGCCUAACUGGGGCGAAUA
[0246] UGUGCUGCUGAGUGCCGGCACACUGAUUGCCCUGAUGCUGAUCAUUUUUCUGAUCA
[0247] CCUGUUGUAAGAGAGUGGACCGGCCAGAGAGUACCCAGAGAUCCCUGAGAGGGACA
[0248] GGCAGGAACGUGAGCGUGACCAGCCAGAGCGGGAAGUUCAUCCCCAGCUGGGAGAG
[0249] CUACAAGAGCGGGGGCGAGACAGGACUGGGCGGAGGAGGAAGCGGCUAUAUCCCAG
[0250] AGGCCCCCAGAGACGGCAGGCUUACGUGAGAAAGGACGGCGAGUGGGUGCUGCUG
[0251] AGCACAUUCCUGGACUACAAGGAUGAUGACGAUAAAUAAGGUACCGAUAUCUGAUA
[0252] AUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCU
[0253] CCUCCCCUUCCUGACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAAAAAAAAAA
[0254] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.
[0255] Example 2. mRNA transcription verification experiment
[0256] The plasmids pUC57-G, pUC57-GLG, pUC57-G-Fc, and pUC57-G-Folden obtained in Example 1 were digested with Bsa I restriction endonuclease from Novizan Biosciences and linearized by reacting at 37°C for 1 hour. DNA templates were recovered using a DNA recovery kit from TransGen. The linearization system is shown in Table 1.
[0257] Table 1. Plasmid linearization reaction system
[0258]
[0259] mRNA was synthesized in vitro using the T7 transcription kit from Yisheng Biotechnology, and a 5' capping structure was added to the mRNA using Cap101 from Cangzhou Weikexin Biotechnology. The reaction was carried out at 37℃ for 3 hours, with specific reaction conditions as shown in Table 2. After the reaction, 1.5 volumes of lithium chloride solution were added to the system, and the mixture was incubated at -20℃ for 1 hour to precipitate the mRNA. Subsequently, the mixture was centrifuged at 10000 rpm for 10 minutes, the supernatant was removed, and the mRNA was redissolved in DEPC-treated water. The RNA concentration was determined using a Nanodrop device and stored at -80℃. A 1% agarose gel was prepared and electrophoresis was performed to evaluate the quality of the synthesized RNA. The results are shown below. Figure 1 As shown.
[0260] from Figure 1 It can be seen that the bands of the four in vitro synthesized mRNAs, including the mRNAs of the G antigen, GLG antigen, G-Fc antigen, and G-Folden antigen, are clear, single, and consistent with the expected size.
[0261] Table 2 In vitro transcription reaction system
[0262]
[0263] Example 3. Protein Expression Validation Assay
[0264] The mRNA synthesized in vitro in Example 2 was introduced into HEK-293T cells using TransGen's PEI transfection reagent, and its expression capacity was examined by Western blot experiments. First, 293T cells were evenly seeded into 24-well culture plates, and then PEI was used for mRNA transfection, with 0.8 μg of mRNA added to each well, following the manufacturer's instructions. After 48 hours of culture, cell samples were collected and analyzed by SDS-PAGE electrophoresis. After electrophoresis, the proteins were transferred to a PVDF membrane. The membrane was then blocked overnight with 5% skim milk powder and incubated with TransGen's anti-FLAG-tagged monoclonal antibody and TransGen's HRP-labeled goat anti-rabbit IgG secondary antibody. After incubation at room temperature for 1 hour, ECL chemiluminescence was performed using Beyotime Biotechnology's ECL chromogenic solution to obtain the Western blot results, as shown below. Figure 2 As shown.
[0265] from Figure 2As can be seen, compared with the blank control group, the experimental group transfected with four mRNAs (mRNA of G antigen, mRNA of GLG antigen, mRNA of G-Fc antigen, and mRNA of G-Folden antigen) all showed specific and uniform bands on the Western blotting, consistent with the expected protein sizes. This confirms that the mRNA can successfully express the protein in the cell. Non-denaturing electrophoresis revealed that G-Fc protein can form a dimer and G-Folden protein can form a trimer, consistent with expectations.
[0266] Example 4. Preparation of mRNA vaccine
[0267] The four mRNAs obtained in Example 2 (mRNA of G antigen, mRNA of GLG antigen, mRNA of G-Fc antigen, and mRNA of G-Folden antigen) were packaged and prepared as an mRNA vaccine (LNP-mRNA vaccine).
[0268] The specific experimental steps are as follows: First, an alcohol phase was prepared by dissolving lipids (SM102), distearate phosphatidylcholine (DSPC), cholesterol, and DMG-2000 in anhydrous ethanol at a ratio of 50:10:38.5:1.5 (mass ratio). Next, an aqueous phase was prepared using 50 mM citrate buffer (pH 4.0) as the medium for dissolving mRNA. The mRNA was packaged using a microfluidic device with the alcohol and aqueous phases (volume ratio 1:3). Then, it was diluted with RNase-free PBS buffer and concentrated using a 30 kDa ultrafiltration tube. An equal volume of 20% sucrose PBS solution was added to adjust the mRNA concentration to 100 μg / ml, with a sucrose concentration of 10%. Finally, after filtration through a 0.22μm filter membrane, four LNP-mRNA vaccines were prepared: an mRNA vaccine for the G antigen, an mRNA vaccine for the GLG antigen, an mRNA vaccine for the G-Fc antigen, and an mRNA vaccine for the G-Folden antigen. After being aliquoted, they were stored at -20℃.
[0269] The liposome nanoparticles contain at least one of cationic lipids, distearate phosphatidylcholine (DSPC), cholesterol, and DMG-2000.
[0270] Particle size distribution was detected by dynamic light, and the results are as follows: Figure 3 As shown, from Figure 3 It can be seen that all four LNP-mRNA vaccines prepared exhibit uniform particle size, with a particle size of approximately 120 nm.
[0271] Example 5. Mouse Immunological Evaluation Experiment
[0272] Mice were immunized with the four mRNA vaccines prepared in Example 4, and their immunization effects were evaluated. Thirty 8-week-old SPFBALB / c mice purchased from Liaoning Changsheng Biotechnology Co., Ltd. were randomly divided into 6 groups of 5 mice each. Each group was immunized with 20 μg of one of the four mRNA vaccines, 20 μL of Invet rabies inactivated vaccine as a positive control, and 100 μL of PBS as a negative control. A single immunization was administered, and blood was collected 21 days later for neutralizing antibody detection. Neutralizing antibody detection was performed using the FAVN method, as detailed below:
[0273] Inactivate the serum to be tested at 56°C for 30 minutes. Dilute the positive control serum to 0.5 IU / ml. Add 100 μl of DMEM medium containing 2% newborn calf serum to each well of a 96-well cell culture plate. Add 50 μl of the serum to be tested to each well and mix thoroughly with the DMEM medium. Transfer 50 μl to the next column for a 3-fold serial dilution, discarding the excess 50 μl. Perform 3-fold serial dilutions of the diluted standard serum and negative serum in the same manner. Dilute the rabies virus CVS-11 cytotoxic agent to 2000 TCID using 2% newborn calf serum in DMEM medium. 50 / ml, take 50μl (100TCID) 50 Add 50 μl (100 TCID50) to each well (except for the virus control wells and cell control wells); simultaneously, add 50 μl (100 TCID50) to the first column of the virus control wells. 50 After mixing CVS-11, dilute sequentially in 3-fold serial dilutions. Incubate the cell culture plates at 37°C and 5% CO2 for 60 minutes. Add 50 μl of BHK-21 cell suspension dispersed in MEM medium with 2% newborn calf serum to each well. A cell control group is also included. Incubate at 37°C and 5% CO2 for approximately 48 hours. Discard the cell culture supernatant, add 80% acetone solution, fix at -15°C for 20 minutes, discard the fixative, and air dry for 10–20 minutes until completely dry. Dilute the fluorescent antibody to the working concentration with PBS (0.01 mol / L, pH 7.2–7.4), 50 μl per well, and incubate at 37°C for 45–60 minutes. Discard the fluorescent antibody staining solution. Wash the plate three times with PBST (0.01 mol / L, pH 7.2–7.4, PBS containing 0.05% Tween 20), 3 minutes each time. Add 50 μl of 80% acetone solution (80 parts acetone + 20 parts water for injection) to each well. Observe under an inverted fluorescence microscope: no fluorescence should appear in the cell control and positive control sera; the total number of wells with specific fluorescent foci in the control virus should be 12–17, at which point the actual virus titer is 50–200 TCID. 50 / 50μl, FAVN detection is valid; all negative serum control wells should show bright apple green fluorescence for the test to be valid.
[0274] Specific results are as follows Figure 4 As shown, from Figure 4 It can be seen that the levels of neutralizing antibodies produced by the four mRNA vaccine groups were higher than those in the positive control group. Among them, the mRNA vaccine group with G-Fc antigen had the highest level of neutralizing antibodies, followed by the mRNA vaccine group with G-Folden antigen. The levels of neutralizing antibodies in the mRNA vaccine group with GLG antigen were basically the same as those in the mRNA vaccine group with GLG antigen. These results indicate that all four mRNA vaccines can effectively induce mice to produce neutralizing antibodies against rabies virus.
[0275] Example 6. Canine Immunological Evaluation Experiment
[0276] The four mRNA vaccines prepared in Example 4 were used to immunize dogs, and their immunization effects were evaluated. Eighteen beagles purchased from Tianjin Kangwens Biotechnology were randomly divided into 6 groups of 3 dogs each. Each group received 45 μg of one of the four mRNA vaccines, 1 mL of Invet rabies inactivated vaccine as a positive control, and 1 mL of PBS as a negative control. Each group received one injection. Blood samples were collected 21 days later for neutralizing antibody testing. The neutralizing antibody test was performed using the FAVN method (GB / T 201117 / 97-T-326). The results are as follows: Figure 5 As shown.
[0277] from Figure 5 It can be seen that the results of neutralizing antibody detection in dogs are basically consistent with those in mice. All four mRNA vaccines can effectively induce dogs to produce neutralizing antibodies against rabies virus, and all are superior to the inactivated vaccine group.
[0278] Example 7. Dog Safety Evaluation Experiment
[0279] The four mRNA vaccines prepared in Example 4 were administered as a single overdose immunization to dogs, and their safety was evaluated. Five 3-month-old, clinically healthy dogs with negative rabies neutralizing antibodies were immunized via intramuscular injection with a single dose (1 ml / dog). A non-immunized control group of five dogs was also included. Body temperature was measured on day 14, and local changes after vaccination and clinical manifestations of the immunized dogs were observed and recorded. The experimental dogs were necropsyed on day 14, and histological sections were stained. The results are as follows: Figure 6 As shown.
[0280] from Figure 6 As can be seen, the intramuscular injection sites in the dogs showed normal local manifestations. No adverse reactions such as redness, swelling, rash, induration, tenderness, necrosis, suppuration, or hair loss were observed at the injection sites. Body temperature did not change significantly after vaccination. All dogs in both the experimental and control groups showed normal health status, including appetite, behavior, mental state, and defecation. Autopsy observation revealed good vaccine absorption at the injection sites, and no abnormalities were observed visually in any organs. Histological examination revealed no pathological changes. Therefore, single-dose injections of the mRNA vaccine in all four groups were safe for dogs.
[0281] In summary, the mRNA vaccine for the prevention and / or treatment of rabies of the present invention is based on the rabies virus G protein antigen, which is further optimized. The gene sequence of the optimized antigen is further optimized through codon optimization to improve translation efficiency. Furthermore, attempts were made to add a tag sequence Fc or Folden to the nucleotide sequence of the optimized G protein antigen, resulting in mRNA vaccines encoding G-Fc or G-Folden protein. An mRNA vaccine encoding GLG protein was also designed. Unexpectedly, it was found that the rabies mRNA vaccines we designed can effectively induce the production of rabies virus neutralizing antibodies, and their immunogenicity is superior to that of existing inactivated rabies vaccines. Moreover, the mRNA vaccine encoding G-Folden protein has the best immunogenicity, followed by the mRNA vaccine encoding G-Fc protein, while the mRNA vaccine encoding GLG protein has a slightly weaker immunogenicity than the mRNA vaccine encoding G protein.
[0282] Furthermore, to obtain a superior mRNA vaccine, a signal peptide was added before the polynucleotide sequence encoding the protein to increase protein secretion. Additionally, a T7 promoter, a 5'UTR, and a 5' capping structure were added to the front of the signal peptide sequence, and a 3'UTR and a polyA tail were added to the rear of the polynucleotide sequence to improve the translation efficiency and stability of the mRNA vaccine, thus constructing a candidate mRNA vaccine expressing the antigen. Furthermore, a candidate mRNA vaccine with high secretion levels was constructed by expressing the rabies virus G protein and its fusion protein.
[0283] Furthermore, experiments showed that immunization of mice with the constructed rabies mRNA vaccine induced high levels of neutralizing antibodies against RV. Safety experiments demonstrated the safety of the prepared mRNA vaccine. Canine challenge experiments showed that the mRNA vaccine had a good protective effect against rabies virus, indicating that the mRNA vaccine has a protective effect against rabies virus. Safety experiments verified that the four constructed rabies mRNA vaccines have good safety profiles.
[0284] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
[0285] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. A polynucleotide comprising at least one first nucleotide sequence encoding a rabies virus G protein or an immunogenic fragment thereof, wherein the amino acid sequence of the rabies virus G protein or the immunogenic fragment thereof has at least 85%, 90%, 95%, 96%, 97%, 98% or 99% homology with SEQ ID NO:
1.
2. The polynucleotide according to claim 1, characterized in that, The sequence of the first nucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 2 or SEQ ID NO:
3.
3. The polynucleotide according to claim 1 or 2, characterized in that, The polynucleotide also includes a second nucleotide encoding the tag protein Fc or Folden; Preferably, when the second nucleotide encodes the tag protein Fc, the polynucleotide encodes the G-Fc protein or its immunogenic fragment, and the amino acid sequence of the G-Fc protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 4; or When the second nucleotide encodes the tag protein Folden, the polynucleotide encodes the G-Folden protein or its immunogenic fragment, and the amino acid sequence of the G-Folden protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO:
5.
4. The polynucleotide according to claim 3, characterized in that, When the polynucleotide encodes the G-Fc protein or its immunogenic fragment, the polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 6 or 7; or When the polynucleotide encodes the G-Folden protein or its immunogenic fragment, the polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 8 or 9.
5. The polynucleotide according to claim 1, characterized in that, The polynucleotide comprises two first nucleotide sequences encoding a rabies virus G protein or an immunogenic fragment thereof, the two first nucleotides being linked by a linker (L), the amino acid sequence of the L comprising one or more polypeptide fragments as shown in SEQ ID NO:18, the polynucleotide encoding a GLG protein or an immunogenic fragment thereof, the amino acid sequence of the GLG protein or the immunogenic fragment thereof having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology to SEQ ID NO:10; Preferably, the polynucleotide has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 11 or 12.
6. The polynucleotide according to any one of claims 1 to 5, characterized in that, The 5' end of the polynucleotide is also attached to a third nucleotide sequence encoding a signal peptide. Preferably, the signal peptide is tPA, IL-2, IL-6 or a neuropeptide, and the neuropeptide is preferably VIP, CGRP or NPY; More preferably, the 5' end of the third nucleotide sequence is connected to a 5' UTR sequence, and the nucleotide sequence of the 5' UTR sequence is preferably as shown in SEQ ID NO: 13, or The 3' end of the polynucleotide is further connected to a 3'UTR sequence, and the end of the 3'UTR sequence is further connected to a PolyA sequence. The nucleotide sequence of the 3'UTR sequence is preferably as shown in SEQ ID NO:
14. Preferably, the 5' end of the 5' UTR sequence is further provided with a T7 promoter, the nucleotide sequence of which is shown in SEQ ID NO: 15, and the polynucleotide is preferably provided with a FLAG tag.
7. The polynucleotide according to any one of claims 1 to 6, characterized in that, The polynucleotide is DNA or RNA; preferably, when the polynucleotide is RNA, the 5' end of the 5' UTR sequence of the RNA is further provided with a 5' capping structure, and the 5' capping structure is preferably Cap1, Cap2, Cap3, Cap4 or Cap101.
8. A vector constructed from any one of the polynucleotides of claims 1 to 7.
9. A cell derived from the vector combination of claim 8.
10. A composition for the prevention of rabies, comprising the polynucleotide of claims 1 to 7 or mRNA transcribed from the vector of claim 8.
11. The composition according to claim 10, characterized in that, The composition is an mRNA vaccine, which includes at least one selected from mRNA expressing rabies virus G protein or an immunogenic fragment thereof, G-Fc protein or an immunogenic fragment thereof, G-Folden protein or an immunogenic fragment thereof, and GLG protein or an immunogenic fragment thereof.
12. The composition according to claim 11, characterized in that, The mRNA sequence expressing the rabies virus G protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 3; or The mRNA sequence expressing the G-Fc protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 7; or The mRNA sequence expressing the G-Folden protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO: 9; or The mRNA sequence expressing the GLG protein or its immunogenic fragment has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID NO:
12.
13. The composition according to claim 12, characterized in that, The composition further includes a pharmaceutically acceptable carrier, preferably a liposome, wherein the mRNA in the mRNA vaccine is encapsulated in liposome nanoparticles, and the particle size of the liposome nanoparticles is preferably 50-200 nm. Preferably, the liposome nanoparticles are selected from at least one of cationic lipids, distearate phosphatidylcholine (DSPC), cholesterol, and DMG-2000; More preferably, the liposome nanoparticles are composed of the following components in parts by weight: 30-80 parts cationic lipids, 5-15 parts distearate phosphatidylcholine (DSPC), 24-52 parts cholesterol, and 1-2 parts DMG-2000. More preferably, the liposome nanoparticles are composed of the following components in parts by weight: 50 parts cationic lipids, 10 parts distearate phosphatidylcholine (DSPC), 38.5 parts cholesterol, and 1.5 parts DMG-2000.
14. Use of the polynucleotide of any one of claims 1 to 7, the carrier of claim 8, or the composition of any one of claims 10 to 13 in the preparation of a medicament for the prevention and / or treatment of rabies.