Method for identifying authenticity of pineapple hybrid
By applying SNP markers and primer sets to genotype pineapple YLL and MD2 hybrids, the problem of identifying the authenticity of hybrid offspring in pineapple breeding was solved, achieving rapid and accurate identification results and improving breeding efficiency.
Patent Information
- Application Number
- CN202411508368.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2025-11-25
AI Technical Summary
Identifying the authenticity of hybrid offspring in pineapple breeding is difficult. Current technologies mainly rely on morphological characteristics, which are easily affected by environmental and human factors. Furthermore, the breeding cycle is long, making it difficult to accurately identify true and false hybrids.
Genotyping of pineapple YLL and MD2 hybrids was performed using SNP markers and specific primer sets. Primers were designed based on the SNP marker located at the 3881791 locus on chromosome LG24 for PCR amplification and genotyping, and rapid identification was performed using the PARMS-SNP marker method.
This technology enables rapid and accurate identification of pineapple hybrid authenticity, improves breeding efficiency, reduces human error, and ensures the reliability of identification results.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of pineapple hybrid breeding, and particularly relates to a SNP marker for identifying the authenticity of a YLL and MD2 hybrid pineapple, a primer set and application thereof. BACKGROUND
[0002] Pineapple is one of the three major tropical fruit trees in the world, and China is one of the top ten major producing countries of pineapple. Pineapple is mainly distributed in Guangdong, Hainan, Yunnan, Guangxi and Fujian provinces, and is a pillar industry in the hot zone, playing an important role in rural revitalization. However, the main cultivated variety of pineapple is 'Bali', which has been used for nearly 100 years. The single variety and degradation have led to problems such as concentrated harvesting period and declining quality, which have become one of the urgent problems that the industry needs to solve. The selection and promotion of new varieties is an effective means to adjust the variety structure and improve the quality and efficiency of the industry. At present, artificial hybridization is the main method for breeding new varieties of pineapple. However, the breeding cycle is long, and due to open pollination, false hybrids are easily produced. The identification of hybrid authenticity based on field phenotypic traits of hybrid offspring is time-consuming and labor-intensive, and is easily affected by environmental and human factors. With the centralized use of parents, the morphological differences of hybrid offspring are becoming smaller and smaller, making it more and more difficult to identify true and false hybrids using morphological characteristics.
[0003] DNA molecular markers are used to identify the identity of varieties, which are accurate, reliable, simple, fast, easy to operate, and have good timeliness. They are widely used in the identification of true and false varieties of citrus, apple, grape, cherry, peach, kiwi fruit and other fruit trees. The International Union for the Protection of New Varieties of Plants (UPOV) has recommended SSR marker technology and single nucleotide polymorphism technology (SNP) as two technologies for variety identification or seed purity identification in the BMT molecular test guide. However, SSR technology has some drawbacks such as fewer detection sites, low throughput, poor representativeness, and difficulty in data sharing. SNP markers have high and uniform distribution density in the genome, can achieve high-throughput detection, and are more suitable for database integration and sharing. Therefore, SNP markers are considered to be the most promising molecular marker technology.
[0004] At present, the identification of pineapple hybrid offspring is mainly based on morphological characteristics observed in multiple years and multiple sites, and there is no report on the use of molecular markers to identify the authenticity of F1 hybrid population. SUMMARY
[0005] To solve the above problems, the application provides a SNP marker for identifying the authenticity of a YLL and MD2 hybrid pineapple, which is located at 3881791 of LG24 chromosome and has a genotype of T / C.
[0006] The application also provides a primer set for amplifying the SNP marker, which comprises sequences shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.
[0007] The application also provides a detection reagent for identifying the SNP marker, which comprises the primer set.
[0008] The application also provides a detection kit for identifying the SNP marker, which comprises the primer set or the detection reagent.
[0009] The application also provides application of the molecular marker, the primer set and the detection kit and the detection reagent in genetic breeding of pineapples.
[0010] Further, the application comprises: application of the SNP marker or the primer set or the detection reagent or the detection kit in identifying authenticity of the hybrid of the pineapple YLL and MD2.
[0011] Further, when the genotype of the sample to be detected is a homozygous genotype, the sample to be detected is a false hybrid; when the genotype of the sample to be detected is a heterozygous genotype, the sample to be detected is a true hybrid.
[0012] The application has the following beneficial effects:
[0013] The primer set designed based on the SNP marker can quickly and effectively identify authenticity of the hybrid of the pineapple YLL and MD2, the identification result is accurate and reliable, and the application is beneficial to genetic breeding of the pineapple. BRIEF DESCRIPTION OF DRAWINGS
[0014] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the application, and for those skilled in the art, other drawings can be obtained based on these drawings without creative labor.
[0015] Figure 1 Part of the genotyping results of the primer, wherein the blue dot represents the genotype of 'MD2', the red represents the genotype of 'YLL', and the green represents the genotype of the hybrid F1 generation;
[0016] Figure 2 is the genotyping result of 264 single plants, wherein the blue dot represents the genotype of 'MD2', the red represents the genotype of 'YLL', and the green represents the genotype of the hybrid F1 generation; A: genotyping result of SNP30858; B: genotyping result of SNP7273.
[0017] Figure 3 Part of the sequencing results of the true hybrid and the false hybrid. DETAILED DESCRIPTION
[0018] The following detailed description of various example embodiments of the application will be better understood when read in conjunction with the appended drawings. While the application is not limited to any single form of implementation, the detailed description illustrates embodiments of the practices of the application for educational purposes, and these illustrated embodiments are intended to provide specific exemplifications of how the application can be made and used, and are not intended to limit the scope of the application or to limit the applicability of the concepts embodied in ways not expressly disclosed. Numerous specific details of alternative implementations are described to provide a thorough understanding of the embodiments of the application. However, in cases where specific details are not needed to understand the application, they are not provided. Those skilled in the art will recognize that the techniques described can typically be used in any number of applications, and the embodiments discussed are merely by way of example.
[0019] It should be understood that the terms so far as the word "comprise", "comprising", "include", "including" and "includes" are not used solely to specify the presence of the stated features, integers, steps or components but to provide examples of the features, integers, steps or components. The use of relative terms such as "about", "approximately", "substantially" and the like acknowledges that some variation will occur when compared to an ideal. It will be further understood that the terms "comprise" (and any grammatical variations thereof), "comprising", "comprise", "comprising", "comprise" when used in this specification are taken to specify the presence of stated features, integers, steps or components but not to preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.
[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not construed as an admission that it is prior art with respect to the present application.
[0021] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof, and it is to be understood that all such modifications and variations warrant the patentable subject matter under the patent laws. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in any way by the specific construction, materials, and / or embodiments disclosed herein.
[0022] As used herein, the terms "comprise", "comprising", "include", "including", "contain", "containing", "have", "having" and the like are open-ended and do not exclude additional elements or steps.
[0023] 1. Experiments
[0024] 1.1 Materials
[0025] In March 2020, 80 hybrid offspring of 'MD2' and 'YLL' (numbered JYA001-JYA080) were obtained by artificial pollination, with 'MD2' as the male parent and 'YLL' as the female parent; in March 2020, 182 hybrid offspring of 'YLL' and 'MD2' (numbered YJA001-YJL013) were obtained by artificial pollination, with 'MD2' as the male parent and 'YLL' as the female parent, and were planted in the Danzhou experimental base of the Institute of Tropical Crop Variety Resources, Chinese Academy of Tropical Agricultural Sciences.
[0026] 1.2 Method
[0027] The DNA of the pineapple parents and offspring was extracted using the improved CTAB method. From the pineapple resequencing data, SNP homozygous sites with differences between parents were screened, and primers were designed according to SNP site information using the primer design tool on the website of Wuhan Jingpeibio Technology Co., Ltd. (http: / / www.snpway.com), named primer X, primer Y and primer C, respectively, and PCR amplification was performed. According to the difference of the last base at the 3' end of the primer and the fluorescence signal value, the DNA fragments of specific alleles were distinguished and amplified, the fluorescence signal value of the tested site was detected, and genotyping was performed. The primers used were synthesized by Shanghai Shengong.
[0028] Using 'YLL', 'MD2' and 16 hybrid F1 individuals as materials, primer screening was performed, and SNP genotyping reagent PARMS was purchased from Wuhan Jingpeibio. The reaction system is shown in Table 1:
[0029] Table 1 PCR reaction system
[0030] Ingredients Volume 2x PARMS 3ul Primer X 0.1ul Primer Y 0.15ul Primer C 0.15ul DNA template 1ul Double distilled water 1.5ul
[0031] PCR reaction was performed on ABI QuantStudio6 QS6 instrument, and genotyping was performed on the instrument, and the reaction program is shown in Table 2. Two groups of SNP primers that can be used for hybrid authenticity identification were obtained by screening primers that can genotype 16 materials.
[0032] Table 2 PCR thermal cycle program
[0033]
[0034]
[0035] 1.3 Molecular identification of hybrid authenticity
[0036] Genomic DNA of 'YLL', 'MD2' and 262 hybrid offspring (numbered YJA001-JYA080) were genotyped using the screened primers. The genotype of each sample was counted, and when the genotype of the sample was homozygous, it was a false hybrid; when the genotype of the sample was heterozygous, it was a true hybrid.
[0037] 1.4 Verification of hybrid authenticity
[0038] Specific primers were designed 150 bp before and after the SNP30858 locus of the candidate marker. True hybrids and false hybrids were randomly selected for specific PCR amplification, and the PCR products were sequenced. When the sequencing peak graph of the SNP site was single peak, it was homozygous genotype; when the sequencing peak graph of the SNP site was double peak, it was heterozygous genotype. The primer sequences are as follows:
[0039] Primer name Primer sequence (5' - 3') F30858 ACACATCCTCTGATCTCACTGC R30858 CCTCCATAGCTCTCTCCTGAT
[0040] 2 Results and analysis
[0041] 2.1 Screening of primers
[0042] From the whole genome resequencing data of pineapple, SNP homozygous sites with differences between parents were screened. 15 groups of primers (Table 3) were designed, and 'YLL', 'MD2' and 16 hybrid F1 generation single plants were used as materials to screen primers by PARMS-SNP marker method. The results showed that the 15 groups of primers were distributed on 8 chromosomes of LG3, LG7, LG9, LG12, LG16, LG17, LG22 and LG24. After PCR amplification, 13 groups of primers could not distinguish 18 materials, and only SNP30858 and SNP7273 could distinguish 18 materials into 3 types, in which blue represents the homozygous genotype of 'MD2', red represents the homozygous genotype of 'YLL', and green represents the heterozygous genotype of hybrid F1 generation Figure 1 ). It is shown that SNP30858 and SNP7273 can be used for authenticity identification of 'YLL' and 'MD2' hybrid offspring (Table 4).
[0043] Table 3 SNP marker information of homozygous sites with differences between 'YLL' and 'MD2'
[0044]
[0045]
[0046] Table 4 SNP markers for authenticity identification of 'YLL' and 'MD2' hybrids
[0047]
[0048] 2.2 Hybrid authenticity identification
[0049] PCR amplification was performed on the hybrid F1 generation of 262 strains of parents 'YLL', 'MD2' and SNP30858 and SNP7273. The results showed that the two markers could divide 264 single plants into three genotypes. Among them, 2 and 4 single plants were identified by SNP30858 and SNP7273 respectively, which were consistent with the genotype of 'YLL' ( Figure 2 ). Comprehensive two markers, 258 true hybrids, 4 false hybrids were identified, and the true hybrid rate was 98.47% (Table 5).
[0050] Table 5 Statistical results of 'MD2' x 'LL' hybrid authenticity identification
[0051]
[0052] 2.3 Sequencing verification of true and false hybrids
[0053] A pair of specific primers were designed at the position of 150bp before and after 3881791 on chromosome 24, named F30858 and R30858. The false hybrids YJB012, YJF008, YJE004, YJH006 and the true hybrids YJL006, YJH001, YJH010 identified by typing were amplified by PCR using the primers, and the PCR products were sent to Shanghai Shengong Bioengineering Co., Ltd. for sequencing.
[0054] The results are shown in Figure 3 . The results showed that YJF008 was single peak at the position of 3881791, and the base was C; YJB012, YJE004, YJH006 were double peaks, and the base was T / C. It showed that YJF008 was a false hybrid, and YJB012, YJE004, YJH006 were true hybrids. The sequencing results were basically consistent with the SNP typing results, indicating that the SNP typing results were stable and reliable.
[0055] The above-described embodiments are only to describe the preferred modes of the present application, and not to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. A SNP marker for identifying the authenticity of hybrids of pineapple YLL and MD2, characterized in that, The molecular marker is located at 3881791 on chromosome LG24, with a genotype of T / C.
2. The primer set for amplifying the SNP marker described in claim 1, characterized in that, The primer set for amplifying the above SNP markers includes sequences as shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.
3.
3. The detection reagent for identifying the SNP marker as described in claim 1, characterized in that, Includes the primer set as described in claim 2.
4. The detection kit for identifying the SNP marker as described in claim 1, characterized in that, Includes the primer set as described in claim 2 or the detection reagent as described in claim 3.
5. The application of the SNP marker of claim 1, the primer set of claim 2, the detection reagent of claim 3 or 4, or the detection kit of claim 4 in pineapple genetic breeding.
6. The application according to claim 5, characterized in that, Applications include: Application of SNP markers, primer sets, detection reagents, or detection kits in identifying the authenticity of pineapple YLL and MD2 hybrids.
7. The application according to claim 6, characterized in that, If the genotype of the sample to be tested is homozygous, it is a pseudo-hybrid; if the genotype of the sample to be tested is heterozygous, it is a true hybrid.