Application of CDCA5 inhibitor in preparation of medicine for treating ovarian cancer

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a CDCA5 inhibitor in preparation of a medicine for treating ovarian cancer. According to the invention, CDCA5 is knocked out from UWB1.289 and snu251 cells, and Olaparib, MHY1485 or 740Y-P is given to the UWB1.289 and snu251 cells. CCK-8, immunofluorescence staining, a transmission electron microscope and western blot are used for detecting cell viability, autophagy, DNA damage and a PI3K / AKT / mTOR pathway. And establishing a BRCA1 mutation ovarian cancer xenotransplantation tumor model. The overall influence of CDCA5 knockout and olaparib is evaluated through tumor volume, weight and biomarkers. Research results show that knock-down CDCA5 is combined with olaparib to inhibit growth of ovarian cancer with BRCA1 mutation, and autophagy and DNA damage are promoted through a PI3K / AKT / mTOR pathway.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a CDCA5 inhibitor in preparation of a drug for treating ovarian cancer. BACKGROUND

[0002] Ovarian cancer is one of the most common cancers in women worldwide. Due to the lack of effective early screening methods, the early symptoms of ovarian cancer are not obvious, and about 70% of ovarian cancer patients are in the advanced stage at the initial diagnosis. Surgery combined with chemotherapy is the classic initial treatment method for ovarian cancer. Early ovarian cancer is subjected to comprehensive staging surgery, and advanced ovarian cancer is subjected to initial tumor debulking surgery. Ovarian cancer is the gynecological malignant tumor with the worst prognosis due to its easy occurrence of chemotherapy resistance and relapse and metastasis. Therefore, it is of great significance to study the pathogenesis of ovarian cancer and explore molecular targeted drugs.

[0003] Molecular biology research has found that the accumulation of gene changes in somatic cells can lead to tumors. When tumor suppressor genes are lost or mutated, the integrity of the genome is disrupted, leading to genetic instability of cells or causing tumor susceptibility, and thus directly or indirectly inducing the occurrence of cancer. Ovarian cancer has the characteristics of family clustering and heredity, and its related risk is related to gene mutation. Breast cancer susceptibility gene (BRCA) was discovered in the early 1990s in patients with hereditary breast cancer. BRCA, including BRCA1 and BRCA2, is an important tumor suppressor gene, and its pathogenic mutation is associated with an increased risk of ovarian cancer. In addition, BRCA1 / 2 is a tumor suppressor gene closely related to the occurrence and development of ovarian cancer, and its mutation or functional loss leads to malignant changes in cells. BRCA1 / 2 mutation plays an important role in DNA damage homologous recombination repair and normal cell growth.

[0004] Poly (ADP-ribose) polymerase (PARP) inhibitors impair PARP function, leading to persistent DNA damage that can be repaired through the homologous recombination repair pathway. However, tumor cells carrying BRCA1 / 2 mutations cannot repair through homologous recombination. Olaparib is an alternative drug for PARP inhibitors that can cause DNA damage and apoptosis in cancer cells and is used for first-line maintenance therapy in patients with BRCA1 / 2 mutations. Studies have shown that the IC50 value of olaparib in BRCA1 mutant UWB1.289 cells is more than 10 times that of BRCA1 wild-type UWB1.289 cells. Therefore, BRCA1-deficient cells are sensitive to PARP inhibitors. Compared with monotherapy, the combination of olaparib with other antitumor drugs can exert a synergistic effect, thereby prolonging the progression-free survival (PFS) of patients, enhancing drug sensitivity, and overcoming resistance to PARP inhibitors. Therefore, it is necessary to further study the possibility of pairing PARP inhibitors with other therapies to enhance the effectiveness of olaparib against ovarian cancer.

[0005] Cell cycle-associated protein 5 (CDCA5), commonly known as Sororin, is a phosphoprotein encoded by a gene located on human chromosome 11 (11q131.1). Belonging to the CDCA family, CDCA5 is crucial for regulating chromatid adhesion and separation. It acts as a regulator of protein complex cohesion, significantly influencing cell proliferation. CDCA5 is a promising biomarker and an important mediator in several human cancers. Malignant tumors such as ovarian cancer, breast cancer, and liver cancer all exhibit aberrant CDCA5 expression. Furthermore, CDCA5 participates in tumor progression by regulating biological behaviors such as proliferation, cell cycle, and apoptosis. CDCA5 activates the TGF-β1 / Smad2 / 3 or p53 pathway, promoting malignant behavior in ovarian cancer cells. However, the link between CDCA5 and BRCA1-mutant ovarian cancer remains unclear.

[0006] Currently, treatment options for BRCA1-mutated ovarian cancer include PARP inhibitors (such as olaparib and niraparib), platinum-based chemotherapy drugs (such as carboplatin), and taxane-based drugs. Among these, PARP inhibitors are more widely used clinically than the others. Although PARP inhibitors can be used as first-line maintenance therapy for BRCA1 / 2-mutated patients, single-agent PARP inhibitor therapy still suffers from limitations in efficacy and the tendency for tumors to develop resistance. Summary of the Invention

[0007] To address the shortcomings of existing single PARP inhibitors, such as insufficient efficacy and the tendency for tumors to develop drug resistance, this invention provides the application of a CDCA5 inhibitor in the preparation of a drug for treating ovarian cancer.

[0008] To achieve the above objectives, the present invention adopts the following technical solution.

[0009] The first objective of this invention is to provide the use of a CDCA5 inhibitor in combination with olaparib in the preparation of a medicament for the treatment of ovarian cancer.

[0010] This invention is the first to discover that silencing CDCA5 in combination with olaparib effectively inhibits the progression of BRCA1-mutant ovarian cancer and enhances autophagy and DNA damage through the PI3K / AKT / mTOR signaling pathway. These findings provide a foundation for treatment strategies for BRCA1-mutant ovarian cancer. Based on this, this invention provides the application of a CDCA5 inhibitor in combination with olaparib in the preparation of drugs for treating ovarian cancer. By targeting and inhibiting CDCA5 in combination with olaparib, DNA damage and autophagy effects are significantly enhanced, thus enabling the treatment of BRCA1-mutant ovarian cancer. Furthermore, the combination of CDCA5 inhibitor and olaparib does not exhibit the drawbacks of insufficient efficacy or the tendency for tumors to develop drug resistance.

[0011] Preferably, the CDCA5 inhibitor comprises at least one of the following: an RNA interference molecule targeting CDCA5, an antisense oligonucleotide, a small molecule inhibitor, a substance for lentiviral infection, and a gene knockout substance.

[0012] Preferably, the gene knockout substance includes at least one of the CRISPR-Cas9 system, transcription activator-like effector nuclease, and zinc finger nuclease.

[0013] Preferably, the small molecule inhibitor comprises at least one of CDCA5-specific siRNA, shRNA expression vector, and antisense oligonucleotide.

[0014] Preferably, the small molecule inhibitor includes si-CDCA5.

[0015] The nucleotide sequence of si-CDCA5 is shown in SEQ ID NO.1: GAGACUUGGAAAUGUCUAAGA.

[0016] Preferably, the drug further comprises a pharmaceutically acceptable carrier and / or excipients.

[0017] Preferably, the pharmaceutically acceptable carrier includes at least one of physiological saline, phosphate buffer, glucose solution, polyethylene glycol, liposomes and cyclodextrin.

[0018] Preferably, the pharmaceutically acceptable excipients include at least one of stabilizers, preservatives, antioxidants, pH adjusters, emulsifiers, and disintegrants.

[0019] Preferably, the dosage form of the drug includes at least one of tablets, capsules, injections, sustained-release formulations, nanoparticles, liposomes, and lyophilized powder for injection.

[0020] A second objective of the present invention is to provide a pharmaceutical composition for treating ovarian cancer, said pharmaceutical composition being the CDCA5 inhibitor in combination with olaparib.

[0021] CDCA5 inhibitors disrupt the proliferation process of ovarian cancer cells by interfering with the function of cell cycle-related proteins; olaparib, as a PARP inhibitor, inhibits the repair of DNA damage in cancer cells. The combined use of these two drugs disrupts the cell cycle of cancer cells on the one hand, and enhances the attack on cancer cell DNA damage on the other, resulting in a synergistic and stronger anti-cancer effect.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. This invention provides the application of CDCA5 inhibitors in the preparation of drugs for treating ovarian cancer. This invention can significantly enhance DNA damage and autophagy effects by targeting and inhibiting CDCA5 in combination with olaparib, thereby enabling the treatment of BRCA1-mutant ovarian cancer. Furthermore, the combination of CDCA5 inhibitors and olaparib does not exhibit the drawbacks of insufficient efficacy or the tendency for tumors to develop drug resistance.

[0024] 2. This invention uses qRT-PCR and Western blot to detect CDCA5 levels in normal ovarian epithelial cells (IOSE-80) and BRCA1-mutant ovarian cancer cells (UWB1.289 and SNU251). CDCA5 was knocked out in UWB1.289 and SNU251 cells, and the cells were treated with olaparib, MHY1485, or 740Y-P. Cell viability, autophagy, DNA damage, and the PI3K / AKT / mTOR pathway were detected using CCK-8 assay, immunofluorescence staining, transmission electron microscopy, and Western blot. A BRCA1-mutant ovarian cancer xenograft model was established. The overall effects of CDCA5 knockout and olaparib were assessed using tumor volume, weight, and biomarkers.

[0025] The results of this study are as follows: CDCA5 is highly expressed in UWB1.289 and SNU251 cells. Functional experiments showed that inhibiting CDCA5 reduced the viability of UWB1.289 and SNU251 cells. Simultaneously, CDCA5 inhibition increased LC3-positive cells and autophagosome structure, upregulated ATG5 and Beclin1 levels, and downregulated p62 SQSTM1 levels. CDCA5 knockdown increased γ-H2AX levels in UWB1.289 and SNU251 cells. Furthermore, CDCA5 knockout combined with olaparib exhibited a significant synergistic anti-tumor effect against BRCA1-mutant ovarian cancer cells. Notably, the administration of MHY1485 (an mTOR activator that inhibits autophagy) or 740Y-P (a PI3K / AKT activator) reversed the promoting effects of CDCA5 knockdown combined with olaparib on autophagy and DNA damage. Furthermore, in vivo studies have confirmed that olaparib enhances the antitumor effect of CDCA5 knockdown on the progression of BRCA1-mutant ovarian cancer, and its mechanism is related to PI3K / AKT / mTOR-mediated autophagy and DNA damage.

[0026] The results above indicate that knocking down CDCA5 in combination with olaparib inhibits the growth of BRCA1-mutated ovarian cancer and promotes autophagy and DNA damage through the PI3K / AKT / mTOR pathway. Attached Figure Description

[0027] Figure 1 The CDCA5 level is highly expressed in ovarian cancer in this invention; wherein, Figure 1Figure A shows the CDCA5 mRNA levels in normal ovarian epithelial cells (IOSE-80) and BRCA1-mutant ovarian cancer cells (UWB1.289 and SNU251) detected by qRT-PCR. Figure 1 Figure B in the figure shows the CDCA5 protein level detected by Western blot in IOSE-80, UWB1.289 and SNU251 cells; Figure 1 The C diagram in the diagram is based on Figure 1 The Western blot results in Figure B were used to quantitatively analyze the expression level of CDCA5 protein using statistical software, and the results are presented in bar chart form. Figure 1 Figure D in the figure shows the expression of CDCA5 in ovarian cancer tissue and normal tissue analyzed using the ualcan database; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with IOSE-80 or normal tissue.

[0028] Figure 2 This refers to the results of loss-of-function assays performed by knocking out CDCA5 in UWB1.289 and SNU251 cells in this invention; wherein, Figure 2 Figure A shows the expression level of CDCA5 in UWB1.289 cells and SNU251 cells transfected with si-NC or si-CDCA5, as detected by Western blot. Figure 2 Figure B in the figure shows the quantitative analysis of CDCA5 protein expression levels in UWB1.289 cells transfected with si-NC and si-CDCA5; Figure 2 Figure C in the figure shows the quantitative analysis of CDCA5 protein expression levels in SNU251 cells transfected with si-NC and si-CDCA5; Figure 2 Figure D in the figure shows the cell viability of SNU251 cells transfected with si-NC or si-CDCA5 as determined by the CCK-8 assay. Figure 2 Figure E in the figure shows the viability of UWB1.289 cells transfected with si-NC or si-CDCA5 as determined by the CCK-8 assay. Figure 2 Figure F in the figure shows the immunofluorescence staining analysis of LC3-positive cells in UWB1.289 cells and SNU251 cells transfected with si-NC or si-CDCA5; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with si-NC.

[0029] Figure 3 This invention relates to the effects of interfering with CDCA5 on the levels of autophagy-related proteins and the phenomenon of autophagy in UWB1.289 and SNU251 cells; among which, Figure 3Figure A shows the levels of autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1) in UWB1.289 and SNU251 cells transfected with si-NC or si-CDCA5 as detected by Western blot. Figure 3 Figure B in the figure shows the quantitative analysis of the levels of autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1) in SNU251 cells transfected with si-NC or si-CDCA5. Figure 3 Figure C in the figure shows the quantitative analysis of the levels of autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1) in UWB1.289 cells transfected with si-NC or si-CDCA5. Figure 3 Figure D in the image shows the autophagy phenomenon observed in UWB1.289 cells and SNU251 cells transfected with si-NC or si-CDCA5 under transmission electron microscopy. Figure 3 Figure E in the figure shows the immunofluorescence staining analysis of γ-h2ax positive cells in UWB1.289 cells and SNU251 cells transfected with si-NC or si-CDCA5; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with si-NC.

[0030] Figure 4 This invention involves the knockout of CDCA5 in UWB1.289 and SNU251 cells, followed by detection of related autophagy levels after olaparib treatment; wherein, Figure 4 Figure A shows the cell viability of SNU251 cells after treatment with si-CDCA5 and olaparib, as determined by the CCK-8 assay. Figure 4 Figure B in the figure shows the cell viability of UWB1.289 cells after treatment with si-CDCA5 and olaparib, as determined by the CCK-8 assay. Figure 4 Figure C in the figure shows the immunofluorescence staining analysis of LC3-positive cells in UWB1.289 and SNU251 cells treated with si-CDCA5 and olaparib; Figure 4 Figure D in the figure shows the autophagy phenomenon in UWB1.289 cells and SNU251 cells after treatment with si-CDCA5 and olaparib, as observed by transmission electron microscopy. Figure 4 Figure E in the figure shows the levels of autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1) in si-CDCA5 and olaparib-treated UWB1.289 cells as detected by Western blot. Figure 4 Figure F in the figure shows the levels of autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1) in SNU251 cells treated with si-CDCA5 and olaparib as detected by immunoblotting. Figure 4Figure G in the figure shows the immunofluorescence staining analysis of γ-h2ax positive cells in UWB1.289 and SNU251 cells treated with si-CDCA5 and olaparib; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with si-CDCA5.

[0031] Figure 5 In this invention, Western blot was used to detect the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in UWB1.289 and SNU251 cells; among which, Figure 5 Figure A in the figure shows the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in UWB1.289 and SNU251 cells after treatment with si-CDCA5 and olaparib, as detected by Western blotting. Figure 5 Figure B in the figure shows the quantitative analysis of the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in SNU251 cells after treatment with si-CDCA5 and olaparib. Figure 5 Figure C in the figure shows the quantitative analysis of the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in UWB1.289 cells after treatment with si-CDCA5 and olaparib; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with si-NC; compared with si-CDCA5, #P<0.05, ##P<0.01, ###P<0.001.

[0032] Figure 6 This diagram shows the autophagy levels in UWB1.289 cells treated with -CDCA5 and olaparib, obtained by adding MHY1485 (an mTOR activator that inhibits autophagy) or 740Y-P (a PI3K / AKT activator) to these cells. Figure 6 Figure A shows the cell viability of UWB1.289 cells after treatment with si-CDCA5, olaparib, and MHY1485 or 740Y-P as determined by the CCK-8 assay. Figure 6 Figure B in the figure shows the LC3-positive cells of UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P, analyzed by immunofluorescence staining. Figure 6Figure C in the figure shows the autophagy phenomenon in UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P observed by transmission electron microscopy. Figure 6 Figure D shows the levels of autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1) in UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P, as detected by Western blot. The three samples from left to right represent the levels of autophagy-related proteins in UWB1.289 cells treated with si-CDCA5 and olaparib, the levels of autophagy-related proteins in UWB1.289 cells treated with si-CDCA5, olaparib, and MHY1485, and the levels of autophagy-related proteins in UWB1.289 cells treated with si-CDCA5, olaparib, and 740Y-P, respectively. Figure 6 Figure E in the figure shows the quantitative analysis of autophagy-related protein (ATG5, Beclin1, and p62SQSTM1) levels in UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with si-CDCA5+olaparib.

[0033] Figure 7 This diagram shows the results of adding MHY1485 (an mTOR activator that inhibits autophagy) or 740Y-P (a PI3K / AKT activator) to UWB1.289 cells treated with -CDCA5 and olaparib, resulting in the levels of PI3K / AKT / mTOR pathway-related proteins. Figure 7 Figure A shows immunofluorescence staining analysis of γ-h2ax positive cells in UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P. Figure 7Figure B shows the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P, as detected by Western blot. The three samples from left to right represent the levels of PI3K / AKT / mTOR pathway-related proteins in UWB1.289 cells treated with si-CDCA5 and olaparib, the levels of PI3K / AKT / mTOR pathway-related proteins in UWB1.289 cells treated with si-CDCA5, olaparib, and MHY1485, and the levels of PI3K / AKT / mTOR pathway-related proteins in UWB1.289 cells treated with si-CDCA5, olaparib, and 740Y-P, respectively. Figure 7 Figure C in the figure shows the quantitative analysis of the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in UWB1.289 cells treated with si-CDCA5, olaparib, MHY1485, or 740Y-P; all data are expressed as mean ± standard deviation (mean ± SD); *P<0.05, **P<0.01, ***P<0.001 compared with si-CDCA5+olaparib.

[0034] Figure 8 In this invention, BALB / c nude mice were subcutaneously injected with UWB1.289 cells treated under four different conditions. The four groups were: control group, CDCA5 interference group, CDCA5 interference combined with olaparib group, and CDCA5 interference, olaparib combined with 740Y-P group. Figure 8 Figure A in the figure shows a physical image of the tumor tissue, recording the tumor tissue, volume, and weight. The three samples from top to bottom are the control group, the CDCA5 interference group, the CDCA5 interference combined with olaparib group, and the CDCA5 interference, olaparib combined with 740Y-P group, respectively. Figure 8 Figure B in the graph is a line graph showing the tumor volume recorded every 3 days; Figure 8 Figure C in the figure shows the tumor volume of BALB / c nude mice after subcutaneous injection of UWB1.289 cells under four different treatments; Figure 8 Figure D shows the results of tumor tissue pathology, Ki67 positive cells, and TUNEL positive cells detected by HE staining, immunohistochemical staining, and TUNEL staining; ***P<0.05, P<0.01, ***P<0.001 vs. control; #P<0.05, ##P<0.01, ###P<0.001 vs. si-CDCA5; compared with si-CDCA5+olaparib, $P<0.05, $P<0.01, $$P<0.001.

[0035] Figure 9 The levels of CDCA5, autophagy-related proteins (ATG5, Beclin1, and p62SQSTM1), DNA damage-related proteins (γ-H2AX), and PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) were measured after tumorigenesis experiments in nude mice in this invention. Figure 9 Figure A shows the Western blot analysis of CDCA5, autophagy-related proteins (ATG5, Beclin1, and p62 SQSTM1), and DNA damage-related protein (γ-H2AX) expression levels in tumor tissues. The four samples from left to right represent: the control group; the control group; the CDCA5 interference group; the CDCA5 interference combined with olaparib group; and the olaparib combined with 740Y-P group. Expression levels of SQSTM1 and DNA damage-associated protein (γ-H2AX); Figure 9 Figure B shows the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in tumor tissue detected by Western blot. The four samples from left to right represent the expression levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in the control group, and the expression levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in the CDCA5 interference group, respectively. The expression levels of PI3K / AKT / AKT and p-mTOR / mTOR marker proteins in the CDCA5 interference combined with olaparib group and the expression levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT and p-mTOR / mTOR) marker proteins in the CDCA5 interference combined with olaparib group. Figure 9Figure C in the figure shows the quantitative analysis of the expression levels of CDCA5, autophagy-related proteins (ATG5, Beclin1 and p62 SQSTM1), and DNA damage-related proteins (γ-H2AX) in tumor tissue; Figure 9 Figure D in the figure represents the quantitative analysis of the levels of PI3K / AKT / mTOR pathway-related proteins (p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR) in tumor tissue; ***P<0.05, P<0.01, ***P<0.001 vs. control; #P<0.05, ##P<0.01, ###P<0.001 vs. si-CDCA5; compared with si-CDCA5+olaparib, $P<0.05, $P<0.01, $$P<0.001. Detailed Implementation

[0036] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0037] Example 1

[0038] I. Methods

[0039] 1. Cell Culture

[0040] Normal human ovarian epithelial cells (IOSE-80) and BRCA1-mutated ovarian cancer cells (UWB1.289 and SNU251) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai).

[0041] IOSE-80 cells, UWB1.289 cells, and SNU251 cells were cultured in rmi-1640 medium supplemented with 10% fetal bovine serum at 37°C in a 5% CO2 incubator.

[0042] 2. Cell transfection and treatment

[0043] To inhibit CDCA5, GenePharma (Shanghai, China) synthesized a small interfering RNA (si-CDCA5) against CDCA5, using si-NC as a control. Cells treated with 20 nmol / L si-CDCA5 and si-NC were transfected with Lipofectamine RNAiMAX (Invitrogen, USA) for 24 h.

[0044] The transfection sequence of si-CDCA5 is shown in Table 1.

[0045] Table 1 siRNA sequences

[0046] Target Sequence (5'-3') SEQ ID NO. si-CDCA5 GAGACUUGGAAAUGUCUAAGA 1 si-NC CACGATAAGACAATGTATTT 2

[0047] To determine the role of olaparib, UWB1.289 cells and SNU251 cells were treated with 5 μM / L olaparib (MedChemExpress, USA).

[0048] To explore the functional role of the PI3K / AKT / mTOR-related autophagy pathway, UWB1.289 cells were treated with 1 μM / mL MHY1485 (an mTOR activator that inhibits autophagy; MedChemExpress, USA) and 25 μg / mL 740Y-P (a PI3K / AKT activator; MedChemExpress, USA).

[0049] 3. CCK-8

[0050] UWB1.289 and SNU251 cells were seeded. 3000 cells per well (100 μL) were seeded into each well of a 96-well plate. After incubation in a standard incubator, 10 μL of CCK8 reagent (Sigma, USA) was added to each well, and the plates were incubated at 37°C for 2 hours. The absorbance was measured at 450 nm using a microplate reader (BioTek, USA).

[0051] 4. Immunofluorescence staining method

[0052] UWB1.289 and SNU251 cells were fixed with 4% polyurea (Sigma, USA) at room temperature for 20 minutes. Both cells were then infiltrated with 0.3% Triton X-100 (Beyotime, China) for 15 minutes, followed by blocking with Blocking Buffer (Beyotime, China) for 30 minutes. UWB1.289 and SNU251 cells were incubated at 4°C for 1 hour in buffers containing monoclonal rabbit antibodies LC3 (1:100, ab232940, Abcam, USA), γ-H2AX (1:100, ab81299, Abcam, USA), and goat anti-rabbit IgG (1:100, ab150081, Abcam, USA), respectively. Cell morphology was observed under a fluorescence microscope.

[0053] 5. Transmission electron microscope (TEM)

[0054] Cells were fixed with 2.5% glutaraldehyde (v / v) and then stained with uranyl acetate and lead citrate. The cells were then observed using TEM (JEOL, Japan).

[0055] 6. Animal experiments

[0056] Female BALB / c nude mice (weighing 20g-25g) aged 6-8 weeks were purchased from Jackson Laboratory. All animal care procedures during the experiment were approved by Bengbu Medical University.

[0057] Following infection with si-NC and si-CDCA5 lentiviral particles, UWB1.289 cells were collected and suspended in 200 μL of PBS and Matrigel mixture. To establish a BRCA1-mutated ovarian cancer xenograft model, 5 × 10⁵ cells were subcutaneously injected into the right side of BALB / c nude mice. 6 1,289 UWB cells.

[0058] Mice were divided into 4 groups (n=3): control group, si-CDCA5 group, si-CDCA5+olaparib group and si-CDCA5+olaparib+740Y-P group.

[0059] In the control group, BALB / c nude mice were subcutaneously injected with si-NC-infected UWB1.289 cells.

[0060] In the si-CDCA5 group, BALB / c nude mice were subcutaneously injected with si-CDCA5-infected UWB1.289 cells.

[0061] In the si-CDCA5+olaparib group, BALB / c nude mice were subcutaneously injected with si-CDCA5-infected UWB1.289 cells and intraperitoneally injected with 40 mg / kg olaparib daily for 3 weeks.

[0062] In the si-CDCA5 + olaparib + 740Y-P group, BALB / c nude mice were subcutaneously injected with si-CDCA5-infected UWB1.289 cells, followed by daily intraperitoneal injections of 40 mg / kg olaparib and 10 mg / kg 740Y-P for 3 weeks. Tumor size and volume were measured and calculated every 2 days. After 21 days of continuous administration, the mice were sacrificed, and the tumors were harvested for experiments.

[0063] 7. Hematoxylin and eosin (HE) staining

[0064] Paraffin sections of transplanted tumor tissue were prepared. Ovarian cancer tissue was fixed in 4% paraformaldehyde (v / v), infiltrated with paraffin, embedded, and sectioned into 4μm sections. The sections were stained with hematoxylin (Servicebio, China) for 5 minutes and then with 1% eosin solution (v / v) for 2 minutes. After HE staining, the tumor tissue was observed under a microscope (Nikon, Japan).

[0065] The ovarian cancer tissue was derived from a nude mouse xenograft tumor experiment.

[0066] 8. Immunohistochemistry (IHC)

[0067] After routine dewaxing and hydration of subcutaneous tumor tissue sections, EDTA antigen was repaired, and the sections were immersed in 3% H2O2 for 15 min. Anti-rabbit IgG (Cat.SA00004, 1:400 dilution, ProteinTech, USA) was added and incubated overnight at 4°C. The next day, anti-rabbit IgG (Cat.SA00004, 1:400 dilution, ProteinTech, USA) was added and incubated for 20 min, followed by staining with DAB and hematoxylin. The stained sections were observed under a Nikon microscope (Japan).

[0068] Overnight stays refer to stays of 12 hours or more.

[0069] 9. Tunel

[0070] According to the instructions of the TUNEL cell apoptosis detection kit (Beyotime, China), subcutaneous tumor tissue pathological sections underwent DAB staining, hematoxylin preservation, differentiation, blue re-blueing, dehydration and clearing, and sealing. TUNEL expression in different groups was observed under a microscope (Nikon, Japan).

[0071] 10. qRT-PCR

[0072] Total RNA was isolated from UWB1.289 and SNU251 cells using the RNeasy Mini Kit (Qiagen, Germany). The RNA was then reverse transcribed into cDNA using the Omniscript RT Kit (Qiagen, Germany). qRT-PCR was performed using the cDNA as a template, following the instructions of the Taq PCR MasterMixkit (Qiagen, Germany). Two [PCR methods were employed]. -ΔΔCt The method detects the expression level of CDCA5.

[0073] The primer sequences for CDCA5 are shown in Table 2.

[0074] Table 2 qRT-PCR primers

[0075]

[0076] 11. Western blotting

[0077] Cells or tissues from each group were collected and lysed using RIPA (Beyotime, China) on ice (4°C) for 30 min. After electrophoresis, equal volumes of protein were transferred to PVDF membranes. The membranes were sealed in 3% BSA (Beyotime, China) for 1 hour and incubated with primary antibody at 4°C. After overnight incubation, secondary antibody was incubated for 1 hour. Finally, ECL solution (Beyotime, China) was added, and protein band images were obtained using a gel imaging system.

[0078] The relevant antibodies used are listed in Table 3.

[0079] Table 3 Antibody Information

[0080]

[0081] 12. Statistical Analysis

[0082] Statistical analysis was performed using GraphPad Prism 6 software. Quantitative data were described as mean ± standard deviation (mean ± SD). Differences between two groups were compared using t-tests. Differences among multiple groups were compared using one-way ANOVA. A p-value < 0.05 was considered statistically significant.

[0083] II. Results

[0084] 1. CDCA5 levels are highly expressed in ovarian cancer.

[0085] Compared with normal ovarian epithelial cells (IOSE-80), BRCA1-mutated ovarian cancer cells (UWB1.289 and SNU251) had elevated CDCA5 levels. Figure 1 Figure A in the middle~ Figure 1 Figure C in the diagram). The ualcan database shows that ovarian cancer tissues have high expression of CDCA5 ( Figure 1 (See Figure D in the diagram). These results further demonstrate the close relationship between CDCA5 and the development of ovarian cancer.

[0086] 2. CDCA5 knockdown inhibits the proliferation of BRCA1-mutated ovarian cancer cells, promotes autophagy and DNA damage.

[0087] To investigate the effect of CDCA5 on BRCA1-mutated ovarian cancer cells, CDCA5 was knocked down in UWB1.289 and SNU251 cells for loss-of-function assays.

[0088] Western blot analysis showed that, compared with si-NC treatment, the level of CDCA5 protein in UWB1.289 cells and SNU251 cells treated with si-CDCA5 was significantly reduced. Figure 2 Figure A in the middle~ Figure 2 (Figure C in the diagram). After CDCA5 knockdown, the cell viability of UWB1.289 cells and SNU251 cells gradually decreased. Figure 2 Image D in the middle~ Figure 2 (Figure E in the image). Immunofluorescence staining showed that inhibition of CDCA5 increased LC3-positive cells in UWB1.289 and SNU251 cells. Figure 2 (Figure F in the image). Transmission electron microscopy showed that the CDCA5 knockdown group exhibited more autophagosome structures, with organelles such as cytoplasm, mitochondria, and endoplasmic reticulum encased in a double-membrane structure. Figure 3(See Figure A in the image). Meanwhile, Western blot results showed that CDCA5 inhibition significantly upregulated ATG5 and Beclin1 levels in UWB1.289 and SNU251 cells, and downregulated p62SQSTM1 levels. Figure 3 Figure B in the middle~ Figure 3 (Figure D in the diagram). Simultaneously, knockdown of CDCA5 increased the level of γ-H2AX, a marker of DNA damage and repair, in UWB1.289 and SNU251 cells (Figure D in the diagram). Figure 3 (Figure E in the diagram).

[0089] The above results indicate that CDCA5 is involved in autophagy and DNA damage in BRCA1-mutant ovarian cancer.

[0090] 3. Knocking down CDCA5 in combination with olaparib inhibits the proliferation of BRCA1-mutated ovarian cancer cells, promotes autophagy and DNA damage.

[0091] Olaparib is a classic PARP inhibitor that inhibits base excision repair and reverses DNA damage that leads to tumor cell death. To evaluate whether downregulating CDCA5 in combination with olaparib induces a synergistic effect in BRCA1-mutated ovarian cancer, this invention knocked down CDCA5 in UWB1.289 and SNU251 cells and treated them with olaparib. The combination of silencing CDCA5 and olaparib inhibited the viability of UWB1.289 and SNU251 cells. Figure 4 Figure A in the middle~ Figure 4 Figure B in the diagram). The combined use of CDCA5 knockdown and olaparib further increased LC3-positive cells (Figure B). Figure 4 (See Figure C in the original text). Meanwhile, more autophagosome structures were observed in UWB1.289 and SNU251 cells treated with CDCA5 knockdown and olaparib. Figure 4 (Figure D in the diagram). Following siPKM2, olaparib further increased ATG5 and Beclin1 levels in UWB1.289 and SNU251 cells, and downregulated p62SQSTM1 levels (Figure D in the diagram). Figure 4 Figure E in the figure). CDCA5 knockdown combined with olaparib significantly upregulated the expression of the DNA damage marker γ-H2AX in UWB1.289 and SNU251 cells. Figure 4 F diagram in the middle ~ Figure 4 (H diagram in the image).

[0092] The above data indicate that silencing CDCA5 in combination with olaparib has a significant synergistic anti-tumor effect on BRCA1-mutated ovarian cancer, which may be related to enhanced autophagy and DNA damage.

[0093] 4. Knocking down CDCA5 in combination with olaparib can weaken the PI3K / AKT / mTOR pathway.

[0094] Subsequently, this invention further verified the effect of silencing CDCA5 in combination with olaparib on the PI3K / AKT / mTOR pathway.

[0095] Western blot results showed that, compared with cells transfected with si-NC, the levels of p-PI3K / PI3K, p-AKT / AKT, and p-mTOR / mTOR were decreased in UWB1.289 and SNU251 cells transfected with si-CDCA5; and in UWB1.289 and SNU251 cells, the expression level was further downregulated after knockdown of CDCA5 in combination with olaparib. Figure 5 ).

[0096] The above results highlight the importance of combined CDCA5 and olaparib knockdown of the PI3K / AKT / mTOR signaling pathway.

[0097] 5. Knocking down CDCA5 in combination with olaparib inhibits the proliferation of BRCA1-mutated ovarian cancer cells and promotes autophagy and DNA damage through the PI3K / AKT / mTOR pathway.

[0098] To explore the functional role of the PI3K / AKT / mTOR-related autophagy pathway in BRCA1-mutant ovarian cancer, this invention added MHY1485 (an mTOR activator that inhibits autophagy) or 740Y-P (a PI3K / AKT activator) to UWB1.289 cells treated with -cdca5 and olaparib. CCK-8 results showed that...

[0099] Compared with the si-CDCA5+olaparib group, both the si-CDCA5+olaparib+MHY1485 group and the si-CDCA5+olaparib+740Y-P group increased the viability of UWB1.289 cells. Figure 6 (Figure A in the text). Meanwhile, MHY1485 or 740Y-P both inhibited LC3-positive cells in si-CDCA5 and olaparib-treated UWB1.289 cells (Figure A in the text). Figure 6 (Figure B in the diagram). Similarly, fewer autophagosome structures were observed in the si-CDCA5+olaparib+MHY1485 and si-CDCA5+olaparib+740Y-P groups than in the si-CDCA5+olaparib group ( Figure 6 (See Figure C in the original text). MHY1485 and 740Y-P also inhibited ATG5 and Beclin1 levels and increased p62 SQSTM1 levels in UWB1.289 cells treated with olaparib. Figure 6 Image D in the middle~ Figure 6Figure E in the figure). MHY1485 or 740Y-P reversed the promoting effect of CDCA5 knockout combined with olaparib on γ-H2AX levels in UWB1.289 and SNU251 cells. Figure 7 (Figure A in the diagram). Furthermore, after processing with MHY1485 or 740Y-P, the PI3K / AKT / mTOR signaling pathway is activated ( Figure 7 Figure B in the middle~ Figure 7 (See Figure C in the table). These results indicate that the PI3K / AKT / mTOR pathway plays an important role in CDCA5 knockdown and olaparib-induced autophagy and DNA damage.

[0100] 6. In vivo knockdown of CDCA5 combined with olaparib inhibits tumor growth through the PI3K / AKT / mTOR pathway, and promotes autophagy and DNA damage.

[0101] This invention further evaluates the effect and mechanism of CDCA5 knockdown combined with olaparib on the in vivo antitumor effect of BRCA1-mutant ovarian cancer.

[0102] Compared with the control group, interfering with CDCA5 expression inhibited the occurrence of subcutaneous tumors in UWB1.289 cells. Figure 8 Figure A in the middle~ Figure 8 (See Figure C in the original text). More importantly, olaparib combined with CDCA5 knockdown effectively inhibited tumor growth, with the tumor volume of the combination therapy group being only half that of the CDCA5 knockdown group. Figure 8 Figure A in the middle~ Figure 8 (Figure C in the figure). Simultaneously, 740Y-P reversed the inhibitory effect of olaparib combined with CDCA5 knockdown on tumor growth (Figure C). Figure 8 Figure A in the middle~ Figure 8 (See Figure C in the diagram). Furthermore, the tumor cells in the control group were morphologically intact and appeared normal. Figure 6 (Figure B in the diagram). In contrast, the tumor tissue in the si-CDCA5 group was loose, characterized by numerous intercellular spaces and inflammatory cell infiltration (Figure B in the diagram). Figure 8 (Figure D in the diagram). In the si-CDCA5+olaparib+740Y-P group, the tumor tissue lesions were severe, with many cell ruptures and inflammatory cell infiltration, while further administration of 740Y-P reversed this phenomenon. Figure 8 (Figure D in the diagram). Ki67 is a key marker of cell proliferation. IHC analysis showed that silencing CDCA5 reduced Ki67 levels (Figure D in the diagram). Figure 8 (Figure D in the diagram). The combined treatment group showed a more significant reduction in Ki67-positive tumor cells, which was reversed by 740Y-P (Figure D). Figure 8 (See Figure D in the diagram). Simultaneously, the proportion of Tunell-positive cells inhibited by CDCA5 was higher than in the control group, indicating that olaparib enhanced the pro-apoptotic effect of CDCA5 downregulation in vivo.Figure 8 (Figure D in the diagram). YP administration partially reversed the combination therapy's promotion of tumor apoptosis ( Figure 8 (Figure D in the image). Western blot analysis revealed that after transfection with si-CDCA5, the levels of CDCA5, p62SQSTM1, and PI3K / AKT / mTOR pathways gradually decreased, while the levels of ATG5, Beclin1, and γ-H2AX increased. The combined treatment group showed a stronger effect in tumor tissue than the CDCA5 knockout group. Figure 9 Figure A in the middle~ Figure 9 (See Figure D in the diagram). Similarly, 740Y-P treatment partially reversed the effects of combination therapy on autophagy, DNA damage, and the expression of PI3K / AKT / mTOR-related proteins. Figure 8 and Figure 9 These results indicate that olaparib enhances the antitumor activity of CDCA5 knockdown in vivo, and its mechanism is related to PI3K / AKT / mtor-mediated autophagy and DNA damage.

[0103] As shown above, knocking down CDCA5 in combination with olaparib inhibits the growth of BRCA1-mutated ovarian cancer and promotes autophagy and DNA damage through the PI3K / AKT / mTOR pathway.

[0104] This invention is the first to identify a key molecule for CDCA5 knockout that, in combination with olaparib, can be used to treat BRCA1-mutant ovarian cancer. Knockdown of CDCA5 combined with olaparib inhibits the growth of BRCA1-mutant ovarian cancer and promotes autophagy and DNA damage through the PI3K / AKT / mTOR pathway.

[0105] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0106] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. Application of CDCA5 inhibitors in combination with olaparib in the preparation of drugs for the treatment of ovarian cancer.

2. The application according to claim 1, characterized in that, The CDCA5 inhibitors include at least one of the following: RNA interference molecules targeting CDCA5, antisense oligonucleotides, small molecule inhibitors, substances that induce lentiviral infection, and gene knockout substances.

3. The application according to claim 2, characterized in that, The gene knockout substance includes at least one of the CRISPR-Cas9 system, transcription activator-like effector nuclease, and zinc finger nuclease.

4. The application according to claim 2, characterized in that, The small molecule inhibitors include at least one of CDCA5-specific siRNA, shRNA expression vector, and antisense oligonucleotides.

5. The application according to claim 4, characterized in that, The small molecule inhibitor includes si-CDCA5; The nucleotide sequence of si-CDCA5 is shown in SEQ ID NO.

1.

6. The application according to claim 1, characterized in that, The drug also includes pharmaceutically acceptable carriers and / or excipients.

7. The application according to claim 6, characterized in that, The pharmaceutically acceptable carriers include at least one of physiological saline, phosphate buffer, glucose solution, polyethylene glycol, liposomes, and cyclodextrin.

8. The application according to claim 6, characterized in that, The pharmaceutically acceptable excipients include at least one of stabilizers, preservatives, antioxidants, pH adjusters, emulsifiers, and disintegrants.

9. The application according to claim 1, characterized in that: The dosage form of the drug includes at least one of tablets, capsules, injections, sustained-release formulations, nanoparticles, liposomes, and lyophilized powder for injection.

Images