Marker composition for evaluating atopic dermatitis treatment effect of mesenchymal stem cells and application of marker composition

By detecting changes in the mRNA expression of Ighg1, Mfsd4a, and Selenbp1 genes, and combining this with computer prediction, the complexity and inaccuracy of existing technologies for evaluating the efficacy of mesenchymal stem cell therapy have been resolved, enabling precise evaluation of the treatment effect of atopic dermatitis.

CN121109581AActive Publication Date: 2025-12-12HANGZHOU S EVANS BIOSCI LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511679308.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2025-12-12
Estimated Expiration
2045-11-17

AI Technical Summary

Technical Problem

Current technologies lack effective methods to evaluate the efficacy of mesenchymal stem cells in the treatment of atopic dermatitis, and traditional methods are complex and not precise enough.

Method used

Using mRNAs of Ighg1, Mfsd4a, and Selenbp1 genes as biomarker combinations, the efficacy of mesenchymal stem cell therapy for atopic dermatitis was evaluated by quantitative PCR detection of changes in the expression of these genes, and predictions were made using computer-readable media.

Benefits of technology

This provides a more precise and sensitive method for evaluating therapeutic efficacy, simplifies the sampling process, and improves the intuitiveness and accuracy of the evaluation, reflecting the therapeutic effect of mesenchymal stem cells on atopic dermatitis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109581A_ABST
    Figure CN121109581A_ABST
Patent Text Reader

Abstract

The invention provides a marker composition for evaluating the atopic dermatitis treatment effect of mesenchymal stem cells and application of the marker composition, and relates to the technical field of biology. The marker composition is prepared from an Ighg1 gene, an Mfsd4a gene and a Selenbp1 gene. The marker composition is applied to preparation of a product for evaluating the atopic dermatitis treatment effect of a subject treated by the mesenchymal stem cells, and the problem that in the prior art, a method for evaluating the atopic dermatitis treatment effect of the mesenchymal stem cells is lacked is solved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a marker composition for evaluating the effect of mesenchymal stem cell therapy on atopic dermatitis and application thereof. BACKGROUND

[0002] The following statements are only provided with the background information related to the present application, and do not necessarily constitute the prior art.

[0003] Atopic dermatitis (AD) is also known as atopic eczema, which is a chronic recurrent, pruritic, inflammatory skin disease, and is characterized by repeated occurrence of severe itching and dry skin. At present, the treatment of AD usually involves the topical and / or systemic use of moisturizers, glucocorticoids and immunosuppressive agents. However, the topical use of glucocorticoids has limited effect on moderate to severe AD patients, and the systemic use of immunosuppressive agents has the risk of bone marrow suppression and increased infection opportunities, so it is necessary to develop a new and safe and effective method for treating AD.

[0004] Mesenchymal stem / stromal cells (MSCs) are adult stem cells derived from mesoderm, which can be obtained from bone marrow, adipose tissue, placenta, umbilical cord and other tissues. More and more studies have shown that MSCs transplantation can significantly improve the repair of damaged tissues, including bone defects, brain injury, myocardial infarction, acute liver, lung injury, ulcerative colitis, etc. Studies have shown that MSCs have strong immunomodulatory function, especially in inhibiting excessive Th2 response, promoting Treg, inhibiting mast cells and reducing IgE. MSCs also have tissue repair function, promote barrier protein expression and improve keratinocyte function. Previous studies have shown that MSCs injection can regulate skin barrier function, significantly reduce dermal inflammatory cell infiltration (eosinophils, mast cells, lymphocytes), and promote inflammation resolution and tissue repair in the lesion site. Through multi-target and multi-pathway intervention in the core pathological link of AD, the effect of significantly improving clinical symptoms and histopathological damage is ultimately achieved. The mechanism and efficacy evaluation method of MSCs in treating AD still need further research.

[0005] In view of this, the present application is proposed. SUMMARY

[0006] The purpose of the present application is to provide a marker composition for evaluating the effect of mesenchymal stem cell therapy on atopic dermatitis and application thereof, so as to alleviate the problem that the prior art lacks an efficacy evaluation method for mesenchymal stem cell therapy on atopic dermatitis.

[0007] To solve the above technical problems, the technical scheme is as follows: In a first aspect, there is provided a use of a substance for detecting a marker composition in the preparation of a product for evaluating the treatment effect of atopic dermatitis of a subject, the marker composition comprising a first marker, a second marker and a third marker; The first marker is mRNA of an Ighg1 gene. The second marker is mRNA of an Mfsd4a gene. The third marker is mRNA of a Selenbp1 gene. The subject is treated with mesenchymal stem cells.

[0008] In a second aspect, there is provided a kit for evaluating the treatment effect of atopic dermatitis of a subject, the kit comprising the substance for detecting the marker composition as described in the first aspect, the subject being treated with mesenchymal stem cells.

[0009] In a third aspect, there is provided a device for evaluating the treatment effect of atopic dermatitis of a subject, the device comprising a detection module and a prediction judgment module, the subject being treated with mesenchymal stem cells; the detection module is used for detecting the marker composition as described in the first aspect. The prediction judgment module comprises a computer readable medium recording a judgment rule, the computer readable medium, when executed, realizes comparing the amount of the marker composition of a sample of the subject treated with mesenchymal stem cells and a sample of a subject not treated; if the amount of the first marker of the sample of the subject treated with mesenchymal stem cells is reduced compared with the sample of the subject not treated, and the amount of the second marker and the third marker is increased, it is determined that the subject treated with mesenchymal stem cells is effective.

[0010] Compared with the prior art, the present application has the following beneficial effects: The present application finds that mesenchymal stem cells can improve the skin pathological damage of an atopic dermatitis model and reduce the skin damage score, and has obvious treatment effect. Meanwhile, through transcriptome sequencing, a group of up-regulated genes Mfsd4a gene and Selenbp1 gene and down-regulated gene Ighg1 gene highly related to the treatment effect of mesenchymal stem cells are first found, and it is confirmed through quantitative PCR that the detection of the group of genes can be used for evaluating the treatment effect of mesenchymal stem cells on atopic dermatitis.

[0011] Based on the finding, the application takes the found gene combination as a marker composition, which is significantly related to mouse atopic dermatitis lesions and treatment, provides new data support and research ideas for the pathogenesis of atopic dermatitis, and perfects the evaluation system of mesenchymal stem cell treatment of atopic dermatitis. In the prior art, the skin epidermis score, blood test and even pathological biopsy are usually used for analysis. Compared with the prior art, the application verifies the high correlation between the expression of the marker composition and the skin epidermis score, simplifies the sampling mode and evaluation mode of the traditional atopic dermatitis treatment evaluation, and at the same time obtains more intuitive, accurate and sensitive effect evaluation.

[0012] In summary, the application provides methodological support for evaluating the effect of mesenchymal stem cells in the treatment of atopic dermatitis, and provides a new idea for developing accurate and sensitive stem cell treatment efficacy evaluation technology. BRIEF DESCRIPTION OF DRAWINGS

[0013] In order to more clearly illustrate the specific embodiments of the application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0014] Figure 1 Skin tissue morphology of each experimental group of mice in Example 2; Figure 2 Skin epidermis score of a representative mouse in Example 2; Figure 3 Relative expression amount of mouse Slc38a5 gene in Example 4; Figure 4 Relative expression amount of mouse Ighg1 gene in Example 4; Figure 5 Relative expression amount of mouse Mfsd4a gene in Example 4; Figure 6 Relative expression amount of mouse Selenbp1 gene in Example 4; Figure 7 ROC curve for verifying the correlation between the expression of the gene combination and the histological score in Example 6. DETAILED DESCRIPTION

[0015] The technical solutions of the present application will be described clearly and completely below in connection with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0016] In this document, all the embodiments and preferred embodiments mentioned herein can be combined with each other to form new technical solutions, if not specifically stated. All the technical features and preferred features mentioned herein can be combined with each other to form new technical solutions. The components involved or the preferred components thereof can be combined with each other to form new technical solutions.

[0017] In this document, unless otherwise specified, any number is used to distinguish one entity or behavior from another entity or behavior, rather than necessarily requiring or implying any actual such relationship, order or importance between the entities or behaviors, such as the first, second, third and fourth numbers.

[0018] In this document, unless otherwise specified, "optionally", "optional", "optional" or "option" means that the event or environment described subsequently can but does not necessarily occur, and the description includes the case where the event or environment occurs or does not occur.

[0019] In this document, the term "each independently selected from" is interchangeable with "… respectively independently selected from" and "… independently selected from", and should be interpreted broadly, which can mean that the specific options expressed between the same type of elements in different sets do not affect each other, or that the specific options expressed between the same type of elements in the same set do not affect each other.

[0020] In this document, the term "comprising" or "including" means including the elements, integers or steps described, but does not exclude any other elements, integers or steps.

[0021] In this document, the terms "patient", "subject" or "individual" are used interchangeably and include human or non-human animals, or cells, blood, tissues, body fluids or secretions derived from human or non-human animals, such as humans, monkeys, mice, rats, rabbits, donkeys, cows, horses, pigs or dogs.

[0022] In this document, the term "expression product of a gene" refers to the product produced by the gene through processes such as transcription and translation, which can be a direct product or a product after the direct product is cut, recombined, replicated or metabolized. Exemplary "expression product of a gene" includes but is not limited to RNA or polypeptide.

[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Methods and materials similar or equivalent to those described herein can be used in the practice of the application.

[0024] In a first aspect, there is provided a use of a substance of a marker composition comprising a first marker, a second marker and a third marker in the manufacture of a product for evaluating therapeutic effect of atopic dermatitis in a subject, wherein the subject is treated with mesenchymal stem cells. In an alternative embodiment, the subject is treated with umbilical cord mesenchymal stem cells.

[0025] The first marker comprises Ighg1 gene and / or an expression product of Ighg1 gene, Ighg1 gene (immunoglobulin heavy chain gamma 1 constant region gene) is essential for the production of IgG1 antibodies with potent effector functions, and is a key player in the adaptive immune response to clear pathogens and abnormal cells. Alternatively, the expression product of Ighg1 gene comprises at least one of mRNA and polypeptide, preferably mRNA.

[0026] The second marker comprises Mfsd4a gene and / or an expression product of Mfsd4a gene, Mfsd4a (major facilitator superfamily domain-containing 4A) gene is likely to be involved in the regulation of neuronal communication or synaptic function, and belongs to the member of solute transporter protein family. Alternatively, the expression product of Mfsd4a gene comprises at least one of mRNA and polypeptide, preferably mRNA.

[0027] The third marker comprises Selenbp1 gene and / or an expression product of Selenbp1 gene, Selenbp1 (Selenium-binding protein 1) gene catalyzes the oxidation of methanethiol, participates in sulfur metabolism and redox balance, and plays a regulatory role in cancer inhibition and cardiovascular diseases. Alternatively, the expression product of Selenbp1 gene comprises at least one of mRNA and polypeptide, preferably mRNA.

[0028] In an alternative embodiment, the marker composition comprises a fourth marker, the fourth marker comprises Slc38a5 gene and / or an expression product of Slc38a5, Slc38a5 (Solute Carrier Family 38 Member 5) gene encodes a 12-transmembrane Na +This is a amino acid-dependent transporter protein expressed in tissues such as the liver, kidneys, brain (astrocytes), and umbilical cord, participating in physiological processes such as amino acid metabolism, cellular nutrient supply, acid-base balance regulation, and the neurotransmitter precursor (glutamate / γ-aminobutyric acid) cycle. Optionally, the expression product of the Slc38a5 gene includes at least one of mRNA and polypeptide, preferably including mRNA.

[0029] In optional embodiments, the substances in the detection biomarker composition include one or more of the following: probes, reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, total RNA extraction reagents, and reverse transcription reagents. Depending on the specific detection method, those skilled in the art can select the substances in the detection biomarker composition based on methods described in general and more specific textbooks, references, process manuals, product instructions, and standard documents; this invention does not limit this selection. Specific examples include, but are not limited to, at least one of the following: enzymes for amplification reactions, enzymes for reverse transcription, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, primers for gene amplification, probes, positive controls, and negative controls.

[0030] In an optional embodiment, the biomarker composition includes mRNA from the Ighg1 gene, mRNA from the Mfsd4a gene, and mRNA from the Selenbp1 gene.

[0031] In an optional embodiment, the biomarker composition includes mRNA of the Ighg1 gene, mRNA of the Mfsd4a gene, mRNA of the Selenbp1 gene, and mRNA of the Slc38a5 gene.

[0032] The substance in the detection marker composition includes at least one of (i) to (iv): (i) The upstream and downstream primers for detecting the first marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0033] (ii) The upstream and downstream primers for detecting the second marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0034] (iii) The upstream and downstream primers for detecting the third marker, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.5, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0035] (iv) The upstream and downstream primers for detecting the fourth marker, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.7, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.8, and the working concentration is preferably 8~12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0036] In an optional embodiment, the substances in the detection biomarker composition further include an upstream primer and a downstream primer for detecting the internal reference GAPDH. The nucleotide sequence of the upstream primer for detecting GAPDH is shown in SEQ ID NO.9, and the working concentration is preferably 8-12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM; the nucleotide sequence of the downstream primer for detecting GAPDH is shown in SEQ ID NO.10, and the working concentration is preferably 8-12 μM, for example, but not limited to 8, 9, 10, 11 or 12 μM, and more preferably 10 μM.

[0037] In a second aspect, a kit is provided for evaluating the therapeutic effect of atopic dermatitis in a subject, the kit comprising the substance of the detection biomarker composition described in the first aspect, the subject being treated with mesenchymal stem cells.

[0038] In an optional embodiment, the kit comprises one or more of the following: probes, reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, total RNA extraction reagents, and reverse transcription reagents. Depending on the specific detection method, those skilled in the art can select the composition of the reagents in the kit according to methods described in general and more specific textbooks, references, process manuals, product instructions, and standard documents; this invention does not limit this selection. Optionally, the kit includes, but is not limited to, at least one of the following: enzymes for amplification reactions, enzymes for reverse transcription, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, primers for gene amplification, probes, quality control reagents, positive controls, and negative controls.

[0039] In an optional embodiment, the kit comprises at least one of (i) upstream and downstream primers for detecting a first biomarker, (ii) upstream and downstream primers for detecting a second biomarker, (iii) upstream and downstream primers for detecting a third biomarker, and (iv) upstream and downstream primers for detecting a fourth biomarker.

[0040] Thirdly, an apparatus for evaluating the therapeutic effect of atopic dermatitis in a subject is provided, the apparatus comprising a detection module and a prediction module, wherein the subject has undergone mesenchymal stem cell therapy; the detection module is used to detect the biomarker composition described in the first aspect; The prediction and judgment module includes a computer-readable medium containing judgment rules. When the computer-readable medium is processed and executed, it compares the amount of the biomarker composition in a subject sample treated with mesenchymal stem cells and an untreated subject sample. If the amount of the first biomarker in the subject sample treated with mesenchymal stem cells is lower than that in the untreated subject sample, and the amounts of the second and third biomarkers are higher, then the subject treated with mesenchymal stem cells is determined to have received effective treatment.

[0041] In an optional embodiment, the prediction and judgment module includes a computer-readable medium containing judgment rules. When the computer-readable medium is processed and executed, it compares the amount of the biomarker composition in a subject sample treated with mesenchymal stem cells and an untreated subject sample. If the amount of the first biomarker in the subject sample treated with mesenchymal stem cells is lower than that in the untreated subject sample, the amounts of the second and third biomarkers are higher, and the amount of the fourth biomarker is lower, then the subject treated with mesenchymal stem cells is determined to have received effective treatment.

[0042] In optional embodiments, the amount of the biomarker composition includes, but is not limited to, the amount of a gene transcribed into mRNA or the amount of a gene translated into a polypeptide or protein.

[0043] In an optional embodiment, the first biomarker is the mRNA of the Ighg1 gene, the second biomarker is the mRNA of the Mfsd4a gene, the third biomarker is the mRNA of the Selenbp1 gene, and optionally the fourth biomarker is the mRNA of the Selenbp1 gene. The detection module includes amplifying mRNA using nucleic acid amplification reagents or obtaining cDNA from mRNA through reverse transcription, and the amount of the biomarker composition includes the expression level of the mRNA.

[0044] In an optional embodiment, the amplification reagent includes the upstream and downstream primers of the aforementioned nucleotide sequences as shown in SEQ ID NO. 1-6, respectively, used for amplifying the first to third markers.

[0045] In an optional embodiment, the amplification reagent includes the upstream and downstream primers of the aforementioned nucleotide sequences as shown in SEQ ID NO. 1-8, respectively, used for amplifying the first to fourth markers.

[0046] In an optional implementation, the detection module is used to implement the quantitative real-time PCR reaction procedure, including the following steps: reverse transcription of mRNA extracted from the sample to be tested into cDNA, and performing quantitative real-time PCR (qRT-PCR) reaction using cDNA as a template; collecting the fluorescence signal and Ct value of qRT-PCR, and combining the two for analysis of the prediction and judgment module results.

[0047] In an optional implementation, the amplification reaction procedure is as follows: First step, pre-denaturation at 95℃ for 5 min; second step, cyclic reaction, 5℃ for 10 s, 60℃ for 30 s, for 45 cycles; final step, melting curve, 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s.

[0048] In an optional implementation, the relative expression level of mRNA in the sample is calculated as the amount of the biomarker composition based on the Ct value of the sample to be tested, using conventional calculation methods known in the art.

[0049] In an optional implementation, GAPDH is used as an internal reference for calculating the relative expression level of mRNA, wherein the GAPDH is amplified by primers with the aforementioned nucleotide sequences as shown in SEQ ID NO. 9 and 10.

[0050] In an optional implementation, the amount of the biomarker composition in untreated subject samples and the amount of the biomarker composition in mesenchymal stem cell-treated subject samples are obtained from the same detection process; or, the amount of the biomarker composition in the untreated subject samples is preset in the prediction and judgment module.

[0051] In an optional implementation, the test sample may be derived from conventional samples used for clinical testing in the art, including but not limited to cells, blood (plasma or serum), cells, tissues, body fluids and secretions, preferably including at least one of tissues and blood.

[0052] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0053] Example 1 Establishment of a mouse model of atopic dermatitis and HUCMSC (human umbilical cord mesenchymal stem cells) therapy: Six SPF-grade BALB / c mice (female, 4-6 weeks old) were randomly selected for each group and kept under a 12-hour light / dark cycle at 22±2℃ with humidity maintained at 50%-60%.

[0054] (1) Sensitization by intraperitoneal injection: Dissolve 100 μg of ovalbumin (OVA) in physiological saline to a concentration of 1 μg / μl, and mix with 100 μl of alum adjuvant (40 mg / ml). Administer the mixture intraperitoneally once a week for three weeks (days 0, 7, and 14).

[0055] (2) Skin irritation: Mice were shaved on the back and neck, and after disinfection, gauze soaked in sterile water at a concentration of 1 mg OVA (10 μg / μl) was fixed to the shaved skin surface (1.2 cm × 1.2 cm). The dressing was changed 2-3 times a week for two weeks, and repeated exposure was used to induce AD. A mouse AD model was established by combining intraperitoneal injection of OVA and skin stimulation.

[0056] Two to three days after inducing AD-like symptoms, HUCMSC preparations were subcutaneously injected into the skin model on days 31, 33, and 35 of the experiment. The HUCMSC dose was 0.3 × 10⁻⁶. 7 Cells / kg. After treatment, the same skin stimulation was applied to the back lesions for 7 days. Three days after the stimulation was completed, the edema, erythema, and crusting on the surface of the mouse skin lesions were observed. The animals were then sacrificed, and full-thickness skin lesion specimens were taken for further analysis.

[0057] Example 2 Histological examination and RNA-Seq: I. Histological examination: The skin epidermis of mice in each group in Example 2 was observed and scored. The skin epidermis scoring criteria are as follows: 0 points: No abnormalities; 1 point: Mild erythema / slight thickening; 2 points: Moderate erythema / thickening with localized desquamation; 3 points: Severe erythema / significant thickening with extensive crusting; 4 points: Severe edema, erosion with blood crusts.

[0058] Table 1. Skin epidermal scoring results

[0059] The skin tissue morphology of mice in each experimental group is as follows: Figure 1 As shown in Table 1, the skin epidermal scores of mice are presented, and representative epidermal score images of mice are shown in the figure. Figure 2 As shown, the results indicate that subcutaneous injection of HUCMSCs can effectively improve skin tissue damage in mice with OVA-induced atopic dermatitis by combining peritoneal and skin treatments, and reduce epidermal scores.

[0060] 2. RNA-Seq: Total RNA was extracted from full-thickness skin tissue of BALB / c mice (n=3) using TRIzol reagent (Invitrogen). RNA purity and integrity were analyzed using an Agilent Bioanalyzer 2100 (Agilent Technologies). RNA sequencing was performed using an Illumina HiSeq 4000 sequencing system. RNA-Seq data mapping was performed using the MapSplice program. Expression levels of each gene were measured per kilobase per million transcripts. The quality of the paired-end data fastq (.gz) files was analyzed using fastqc next-generation sequencing data quality analysis software. The filtered fastq.qz data files (containing cDNA sequences) were aligned with the corresponding reference genome using hisat2 to generate the corresponding SAM files. Subsequent steps included assembly screening of differentially expressed genes, GO annotation and KEGG analysis, protein-protein interaction network analysis, and key gene analysis.

[0061] Differential gene analysis of RNA-Seq data revealed that four genes were selected as candidate genes for both upregulation and downregulation, showing significant upregulation and downregulation effects. In mice treated with subcutaneous injection of HUCMSCs, the expression of Slc38a5 and Ighg1 genes was upregulated compared to normal mice, while the expression of Mfsd4a and Selenbp1 genes was downregulated.

[0062] Table 2 Gene Analysis Results

[0063] Example 3 A set of gene compositions for evaluating umbilical cord mesenchymal stem cell therapy for Alzheimer's disease is provided, including primer combinations as described in Table 3: Table 3 Primer Sequences

[0064] Where B represents A or G, Y represents C or T, and M represents A or C. The primer sequences in the degenerate primers are mixed in equimolar proportions.

[0065] Example 4 RT-PCR verification: The atopic dermatitis model and HUCMSC treatment experiment of Example 1 were repeated. Five weeks later, full-thickness skin tissue was obtained, and total RNA was extracted using TRIzol reagent (Invitrogen), followed by reverse transcription to obtain cDNA. Quantitative real-time PCR (qRT-PCR) was performed using the primer sequences provided in Table 3 and the internal reference gene GADPH primer sequences SAD ID NO. 9 and SAD ID NO. 10 to determine the relative mRNA levels of candidate genes. qPCR amplification was performed in a total volume of 10 μL according to the kit instructions.

[0066] Forward and reverse primers for the GADPH gene: The forward primer is: F: AATGGATTTGGACGCATTGGT (SAD ID NO. 9); The reverse primer is: R: TTTGCACTGGTACGTGTTGAT (SAD ID NO.10).

[0067] The amplification conditions for qRT-PCR are as follows: Step 1, pre-denaturation at 95℃ for 5 min; Step 2, cycling reaction: 5℃ for 10 s, 60℃ for 30 s, for 45 cycles; Step 3, melting curve: 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. (Using 2...) -ΔΔCT The method uses GAPDH as an internal reference.

[0068] Each sample was evaluated in triplicate, and measurements were repeated independently at least three times. Data analysis was then performed based on the average threshold (Ct).

[0069] Each sample was evaluated in triplicate, and measurements were performed independently at least three times. The results are as follows: Figure 3~Figure 6 As shown, the results indicate that the expression level of Slc38a5 gene mRNA in the HUCMSC group was downregulated compared to the model group. Figure 3 Ighg1 gene mRNA expression was downregulated relative to the model group. Figure 4 The expression levels of Mfsd4a gene mRNA and Selenbp1 gene mRNA were upregulated relative to the model group. Figure 5 and Figure 6 ).

[0070] Example 5 Correlation analysis between gene expression and skin histology score: The CORREL function was used to analyze the correlation between changes in candidate gene expression and skin histology scores. A correlation coefficient close to 1 or -1 indicates a strong correlation; close to 1 indicates a positive correlation; close to -1 indicates a negative correlation; a correlation coefficient of 0 indicates no correlation; below 0.4 indicates a low correlation; 0.4–0.7 indicates a significant correlation; and above 0.7 indicates a high correlation. The results showed that changes in Ighg1 gene expression were highly positively correlated with skin histology scores, changes in Mfsd4a and Selenbp1 gene expression were highly negatively correlated with skin histology scores, and changes in Slc38a5 gene expression were lowly correlated with skin histology scores. This indicates that changes in the gene combination Ighg1, Mfsd4a, and Selenbp1 are highly correlated with pathological histology scores.

[0071] Table 4 Gene Correlation Coefficient Results

[0072] Example 6 Validation of the correlation between gene expression and skin epidermal score: The atopic dermatitis model establishment and HUCMSC treatment experiment in Example 1 were repeated, with the number of mice in each group increased to 30. After five weeks, full-thickness skin tissue was obtained, and total RNA was extracted using TRIzol reagent (Invitrogen). Quantitative real-time PCR (qRT-PCR) was performed using the primer sequences provided in Table 3 and the internal reference gene primer sequences SAD ID NO. 9 and SAD ID NO. 10 to determine the relative mRNA levels of candidate genes. qPCR amplification was performed in a total volume of 10 μL according to the kit instructions.

[0073] The amplification conditions for qRT-PCR are as follows: Step 1, pre-denaturation at 95℃ for 5 min; Step 2, cycling reaction: 5℃ for 10 s, 60℃ for 30 s, for 45 cycles; Step 3, melting curve: 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. (Using 2...) -ΔΔCT The method uses GAPDH as an internal reference. Each sample is evaluated in triplicate, and measurements are repeated independently at least three times. Finally, data analysis is performed based on the average threshold (Ct).

[0074] When the Ct value of the test sample is less than 40 and there is an obvious amplification curve, and the Ct value of the blank control (the model group without HUCMSC treatment) is greater than 40 and there is no obvious amplification curve, the fluorescence signal is used for the result analysis of mRNA expression level.

[0075] The HUCMSC treatment was deemed effective if the expression level of the Ighg1 gene in the model group was significantly lower than that in the untreated model group, and the expression levels of the Mfsd4a and Selenbp1 genes were significantly higher than those in the untreated model group. If at least one of these three gene expression levels did not meet the criteria, the HUCMSC treatment was deemed ineffective. ROC curves were plotted to validate the gene composition based on histological scoring and PCR results. The ROC curves were analyzed to obtain... Figure 7 AUC value = 96.73%, P < 0.0001.

[0076] In summary, the results indicate that HUCMSCs can alleviate AD damage induced by combined intraperitoneal and skin OVA to a certain extent, demonstrating a therapeutic effect on AD. Functional analysis of candidate genes showed that mice injected subcutaneously with HUCMSCs exhibited improved immune regulation and reduced inflammation levels. RT-PCR analysis confirmed a high correlation between changes in this gene composition and skin histological scores. Therefore, the biomarker composition and kit provided by this invention can reflect the therapeutic effect of HUCMSCs on AD to a certain extent and can be used for evaluating the efficacy of AD treatment.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of a substance comprising a biomarker composition in the preparation of a product for evaluating the therapeutic effect of atopic dermatitis in a subject, wherein the biomarker composition comprises a first biomarker, a second biomarker, and a third biomarker; The first biomarker is the mRNA of the Ighg1 gene; The second biomarker is the mRNA of the Mfsd4a gene; The third biomarker is the mRNA of the Selenbp1 gene; The subjects received mesenchymal stem cell therapy.

2. The application according to claim 1, characterized in that, The biomarker composition further includes a fourth biomarker, which includes mRNA of the Slc38a5 gene.

3. The application according to claim 1, characterized in that, The subjects were treated with umbilical cord mesenchymal stem cells.

4. The application according to claim 1, characterized in that, The substances in the detection biomarker composition include one or more of the following: probes, reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, total RNA extraction reagents, and reverse transcription reagents.

5. The application according to claim 4, characterized in that, The substances in the detection marker composition include (i), (ii), and (iii): (i) The upstream and downstream primers for detecting the first marker have nucleotide sequences as shown in SEQ ID NO.1 and 2, respectively; (ii) The upstream and downstream primers for detecting the second biomarker have nucleotide sequences as shown in SEQ ID NO.3 and 4, respectively; (iii) The upstream and downstream primers for detecting the third biomarker have nucleotide sequences as shown in SEQ ID NO.5 and 6, respectively.

6. The application according to claim 5, characterized in that, The substances in the detection marker composition also include (iv): (iv) The upstream and downstream primers for detecting the fourth marker have nucleotide sequences as shown in SEQ ID NO.7 and 8, respectively.

7. The application according to claim 4, characterized in that, The substances in the detection biomarker composition further include an upstream primer with a nucleotide sequence as shown in SEQ ID NO.9 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.10 for detecting the internal reference.

8. The application according to any one of claims 5 to 7, characterized in that, The working concentration of each of the upstream primers is independently 8-12 μM; and / or, the working concentration of each of the downstream primers is independently 8-12 μM.

9. A kit for evaluating the therapeutic effect of atopic dermatitis in subjects, characterized in that, A substance comprising the detection biomarker composition according to any one of claims 1 to 8, wherein the subject has been treated with mesenchymal stem cells.

10. A device for evaluating the therapeutic effect of atopic dermatitis in a subject, characterized in that, The study includes a detection module and a prediction module, wherein the subject has undergone mesenchymal stem cell therapy; the detection module is used to detect the biomarker composition according to any one of claims 1 to 8; The prediction and judgment module includes a computer-readable medium containing judgment rules. When the computer-readable medium is processed and executed, it compares the amount of the biomarker composition in a subject sample treated with mesenchymal stem cells and an untreated subject sample. If the amount of the first biomarker in the subject sample treated with mesenchymal stem cells is lower than that in the untreated subject sample, and the amounts of the second and third biomarkers are higher, then the subject treated with mesenchymal stem cells is determined to have received effective treatment.

Citation Information

Patent Citations

  • Treatment of atopic dermatitis using mesenchymal stem cells and immune modulation

    CN113396333A

  • Method for detecting atopic dermatitis

    CN115485390A

  • Application of MSCs and AMP in preparation of atopic dermatitis intervention product and preparation

    CN116059246A

  • Transcriptome analysis for treating inflammation

    CN119137282A

  • Method for predicting therapeutic effect in the treatment of atopic dermatitis using mesenchymal stem cells

    JP6375076B1