Combination drug for treating prostate cancer and use thereof

Abstract

The application discloses a combined drug for treating prostate cancer and application, the combined drug is a combined drug of FEN1-IN-4 and TRi-1 administered respectively or simultaneously, the FEN1-IN-4 is an inhibitor targeting Flap endonuclease 1, and the TRi-1 is an inhibitor targeting thioredoxin (TXN) antioxidant system.The combined treatment scheme of FEN1-IN-4 and TRi-1 provided by the application firstly shows a strong antitumor effect superior to single drug in vitro experiment.FEN1-IN-4 as FEN1 specific inhibitor can block the endonuclease function of FEN1 by combining with the active site of FEN1, and can achieve significant growth inhibition to various prostate cancer cell lines such as LNCaP, 22RV-1, PC3, DU145, and the like, and TRi-1 as TXN antioxidant system inhibitor can target to destroy the oxidative stress balance of tumor cells, and the two act on different key pathways (DNA replication / damage repair pathway and antioxidant defense pathway) of tumor cells, forming a "double targeting" synergistic effect.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to combination drugs and their applications in the treatment of prostate cancer. Background Technology

[0002] Prostate cancer (PCa) is one of the most common malignant tumors among men worldwide, and its incidence is continuously rising. The clinical symptoms of prostate cancer are characterized by both typical and insidious presentations. Patients often experience progressive difficulty urinating, which may be accompanied by urinary frequency, urgency, hematuria, and other urinary abnormalities. Some patients may also experience pain or burning sensations during urination, along with persistent pain in the lower back, upper thigh, and pelvic region. However, the disease is often asymptomatic in its early stages—no obvious clinical manifestations are present in the initial stages of the tumor. Most patients only seek medical attention when symptoms of metastasis appear. Furthermore, the long latency period of prostate cancer makes its progression difficult to detect in a timely manner, leading to a situation where most patients are diagnosed at an advanced stage, posing a significant challenge to subsequent treatment.

[0003] Prostate cancer (PCa) often presents with problems such as disease recurrence, progression, and treatment resistance in clinical treatment. The growth and metastasis of prostate cancer are highly dependent on androgens (such as dihydrotestosterone), with approximately 90% of androgens secreted by the testes. After entering cells, androgens bind to androgen receptors, which are nuclear transcription factors, thereby initiating the expression of related genes and ultimately promoting cancer cell proliferation and tumor progression. Based on this, androgen deprivation therapy (including orchiectomy and drug suppression of androgen levels) has become the mainstream treatment approach, producing significant efficacy in most patients. However, the duration of this efficacy is limited—usually only lasting 1-4 years—and after traditional androgen deprivation therapy (ADT), it progresses to castration-resistant prostate cancer (CRPC), ultimately leading to treatment failure. Therefore, developing novel, highly effective, and well-tolerated treatment strategies is of significant clinical importance. Summary of the Invention

[0004] The main objective of this invention is to propose a combination drug for treating prostate cancer and its application, aiming to provide a combination drug of FEN1-IN-4 and TRi-1, which exhibits significant anti-tumor efficacy.

[0005] To achieve the above objectives, the present invention proposes a combination drug for treating prostate cancer, wherein the combination drug is a combination of FEN1-IN-4 and TRi-1 administered separately or simultaneously, wherein FEN1-IN-4 is an inhibitor targeting Flap endonuclease 1, and TRi-1 is an inhibitor targeting the thioredoxin antioxidant system.

[0006] The present invention also proposes the use of a combined pharmaceutical composition comprising FEN1-IN-4 and TRi-1 in the preparation of a medicament for treating prostate cancer.

[0007] FEN1 (Flap Endonuclease 1) is a key endonuclease that plays a crucial role in DNA replication and damage repair. It is overexpressed in prostate cancer, promoting its progression. FEN1-IN-4 is a selective FEN1 inhibitor that inhibits DNA replication and interferes with DNA damage repair by blocking its endonuclease activity, increasing genomic instability in cancer cells and thus suppressing tumor growth. TRi-1 is an inhibitor targeting the thioredoxin (TXN) antioxidant system. By inhibiting TXN's reducing activity, it disrupts intracellular redox homeostasis and affects the redox modification state of FEN1 protein. Studies have shown that FEN1 inhibition and TXN inhibition have a synergistic effect, with the dual action leading to synthetic lethality and significantly enhancing antitumor activity.

[0008] Preferably, the molar ratio of FEN1-IN-4 to TRi-1 in the combined pharmaceutical composition is 1:2 to 10:1.

[0009] Preferably, the molar ratio of FEN1-IN-4 to TRi-1 is 4:1.

[0010] Preferably, the combined pharmaceutical composition is a formulation prepared by using FEN1-IN-4 and TRi-1 as anticancer active ingredients simultaneously, with the addition of pharmaceutically acceptable auxiliary ingredients.

[0011] Preferably, the formulation is an injectable formulation.

[0012] Preferably, the effective concentration of FEN1-IN-4 in the combined drug composition is 5 μM to 50 μM, and the effective concentration of TRi-1 is 1 μM to 10 μM.

[0013] Preferably, in the combined drug composition, FEN1-IN-4 is the main drug component and TRi-1 is the synergistic drug component.

[0014] This invention also proposes the use of FEN1-IN-4 in the preparation of drugs for treating prostate cancer.

[0015] Preferably, the effective concentration of FEN1-IN-4 in the drug is 0.1 μM to 100 μM.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] (1) The combined treatment regimen of FEN1-IN-4 and TRi-1 provided by the present invention first showed a stronger anti-tumor effect than single drugs in in vitro experiments. On the one hand, FEN1-IN-4, as a specific inhibitor of FEN1, can block the endonuclease function of FEN1 by binding to the active site of FEN1, and can significantly inhibit the growth of various prostate cancer cell lines such as LNCaP, 22RV-1, PC3, and DU145. On the other hand, TRi-1, as an inhibitor of the TXN antioxidant system, can target and disrupt the oxidative stress balance of tumor cells. The two play a role in different key pathways of tumor cells (DNA replication and repair pathway and antioxidant defense pathway), forming a "dual-targeting" synergistic effect. On the other hand, this combination regimen effectively overcomes the problem of compensatory repair pathway activation that may be caused by single-targeting FEN1: In vitro experimental data show that the combination therapy significantly reduced the survival rate of prostate cancer cells compared with the single-drug group, and the combination index CI < 1, confirming that the two have a synergistic inhibitory effect. This not only expands the coverage of different subtypes of prostate cancer cells, but also strengthens the blocking effect on tumor cell proliferation, laying a solid foundation for subsequent in vivo experiments and clinical translation.

[0018] (2) The combination of FEN1-IN-4 and TRi-1 provided by this invention has further verified its beneficial effects in in vivo experiments, and has both efficacy and safety advantages. At the animal model level, whether in immunodeficient mice (BALB / c nude mice) or immune-active mice (C57BL / 6 mice), the combination drug showed significant anti-tumor activity, which can effectively inhibit tumor growth without significant safety risks. This feature breaks through the bottleneck of "difficulty in balancing efficacy and safety" in traditional prostate cancer treatment (such as the side effects of radiotherapy and chemotherapy, and the sharp drop in efficacy after resistance to some targeted drugs). From the perspective of clinical value, the beneficial effects of this combination scheme are also reflected in two aspects: First, the feasibility of FEN1 as a therapeutic target for prostate cancer is directly confirmed through animal experiments, providing a basis for the effectiveness of the target for subsequent drug development targeting FEN1; Second, the innovative combination strategy of "FEN1 inhibition + TXN antioxidant system inhibition" is established. This strategy precisely targets the key pathogenic pathways of prostate cancer, avoids the limitations of single-target treatment, and provides a new direction for precision treatment of prostate cancer. These in vivo experimental results not only validated the anti-tumor potential of the combination therapy, but also provided crucial experimental support for its subsequent clinical translation research, which is expected to promote the upgrade of prostate cancer treatment from "single target" to "synergistic precision". Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The following diagrams illustrate the expression and prognostic correlation of FEN1 in prostate cancer provided by this invention: A: Representative immunohistochemical staining results of FEN1 in tissue microarray, scale bar 50 μm; B: Immunohistochemical scoring of FEN1 staining in prostate tissue, right panel: unpaired analysis of prostate tumor tissue (n = 91) and adjacent normal tissue (n = 50), data expressed as mean ± standard error, analyzed using Mann-Whitney U test, left panel: comparison of 50 pairs of prostate cancer and adjacent normal tissue using Wilcoxon signed-rank test; C: Correlation between FEN1 gene mRNA expression level and disease-free survival in prostate cancer patients analyzed based on the GEPIA database (http: / / gepia.cancer-pku.cn / ); Log-rank test was used. P <0.01.

[0021] Figure 2 The following figures illustrate the effects of FEN1 knockout on the proliferation and colony formation of prostate cancer cell lines provided by this invention: A: Western blot analysis of FEN1 knockout protein expression levels in PC3, DU145, 22RV-1, C4-2, and RM-1 cells; B: CCK-8 assay analysis of the proliferation capacity of PC3, DU145, 22RV-1, C4-2, and RM-1 cells after FEN1 knockout (n = 4), with data expressed as mean ± standard error and analyzed using repeated measures ANOVA; C: Representative images of colony formation experiments in PC3, DU145, 22RV-1, C4-2, and RM-1 cells after FEN1 knockout; D: Quantitative analysis of the effect of FEN1 knockout on the colony formation capacity of PC3, DU145, 22RV-1, C4-2, and RM-1 cells (n = 3), with data expressed as mean ± standard error. One-way ANOVA and Dunnett's post-hoc test were used for comparisons among the three groups, and two-tailed Student's test was used for comparisons between the two groups. t-test; P <0.01.

[0022] Figure 3The following figures illustrate the effect of FEN1 knockout on prostate cancer cell growth in vivo: A: Anatomical diagram of subcutaneous xenografts in BALB / c nude mice; B: Tumor growth curves of PC3 cells in the FEN1 knockout group and control group in the BALB / c nude mouse model (n = 8), with data expressed as mean ± standard error and analyzed using repeated measures ANOVA; C: Comparison of PC3 cell xenograft weights between the FEN1 knockout group and control group (n = 8), with data expressed as mean ± standard error and analyzed using a two-tailed Student's t-test; D: Anatomical diagram of subcutaneous xenografts in C57BL / 6 mice; E: Tumor growth curves of RM-1 cells in the FEN1 knockout group and control group in the C57BL / 6 mouse model (n = 4), with data expressed as mean ± standard error and analyzed using repeated measures ANOVA; F: Comparison of RM-1 cell xenograft weights between the FEN1 knockout group and control group (n = 4), with data expressed as mean ± standard error and analyzed using a two-tailed Student's t-test;* P <0.05;** P <0.01.

[0023] Figure 4 The following graphs illustrate the in vitro inhibition of prostate cancer cell proliferation by FEN1-IN-4 monotherapy and its combination with TRi-1, as provided by this invention: A: The half-maximal inhibitory concentration (IC50) of prostate cancer cell lines (LNCaP, 22RV-1, PC3, DU145) was determined by detecting the concentration gradient of FEN1-IN-4 inhibitors using CCK-8 assay; B: Left graph: Heatmap of inhibition rate of PC3 cells treated with different concentrations of TRi-1 combined with FEN1-IN-4 using CCK-8 assay; Right graph: Graph of synergistic effect of drug combination and calculation of combination index (CI) using CompuSyn software.

[0024] Figure 5The following graphs illustrate the effects of FEN1-IN-4 monotherapy and its combination with TRi-1 on the inhibition of prostate cancer growth and drug safety in BALB / c nude mice, as provided by this invention: A: Schematic diagram of the experimental design for the treatment of PC3 cell (BALB / c nude mouse) xenografts with TRi-1 monotherapy and TRi-1 combined with FEN1-IN-4 (IP: intraperitoneal injection); B: Tumor growth curves of PC3 xenografts after TRi-1, FEN1-IN-4 monotherapy or combination therapy (n = 6), with data expressed as mean ± standard error, analyzed using repeated measures ANOVA; C: Comparison of tumor weight of PC3 xenografts after TRi-1, FEN1-IN-4 monotherapy or combination therapy (n = 6), with data expressed as mean ± standard error, analyzed using one-way ANOVA and Dunnett's post-hoc test; D: Left: Representative image of Ki67 immunohistochemical staining of PC3 xenografts (scale bar: 50 μm); Right: IHC score analysis of tumor tissue proliferation activity (Ki67 staining intensity) (n =6) Figures, data are expressed as mean ± standard error, and Kruskal-Walis test and Dunn's post-hoc test were used; E: Anatomical diagram of PC3 cell (BALB / c nude mouse) xenograft; F: Representative H&E staining results of heart, liver, spleen, lung and kidney tissue sections; G: Serum biochemical indicators: blood urea nitrogen (BUN), serum creatinine (SCr), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels, n = 6, data are expressed as mean ± standard error, and one-way ANOVA and Dunnett's post-hoc test were used; # P >0.05; * P <0.05;** P <0.01.

[0025] Figure 6 This is a schematic diagram of the experimental design for the combined treatment of RM-1 cell xenografts (C57BL / 6 mice) with single-drug TRi-1 and FEN1-IN-4 provided by the present invention (IP: intraperitoneal injection).

[0026] Figure 7 The tumor growth curves (n = 6) of RM-1 xenografts treated with TRi-1, FEN1-IN-4 monotherapy or combination therapy provided by this invention are shown. Data are expressed as mean ± standard error and analyzed using repeated measures ANOVA. P >0.05; * P <0.05.

[0027] Figure 8 The figure shows a comparison of tumor weight (n = 6) of RM-1 xenografts after treatment with TRi-1, FEN1-IN-4 monotherapy or combination therapy, as provided in this invention. Data are expressed as mean ± standard error, and one-way ANOVA and Dunnett's post-hoc test were used.P >0.05; * P <0.05.

[0028] Figure 9 Representative images of Ki67 immunohistochemical staining of RM-1 xenografts provided by this invention (scale bar: 50 μm) (left image) and IHC score analysis of tumor tissue proliferation activity (Ki67 staining intensity) (n = 6) (right image) are shown. Data are expressed as mean ± standard error and analyzed using Kruskal-Walis test and Dunn's post-hoc test. P >0.05; * P <0.05.

[0029] Figure 10 Anatomical diagram of RM-1 cell (C57BL / 6 mouse) xenograft provided by this invention.

[0030] Figure 11 The image shows representative H&E staining results of heart, liver, spleen, lung and kidney tissue sections provided by this invention.

[0031] Figure 12 The serum biochemical indexes for detecting blood urea nitrogen (BUN), serum creatinine (SCr), aspartate aminotransferase (AST), and alanine aminotransferase (ALT) levels provided by this invention are plotted, n = 6; data are expressed as mean ± standard error, and analyzed using one-way ANOVA and Dunnett's post-hoc test; # P >0.05; * P <0.05.

[0032] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0033] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0035] Reagents and instruments used in the examples:

[0036] 1. Main reagents and consumables

[0037]

[0038]

[0039]

[0040] 2. Main Instruments

[0041]

[0042]

[0043] Experimental animals used in the examples:

[0044] Five-week-old male BALB / c nude mice and five-week-old male C57BL / 6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., China. All animal experiments were approved by the Animal Ethics Committee of Wuhan University (ethics number ZN2024061).

[0045] Example 1: Detection of FEN1 expression in prostate cancer tissue microarray

[0046] 1. Materials and Reagents

[0047] The prostate cancer tissue microarray used in this study was purchased from Shanghai Chipover Biotechnology Co., Ltd. (Shanghai, China). Immunohistochemistry (IHC) staining was used, with FEN1-specific antibody as the core reagent, to detect the expression of FEN1 protein in the tissue.

[0048] 2. IHC Scoring Criteria

[0049] The IHC score is calculated based on two dimensions: "percentage of positive cells" and "staining intensity," with a final score range of 0-300. The specific criteria are as follows:

[0050] Positive cell percentage grading: Based on the percentage of positive cells in the total cells, it is divided into 5 grades: 0% (Grade 0), 1-25% (Grade 1), 26-50% (Grade 2), 51-75% (Grade 3), and 76-100% (Grade 4); Staining intensity grading: Based on the depth of cell staining, it is divided into 4 grades: Grade 0 (no staining), Grade 1 (weak staining), Grade 2 (medium staining), and Grade 3 (strong staining).

[0051] The scoring formula is: Final IHC score = (percentage of positive cells × staining intensity) × 100.

[0052] 3. Detailed operating procedure for IHC staining

[0053] (1) Section pretreatment: The paraffin sections were placed in a 60℃ oven for 1 hour to ensure that the tissue adhered firmly to the slide; then the sections were dewaxed three times with 100% xylene for 5 minutes each time until they were completely dewaxed; then the sections were hydrated by gradient alcohol, soaking in 100% alcohol (twice, 5 minutes each time), 95% alcohol (5 minutes) and 70% alcohol (5 minutes) in sequence; and then rinsed twice with double-distilled water for 5 minutes each time to remove residual alcohol.

[0054] (2) Antigen retrieval: Add citrate antigen retrieval working solution to the retrieval box to ensure that the slides are completely submerged; place the retrieval box in a pressure cooker filled with tap water and preheat it to boiling over high heat; slowly place the slide rack in and continue heating until the pressure cooker releases steam, then maintain the steam release state for 5 minutes; disconnect the power and allow it to cool naturally for 20-30 minutes, then wash the slides twice with double-distilled water for 5 minutes each time.

[0055] (3) Endogenous peroxidase blocking and occlusion: Add 100 μL of 3% hydrogen peroxide solution to each slice and incubate in a humidified chamber at 37°C for 20 minutes to block endogenous peroxidase activity; wash three times with phosphate-buffered saline (PBS) for 5 minutes each time; add 100 μL of 10% goat serum blocking solution and incubate in a humidified chamber at 37°C for 30 minutes to reduce nonspecific binding.

[0056] (4) Antibody incubation: Discard the blocking solution, add 50 μL of FEN1 primary antibody dilution solution (dilution ratio 1:200), and incubate overnight at 4°C to ensure that the antibody and antigen are fully bound; wash with PBS 3 times for 5 minutes each time the next day to remove unbound primary antibody; then add 100 μL of secondary antibody dilution solution (dilution ratio 1:1000), and incubate at 37°C for 30 minutes; wash with PBS 3 times again for 5 minutes each time to remove residual secondary antibody.

[0057] (5) Color development and post-section treatment: Add 100 μL of freshly prepared 3,3'-diaminobenzidine (DAB) solution. When the section turns brownish-yellow, immediately rinse with running water to stop the reaction. Then counterstain the cell nuclei with hematoxylin for 1 minute, differentiate with 1% hydrochloric acid alcohol for 2-3 seconds, and then rinse with running water to turn the section blue. Finally, dehydrate with gradient alcohol (70%, 95%, and 100% alcohol for 3 minutes each), and clear with xylene twice for 5 minutes each time. After the section is air-dried, mount it with neutral resin.

[0058] 4. Detection and observation of FEN1 expression

[0059] After mounting, the sections were observed using a scanning microscope. Based on the IHC scoring criteria mentioned above, the staining intensity of FEN1 protein was analyzed and recorded, and its expression level in prostate cancer tissue was finally quantified.

[0060] 5. Test Results

[0061] Immunohistochemical (IHC) analysis showed that FEN1 protein expression was significantly upregulated in prostate cancer tissue microarrays compared to adjacent normal tissues (**). P <0.01, Figure 1 AB). Survival analysis using the GEPIA database further confirmed that high FEN1 mRNA expression was significantly associated with poor disease-free survival (DFS) (Log-rank P = 0.0031, AB). Figure 1 C).

[0062] Example 2 In vitro experiment: Functional effect of FEN1 knockout on prostate cancer cell lines

[0063] 1. Construction of FEN1 knockout cell model using CRISPR / Cas9 system and Western blot validation

[0064] Model construction: A gRNA-guided CRISPR / Cas9 system and corresponding control lentiviruses (sgFEN1#1 targeting sequence: CATGCCCATCAGGTGGCTGG; sgFEN1#2 targeting sequence: AGTCTTATGCTGCGGCTACCG) were synthesized by GCI Gene (Shanghai, China). After infecting the corresponding human (PC3, DU145, 22RV-1, C4-2) and mouse (RM-1) prostate cancer cells with the lentiviruses, the cells were screened with 2 μg / mL puromycin for 1 week to obtain stable FEN1 knockout cell lines for each cell line.

[0065] Western blot validation of knockout effect: Selected cells were placed in RIPA lysis buffer containing a protease-phosphatase mixed inhibitor and lysed on ice for 30 minutes; centrifuged at 12,000×g for 30 minutes at 4°C, and the supernatant was collected for protein quantification using a BCA protein concentration assay kit; equal amounts of protein were separated by SDS-PAGE gel electrophoresis and transferred to a PVDF membrane; the membrane was blocked with TBST solution in 5% skim milk at room temperature for 1 hour, and then incubated with FEN1 primary antibody overnight at 4°C; after washing three times with TBST, the membrane was incubated with HRP-labeled secondary antibody at room temperature for 2 hours, and then washed three more times with TBST; finally, chemiluminescence (ECL) substrate was added for color development, and the FEN1 protein expression level was detected by a chemiluminescence imaging system to validate the knockout effect.

[0066] 2. CCK-8 assay for cell viability

[0067] Cell viability was assessed using the Cell Counting Kit-8 (CCK-8). Cells from the FEN1 knockout group and the control group were seeded in 96-well plates at a density of 3 × 10⁶ cells per well. 3 Cell viability was measured using the Cell Counting Kit-8 (CCK-8) assay on days 1, 2, 3, 4, and 5 of culture; all experiments were performed in triplicate.

[0068] 3. Cloning experiment

[0069] Cells from the FEN1 knockout group and the control group were seeded in 6-well plates, and the culture medium was changed every 3 days for 10-14 days. After culture, the cells were fixed with anhydrous methanol, stained with 0.1% crystal violet for 15 minutes, and the visible clones were counted. All experiments were performed in triplicate.

[0070] 4. Experimental Results

[0071] This study constructed stable human (PC3, DU145, 22RV-1, C4-2) and mouse (RM-1) prostate cancer cell lines with FEN1 knockout via lentiviral infection. Western blot validation confirmed the successful construction of the cell models. Figure 2 A). Functional experiments showed that FEN1 knockout significantly inhibited cell proliferation activity (CCK-8 assay, P<0.01). Figure 2 B) and reduced colony-forming ability (P<0.01, Figure 2 CD).

[0072] Example 3 In vivo experiment: Detection of the effect of FEN1 knockout on the growth of prostate cancer cells in vivo

[0073] 1. Source of laboratory animals

[0074] Both male 5-week-old BALB / c nude mice and male 5-week-old C57BL / 6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., China.

[0075] 2. Mouse model construction

[0076] Construction of an immunodeficient (BALB / c nude mouse) mouse model: Stable FEN1 knockout PC3 cells or control PC3 cells (5 × 10⁻⁶) were obtained. 6 (each mouse), mixed with 50% Matrigel and suspended in 200 μL PBS, and subcutaneously inoculated into nude mice;

[0077] Establishment of an immune-active (C57BL / 6 mouse) mouse model: RM-1 cells with stable FEN1 knockout or control RM-1 cells (1×10⁻⁶) were used. 5 (1 / mouse), subcutaneously inoculated into C57BL / 6 mice using the same method as described above.

[0078] 3. Experimental monitoring and endpoint treatment

[0079] Monitoring indicators: During the experiment, the health status of mice was observed regularly, and changes in body weight and tumor growth were recorded. After the preset experimental endpoint was reached, the mice were anesthetized and sacrificed, and tumor tissue was collected for subsequent analysis.

[0080] 4. Experimental Results

[0081] To elucidate the tumor-promoting ability of FEN1 in vivo, subcutaneous xenograft models were established in both immunodeficient (BALB / c nude mice inoculated with PC3 cells) and immunocompetent (C57BL / 6 mice inoculated with RM-1 cells) models. Experimental results showed that FEN1 knockout significantly inhibited tumor size in both models. Figure 3 A, D), tumor growth curves (P<0.05, Figure 3 B, E) and weight (P<0.05, Figure 3 C, F).

[0082] Example 4: Inhibitory effect of FEN1-IN-4 monotherapy and its combination with TRi-1 on prostate cancer cell proliferation.

[0083] 1. FEN1-IN-4 Single-Drug Treatment Experiment

[0084] LNCaP, 22RV-1, PC3, and DU145 cells were seeded in 96-well plates at 3000 cells per well. Gradual concentrations of FEN1-IN-4 inhibitor (0, 0.1, 0.5, 1, 5, 10, 100 μM) were added and the cells were treated for 72 hours. Cell viability and half-maximal inhibitory concentration (IC50) were then calculated using the CCK-8 assay.

[0085] 2. Experiment on the combined action of FEN1-IN-4 and TRi-1

[0086] PC3 prostate cancer cells were seeded into 96-well plates and treated with gradient concentrations of TRi-1 (0, 1, 5, 10 μM) and FEN1-IN-4 (0, 5, 10, 20, 30, 40, 50 μM) for 72 hours. Cell viability was assessed using the CCK-8 assay, and the inhibition rate (FA) was calculated. FA (Fraction Affected) represents the proportion of cells inhibited at a specific drug concentration (FA=0 indicates no inhibition, FA=1 indicates complete inhibition), and arrows indicate the synergistic growth inhibition region produced by the combined drug treatment. The combination index (CI) was calculated using CompuSyn software to evaluate the synergistic (CI < 1 indicates synergistic effect), additive (CI = 1 indicates additive effect), or antagonistic (CI > 1 indicates antagonistic effect) effects of each drug combination on prostate cancer cell proliferation. CI values ​​were used to quantitatively assess drug interactions based on the intermediate-effect equation of the law of mass action. All data were visualized and analyzed using GraphPad Prism 8.0.

[0087] 3. Experimental Results and Analysis

[0088] The half-maximal inhibitory concentration (IC50) of FEN1-IN-4 inhibitors in prostate cancer cell lines (LNCaP, 22RV-1, PC3, DU145) was determined using a concentration gradient assay. Figure 4 A). Further studies revealed that FEN1-IN-4 and TRi-1 inhibitors exhibited a significant synergistic anti-tumor effect in PC3 cells (combination index CI < 1); Figure 4 B).

[0089] Example 5: Evaluation of the efficacy and safety of FEN1-IN-4 monotherapy and its combination with TRi-1 in vivo.

[0090] 1. In vivo treatment effect

[0091] After establishing PC3 (BALB / c nude mice) and RM-1 (C57BL / 6 mice) xenograft models as described above, tumor-bearing mice were randomly divided into four groups: solvent control group, FEN1-IN-4 monotherapy group, TRi-1 monotherapy group, and FEN1-IN-4 + TRi-1 combination therapy group. The stock solutions of FEN1-IN-4 (50 mg / mL) and TRi-1 (10 mg / mL) were prepared with DMSO, and the working solution was diluted with 5% DMSO + 40% PEG300 + 5% Tween-80 + 50% physiological saline. 100 μL / mouse was injected intraperitoneally. The health status, body weight, and tumor volume of the mice were continuously monitored. After sacrifice, whole blood and major organs (heart, liver, lung, spleen, and kidney) were collected for serum biochemical analysis and organ histopathological examination.

[0092] 2. Safety assessment of in vivo treatment

[0093] After mouse whole blood was allowed to stand for 2 hours, serum was separated by centrifugation at 3000×g for 30 minutes at 4℃. Serum levels of blood urea nitrogen (BUN), creatinine (CRE), aspartate aminotransferase (AST / GOT), and alanine aminotransferase (ALT / GPT) were measured using the corresponding detection kits (Nanjing Jiancheng Bioengineering Institute, C013-1-1, C011-2-1, C010-2-1, C009-2-1) according to the manufacturer's instructions.

[0094] 3. Experimental Results

[0095] (1) To evaluate the antitumor effects of single-agent and combination therapies in vivo, a PC3 cell-derived xenograft model was first established in BALB / c nude mice. The results showed that the FEN1-IN-4 single-agent treatment group (intraperitoneal injection, IP) exhibited significant tumor growth inhibition. Notably, the TRi-1 and FEN1-IN-4 combination therapy group (IP) showed a stronger tumor growth inhibition effect compared to the individual single-agent groups. Figure 5 AC, E). IHC analysis confirmed that the Ki-67 positive cell rate was significantly reduced in the combined treatment group (P<0.01). Figure 5 D). Hematoxylin-eosin (H&E) staining and serum biochemical tests (BUN, SCr, AST, ALT) of vital organs (heart, liver, lungs, spleen, kidneys) showed no significant toxic reactions (P>0.05). Figure 5 (FG), indicating that the joint scheme has good security characteristics.

[0096] (2) To further verify the efficacy of the combined therapy in the immune-active model, this study established an allogeneic xenograft model derived from RM-1 cells in C57BL / 6 mice. Experimental results showed that the combined treatment group of TRi-1 and FEN1-IN-4 significantly inhibited tumor volume growth and tumor weight compared to the control group. Figures 6-8 10). IHC analysis also confirmed that the Ki-67 positive cell rate was significantly reduced in the combination therapy group (P<0.01). Figure 9 No significant toxic reactions were observed in H&E staining of vital organs and serum biochemical tests (BUN, SCr, AST, ALT) (P > 0.05). Figures 11-12 This confirms that the combination therapy regimen also has a good safety profile in the immune activity model.

[0097] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A combination therapy for treating prostate cancer, characterized in that, The combined drug is a combination of FEN1-IN-4 and TRi-1 administered separately or simultaneously. FEN1-IN-4 is an inhibitor targeting Flap endonuclease 1, and TRi-1 is an inhibitor targeting the thioredoxin antioxidant system. The effective concentration of FEN1-IN-4 is 5 μM to 50 μM, and the effective concentration of TRi-1 is 1 μM to 10 μM.

2. The use of a combined pharmaceutical composition comprising FEN1-IN-4 and TRi-1 in the preparation of a medicament for treating prostate cancer, wherein the effective concentration of FEN1-IN-4 is 5 μM to 50 μM and the effective concentration of TRi-1 is 1 μM to 10 μM.

3. The application according to claim 2, characterized in that, The molar ratio of FEN1-IN-4 to TRi-1 in the combined drug composition is 1:2 to 10:

1.

4. The application according to claim 3, characterized in that, The molar ratio of FEN1-IN-4 to TRi-1 is 4:

1.

5. The application according to claim 2, characterized in that, The combined pharmaceutical composition is a formulation prepared by using FEN1-IN-4 and TRi-1 as anticancer active ingredients simultaneously, with the addition of pharmaceutically acceptable auxiliary ingredients.

6. The application according to claim 5, characterized in that, The preparation is an injectable preparation.

7. The application according to claim 2, characterized in that, In the combined drug composition, FEN1-IN-4 is the main drug component and TRi-1 is the synergistic drug component.

Images