A d9 mutant protein and its application in regulating plant height, prolonging flowering period and maintaining grain yield

Abstract

The application relates to a D9 mutant protein and application thereof in regulating plant height, prolonging flowering period and maintaining grain yield, and belongs to the technical field of plant gene breeding. The D9 mutant protein is obtained by mutating glycine at the 571th position of D9 protein into valine, and the amino acid sequence is shown as SEQ ID NO. 1. The application finds that the key amino acid site G571 in the GRAS domain of the D9 protein affects the D9-GID1 interaction, predicts and verifies that the G571V mutation at the amino acid site has the functions of dwarfing the plant, moderately prolonging the flowering period and not reducing the grain yield of the plant, thereby providing a solid theoretical basis for the research and development of a dwarfing and non-reducing yield type corn variety.

Description

Technical Field

[0001] This invention belongs to the field of plant gene breeding technology, specifically relating to a D9 mutant protein and its application in regulating plant height, prolonging flowering period, and maintaining grain yield. Background Technology

[0002] As a vital global food crop, maize's high yield is crucial for ensuring food security. Maize yield is determined by both yield per plant and planting density per unit area, with increasing planting density being the primary way to increase yield. Dwarfing or semi-dwarfing, as key traits in density-tolerant maize, can effectively increase planting density and reduce the risk of lodging. Therefore, creating dwarfing or semi-dwarfing germplasm and applying it to breeding is an important strategy for selecting density-tolerant maize varieties.

[0003] Flowering time has a significant impact on the yield per maize plant. The essence of maize grain yield lies in the continuous accumulation of photosynthetic products within the grain. Premature flowering restricts the orderly transition from vegetative to reproductive growth, causing carbon and nitrogen assimilation products to be prematurely allocated to ear differentiation and reproductive organ formation, hindering the morphological development of vegetative organs such as stems and leaves, and reducing the overall scale of photosynthetic products. Conversely, late flowering reduces pollination quality and may affect the "two-crop-a-year" summer-sown maize cropping system in the Huang-Huai-Hai Plain, resulting in a reduction in total yield. Therefore, within a suitable flowering period, moderately extending the vegetative growth period of maize can effectively prolong the photosynthetic time of the plant, improve photosynthetic efficiency and starch synthesis rate, ultimately resulting in a synergistic benefit of "increased source and increased sink," which is one of the key factors determining maize's adaptability to different ecological environments and thus ensuring its yield supply.

[0004] DELLA protein is a key element in GA signaling, binding to a class of bHLH transcription factors and inhibiting their transcriptional activation, leading to plant dwarfing and acting as a suppressor protein for plant growth and development. In GA-deficient plants, DELLA protein accumulates at high levels, inhibiting transcription factor activity and thus suppressing the expression of downstream genes regulated by GA. Under GA-induced conditions, GA binds to its receptor GID1, promoting the binding of GID1 to DELLA protein. This leads to the interaction of DELLA protein with the SCF complex, resulting in ubiquitination and eventual degradation via the 26S proteasome pathway, thus relieving its inhibitory effect on downstream transcription factor activity. Studies have found that mutations in relevant amino acids in DELLA protein weaken the interaction between DELLA protein and GID1, making it less susceptible to ubiquitination and degradation, resulting in varying degrees of plant dwarfing. For example, in rice, natural mutations such as S97L, L99F, and M106K all cause varying degrees of dwarfing phenotypes.

[0005] However, most of the amino acid mutations found in the DELLA protein currently occur in the N-terminal DELLA domain, while it remains unclear whether mutations in its C-terminal GRAS domain can cause dwarfing in maize. Furthermore, existing studies show that dwarfing in maize is often accompanied by severe late flowering, leading to asynchronous pollen shedding and silking, as well as grain abortion, resulting in reduced grain yield per plant and failing to overcome the breeding bottleneck of synergistic plant architecture improvement and high yield. Therefore, this invention provides a D9 mutant protein and its application in regulating plant height, prolonging flowering time, and maintaining grain yield. Summary of the Invention

[0006] The purpose of this invention is to provide a D9 mutant protein and its application in regulating plant height, prolonging flowering period, and maintaining grain yield in order to solve the above-mentioned problems.

[0007] The present invention achieves the above objectives through the following technical solutions:

[0008] This invention provides a D9 mutant protein, which is obtained by mutating glycine at position 571 of the D9 protein to valine. The amino acid sequence of the D9 mutant protein is shown in SEQ ID NO.1.

[0009] This invention also provides an application of the D9 mutant protein in regulating plant height.

[0010] As a further optimization of the present invention, the D9 mutant protein has the function of dwarfing the plant without reducing the grain yield of the plant.

[0011] As a further optimization of the present invention, the D9 mutant protein causes the plant to flower late, thereby prolonging the plant's vegetative growth period and maintaining the grain yield of the dwarfed plant.

[0012] As a further optimization of the present invention, the plant is corn.

[0013] The present invention also provides a method for obtaining dwarf maize by introducing the D9 mutant protein into maize plants through gene editing.

[0014] As a further optimization of the present invention, the method of introducing the D9 mutant protein into maize plants is as follows: by gene editing, the glycine at position 571 of the D9 protein in maize plants is mutated to valine.

[0015] The beneficial effects of this invention are as follows:

[0016] This invention utilizes AlphaFold3 to predict the structure of the interaction complex between maize D9 and GID1 proteins, identifying the key amino acid site G571 in the GRAS domain of the D9 protein that influences the D9-GID1 interaction. By predicting the impact of mutations at the G571 site on the complex, the potentially functional G571V mutation was discovered. Furthermore, using CRISPR / Cas9-mediated gene editing technology, precise replacement of the target amino acid site in maize was performed, verifying that the G571V mutation in the D9 protein can dwarf the plant while moderately delaying flowering to extend the vegetative growth period, thereby maintaining the grain yield of dwarf maize. This achieves the effect of dwarfing without reducing yield, realizing the breeding objective of synergistic plant type improvement and high yield, and providing a solid theoretical foundation for the development of dwarf maize varieties that do not reduce yield. Attached Figure Description

[0017] Figure 1 The structure of the interaction complex between D9 and GID1 proteins;

[0018] Figure 2 The structure of the D9-GID1 complex after the G571 site mutation;

[0019] Figure 3 Simulation results for the structures of 19 D9-GID1 complexes;

[0020] Figure 4 The structure is that of the D9(G571V)-GID1 complex;

[0021] Figure 5 This is a graph showing the sequencing results of the mutation sites;

[0022] Figure 6 The effect of the D9 G571V mutation on flowering time;

[0023] Figure 7 The effect of the D9 G571V mutation on plant height and yield. Detailed Implementation

[0024] The present application will now be described in further detail. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0025] 1. Experimental materials

[0026] Unless otherwise specified, all methods used in this invention are conventional methods known to those skilled in the art, and all reagents and materials used are commercially available products unless otherwise specified.

[0027] 2. Experimental Methods and Conclusions

[0028] 2.1 Analysis of the interaction complex between D9 and GID1 proteins

[0029] The structure of the interaction complex between D9 and GID1 proteins was predicted using AlphaFold3, revealing that D9 primarily interacts with GID1, which binds to GA molecules, through its N-terminal DELLA domain. Figure 1 A, D), which explains why most of the natural mutations of the DELLA protein that cause plant dwarfing in various species are concentrated in this region;

[0030] Notably, a key α-helix forms at the end of the C-terminal GRAS domain of the D9 protein, and its residues form a multiple interaction network with GID1. Specifically, K576 interacts electrostatically with D42 of GID1, E595 with R51, and R592 with E77; while S579 forms hydrogen bonds with D44 and T606 with D67. Figure 1 B, E). These interactions are crucial for maintaining the complex conformation, and disruption of them may significantly weaken the D9-GID1 interaction;

[0031] Further analysis revealed that G571 is located at the terminal end of the D9 protein, at the beginning of the α-helix, precisely at the conformational transition point between the flexible loop and the rigid helix. As the smallest amino acid, glycine (G) provides a unique degree of freedom for main chain torsion at this position, playing an irreplaceable role in the conformational flexibility and stability of helix initiation. Figure 1 C, F).

[0032] 2.2 Study on amino acid mutations at the G571 site

[0033] AlphaFold3 was used to simulate the formation of the D9-GID1 complex after the G571 site was mutated to 19 other amino acids. Figure 2 The simulation results show that () Figure 3 The ipTM (predictive accuracy of protein-protein interaction interfaces) values ​​of all mutants were greater than 0.8, indicating high confidence in the prediction of protein-protein interaction interfaces. However, the pTM (predictive accuracy of the overall structure of the complex) values ​​showed significant differences. When G571 was mutated to amino acids such as V, I, Y, and H, the pTM value was much lower than the normal value of 0.8, and the conformation was also significantly altered compared to the wild type. When G571 was mutated to valine (V), its pTM value was only 0.49. Based on this, it is speculated that this mutation led to a significant decrease in the accuracy of the overall structure prediction of the complex, and the structure of the D9-GID1 complex may have been severely distorted or difficult to form stably.

[0034] Structural analysis based on AlphaFold3 simulations revealed the molecular mechanism by which G571V may induce functional defects. Stereohindrance of the valine side chain forces a large deflection of the C-terminal GRAS domain, triggering a dramatic conformational rearrangement of the entire D9(G571V)-GID1 complex. This directly disrupts the interaction interfaces between key residues such as K576, R592, E595, S579, and T606 and GID1, resulting in a significant decrease in the stability of the D9(G571V)-GID1 complex. Figure 4 );

[0035] Based on the above structural prediction results, it is preliminarily inferred that the D9 G571V mutation weakens the interaction between D9 and GID1, thereby hindering the degradation of D9 protein and causing its accumulation, which in turn leads to the dwarfing phenotype of plants.

[0036] 2.3 Validation of the biological function of the D9 G571V mutation

[0037] Based on the maize genome database, the nucleotide sequence of the D9 gene was found, as shown in SEQ ID NO.2. Using the superior maize inbred line KN5585 as the wild type, a site-directed mutant plant at the G571V site of the D9 gene was constructed by Weimi Biotechnology Co., Ltd. The mutant plants were identified using primers with sequences shown in SEQ ID NO.3-4. The results are as follows: Figure 5 As shown, the sequencing results are consistent with the predicted results, indicating that the mutant plant of the D9 gene G571V was successfully obtained.

[0038] Identification primers:

[0039] SEQ ID NO.3:F:CACGGAGTCGCTGCACTACT

[0040] SEQ ID NO.4: R:GGCGCGTATGCCATCCCAGA

[0041] Observations on the flowering period of mutant plants revealed that the male inflorescence pollen shedding period and the female inflorescence silking period of mutant plants were both 3-4 days later than those of wild-type plants. Figure 6 (AB) This moderately late flowering characteristic enables corn to extend its vegetative growth period, achieving a synergistic yield-increasing effect of "increased source and increased storage";

[0042] Further phenotypic analysis of the mutants revealed that both plant height and ear height were significantly reduced in the mutant plants. Figure 7 (AC), this dwarfing characteristic is directly associated with improved lodging resistance and high-density planting potential, providing a key phenotypic basis for maize's stress resistance and stable yield;

[0043] It is worth noting that the mutant excels in maintaining yield potential: its ear morphology is not significantly different from that of the wild type. Figure 7 D), and quantitative analysis of core yield traits such as ear length, ear diameter, ear weight, number of rows per ear, number of grains per row, and grain weight per ear showed no statistically significant difference between the two. Figure 7 EJ);

[0044] The above results confirm that the D9 G571V mutation can achieve "dwarfing" while also causing maize to flower later, thereby moderately extending the vegetative growth period of maize and maintaining the grain yield of dwarf maize. It breaks through the breeding bottleneck of plant type improvement and high yield synergy, and obtains the ideal "dwarfing without yield reduction" characteristic, laying a physiological foundation for high density tolerance, high yield and stable harvest throughout the year.

[0045] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A D9 mutein, characterized in that, The D9 mutant protein is obtained by mutating the glycine at the 571st position of the maize D9 protein to valine, and the amino acid sequence of the D9 mutant protein is shown as SEQ ID NO.

1.

2. Use of the D9 mutein according to claim 1 for reducing the height of a plant, characterized in that The D9 mutant protein has the function of dwarfing the plant, and does not reduce the grain yield of the plant.

3. Use according to claim 2, characterized in that: The D9 mutant protein makes the plant flower late, thereby prolonging the vegetative growth period of the plant, and further maintaining the grain yield of the dwarfed plant.

4. A method for obtaining a short-stalked maize plant, characterized in that, A dwarf maize is obtained by introducing the D9 mutant protein of claim 1 into the maize plant by gene editing.

5. The obtaining method according to claim 4, wherein, The method for introducing the D9 mutant protein into the maize plant is to mutate the glycine at the 571st position of the D9 protein in the maize plant to valine by gene editing.

Images