Application of Brassica napus gene BnaDOF31 in breeding of Brassica napus resistant to sclerotinia stem rot

By identifying and utilizing the Brassica napus gene BnaDOF31, and editing rapeseed genes using the CRISPR/Cas9 system, the deficiency in regulating resistance to Sclerotinia stem rot in rapeseed was resolved, resulting in enhanced disease resistance for high and stable yields.

CN121344072BActive Publication Date: 2026-07-24OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
OIL CROPS RES INST CHINESE ACAD OF AGRI SCI
Filing Date
2025-12-07
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

In the current technology, the regulatory network of rapeseed resistance to sclerotinia stem rot is not fully understood, and there is a lack of effective gene regulation methods to improve rapeseed resistance to sclerotinia stem rot.

Method used

By identifying and utilizing the Brassica napus gene BnaDOF31, the expression of the BnaDOF31 gene was knocked out or silenced using the CRISPR/Cas9 system to regulate the resistance of Brassica napus to sclerotinia stem rot. Gene editing was then achieved by introducing recombinant vectors or recombinant microorganisms into the Brassica napus gene.

Benefits of technology

This study enhanced rapeseed's resistance to sclerotinia stem rot, ensured high and stable yields, and enriched research on molecular networks of plant disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application belongs to the field of oilseed rape breeding, and specifically discloses application of a Brassica napus gene BnaDOF31 in breeding of Brassica napus resistant to sclerotinia stem rot, wherein the protein encoded by the BnaDOF31 gene is shown as SEQ ID NO. 2; the BnaDOF31 gene of Brassica napus is identified for the first time to be capable of regulating resistance of oilseed rape to sclerotinia stem rot, and the application enriches a molecular network for regulating resistance of plants to sclerotinia stem rot and plays an important role in research on a molecular mechanism for formation of disease resistance of plants. Overexpression of the BnaDOF31 gene disclosed by the application significantly reduces resistance of oilseed rape to sclerotinia stem rot, and a plaque area of a knock-out strain shows a downward trend; the application provides a new negative regulation site for resistance of oilseed rape to sclerotinia stem rot, provides a new target for genetic improvement of disease-resistant oilseed rape, and has important significance for guaranteeing high yield and stable yield of oilseed rape.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rapeseed breeding, specifically involving the application of the Brassica napus gene BnaDOF31 in the breeding of Brassica napus for resistance to sclerotinia stem rot. Background Technology

[0002] Sclerotinia stem rot, caused by Sclerotinia stem rot, is the "cancer" of rapeseed. Improving the resistance of rapeseed to sclerotinia stem rot is an important way to ensure high and stable yields of rapeseed.

[0003] Currently, WRKY28, WRKY33, and the zinc finger transcription factor BnaSTOP2 have been identified in rapeseed as participating in the regulation of sclerotinia stem rot resistance (Dai et al., 2025), indicating that transcription factors play an important role in the regulatory network of sclerotinia stem rot resistance in rapeseed. The Dof (DNA binding with one finger) gene family belongs to the zinc finger protein superfamily and plays an important role in plant growth and development regulation and stress response (Zou and Sun, 2023). VvDOF3 can act as a transcription activator to enhance grape powdery mildew resistance (Yu et al., 2019), and recent studies have found that the DOF transcription factor OsDes1 in rice can simultaneously improve rapeseed yield and disease resistance (Qiu et al., 2024). CDF3 is widely considered a key gene involved in plant flowering regulation and abiotic stress resistance regulation. RsCDF3 has been shown to positively regulate the cold tolerance of radish in cruciferous crops (He et al., 2025), however, its function in disease resistance response remains unknown.

[0004] This invention found that the expression level of the BnaDOF31 gene in rapeseed leaves increased significantly after infection with Sclerotinia sclerotiorum, and used transient overexpression or editing of the gene in rapeseed leaves to verify its function in regulating resistance to Sclerotinia sclerotiorum. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the Brassica napus gene BnaDOF31 in the breeding of Brassica napus for resistance to sclerotinia stem rot, the protein encoded by this gene is shown in SEQ ID NO.2.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] Screening and acquisition of the BnaDOF31 gene, a gene associated with resistance to sclerotinia stem rot in rapeseed:

[0008] RT-qPCR analysis confirmed that the expression level of the BnaDOF31 gene was significantly enhanced 48 hours (48 hpi) after rapeseed infection with Sclerotinia sclerotiorum. This suggests that the gene is involved in the disease response of rapeseed and is therefore listed as a candidate gene for regulating resistance to Sclerotinia sclerotiorum in rapeseed. The protein encoded by the BnaDOF31 gene is shown in SEQ ID NO.2, and the gene sequence encoding this protein is shown in SEQ ID NO.1.

[0009] The scope of protection of this invention also includes:

[0010] Application of the Brassica napus gene BnaDOF31 in controlling Sclerotinia sclerotinia resistance in Brassica napus, wherein the protein encoded by the gene is shown in SEQ ID NO.2.

[0011] Application of increasing the expression of the Brassica napus gene BnaDOF31 in reducing the resistance of Brassica napus to sclerotinia stem rot;

[0012] Application of reducing the expression of the BnaDOF31 gene in Brassica napus in improving resistance to Sclerotinia sclerotinia in Brassica napus;

[0013] The above-described application specifically involves introducing a substance that knocks out, inhibits, or silences the expression of the Brassica napus gene BnaDOF31 into the Brassica napus gene. The substance is an expression cassette, recombinant vector, or recombinant microorganism that reduces the expression level of the BnaDOF31 gene.

[0014] In the above applications, preferably, the knockout is performed using the CRISPR / Cas9 system. The absence or significant reduction in expression of the knocked-out gene can improve the resistance of Brassica napus to Sclerotinia stem rot.

[0015] Preferably, the target sites of gRNA in the CRISPR / Cas9 system are TCCTTACTGGACCATCCCAATGG and TCATCACCTATGAGTCAAAAGGG.

[0016] In the applications described above, the increased yield of Brassica napus after editing with the CRISPR / Cas9 system contains the polynucleotide shown in SEQ ID NO.3.

[0017] Application of reagents for detecting the BnaDOF31 gene in screening or breeding for sclerotinia disease resistance in Brassica napus.

[0018] The method for determining the application described above is as follows: if the BnaDOF31 gene is not expressed or its expression level is significantly lower than that of wild-type Brassica napus, then it is Brassica napus resistant to sclerotinia stem rot.

[0019] The application of expression cassettes that reduce the expression level of the BnaDOF31 gene, recombinant vectors, or recombinant microorganisms in the creation of Sclerotinia sclerotinia resistant Brassica napus, wherein the protein encoded by the gene BnaDOF31 is shown in SEQ ID NO.2.

[0020] The Brassica napus gene BnaDOF31 is shown in SEQ ID NO.1.

[0021] Compared with the prior art, the advantages and beneficial effects of the present invention are:

[0022] This invention, through homologous cloning, identifies for the first time that the BnaDOF31 gene in Brassica napus can regulate sclerotinia stem rot resistance in rapeseed, enriching the molecular network of sclerotinia stem rot resistance regulation in plants and playing an important role in the study of the molecular mechanisms of plant disease resistance formation. The biological function of BnaDOF31 in rapeseed was previously unknown. This invention reveals that the BnaDOF31 gene provided by this invention negatively regulates sclerotinia stem rot resistance in rapeseed. Overexpression of this gene reduces sclerotinia stem rot resistance, while knockout of this gene enhances sclerotinia stem rot resistance. This is of great significance for ensuring high and stable yields of rapeseed by improving its sclerotinia stem rot resistance. Attached Figure Description

[0023] Figure 1 The relative expression level of BnaDOF31 after infection with Sclerotium sclerotiorum;

[0024] Figure 2 Analysis of sclerotinia stem rot resistance in rapeseed leaves with transient overexpression of BnaDOF31;

[0025] Where: A represents the phenotype of BnaDOF31 overexpression (OE-BnaDOF31) and control plants after infection with Sclerotinia sclerotiorum (72 hpi); Figure 2 -B represents the area of ​​bacterial plaque on the leaf after infection (unit: mm). 2 ).

[0026] Figure 3 Analysis of sclerotinia stem rot resistance in rapeseed leaves with BnaDOF31 knocked out;

[0027] Where: A represents the phenotype of BnaDOF31 knockout (KO-BnaDOF31) and control plants after infection with Sclerotinia sclerotiorum (72 hpi); B represents the area of ​​bacterial plaque on infected leaves (unit: mm). 2 ). Detailed Implementation

[0028] The applicant below combines Figures 1-3The technical solutions in the embodiments of the present invention are clearly and completely described, and the present invention is described in detail. These embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection claimed by the present invention.

[0029] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. This invention references the ZS11.V0 annotation sequence of the rapeseed ZS11 (Zhongshuang 11) genome (http: / / cbi.hzau.edu.cn / bnapus / index.php).

[0030] All nucleotide sequences in this specification are oriented 5'-3'.

[0031] Example 1:

[0032] The BnaDOF31 gene in rapeseed is associated with resistance to sclerotinia stem rot:

[0033] ZS11 rapeseed was grown for 5 weeks, and leaves were cut for in vitro leaf infection. Samples were taken at 0, 12, and 48 hours after infection, flash-frozen in liquid nitrogen, and stored at -80℃. RNA was then extracted from the freeze-dried leaves and reverse transcribed. The expression level of BnaDOF31 was verified by qRT-PCR. The results showed that the expression level of BnaDOF31 did not change significantly at 12 hours after infection with Sclerotinia sclerotiorum, but the expression level of BnaDOF31 increased significantly at 48 hours after infection. Figure 1 The presence of BnaDOF31 indicates its involvement in responding to Sclerotinia sclerotiorum infection, thus listing it as a candidate gene for regulating resistance to Sclerotinia sclerotiorum in rapeseed. The protein encoded by the BnaDOF31 gene is shown in SEQ ID NO.2, and the polynucleotide encoding it is shown in SEQ ID NO.1.

[0034] Example 2:

[0035] Application of BnaDOF31 in reducing resistance to Sclerotinia stem rot in rapeseed

[0036] like Figure 2 As shown in this example, the application of the gene BnaDOF31, which is related to resistance to sclerotinia stem rot in rapeseed, in the breeding of the rapeseed variety Shuang 11 was demonstrated:

[0037] (1) Primers were designed to amplify the coding region sequence of BnaDOF31 in rapeseed cultivar Zhongshuang 11: atacaccaaatcgactctagaATGATGATGGAAAGTAGAGATCCAGC and catggtaccggatccactagtAACCCGTTCTTGGAAATTGAGTG, with XbaI and SpeI restriction sites at the 5' ends of the left and right primers, respectively. Leaf cDNA of rapeseed cultivar Zhongshuang 11 was used as a template for cloning. The PCR reaction program was 95℃: 3 min; 95℃: 15 s; 60℃; 72℃: 2 min; 35 cycles; 72℃: 5 min. The PCR product was recovered using a DNA purification kit (OMEGA). The cloned product was ligated into the pCAMBIA1300 vector carrying a 35S promoter.

[0038] (2) The correctly constructed recombinant plasmid vector was introduced into Agrobacterium strain GV3101, and after overnight shaking, the culture was centrifuged, the supernatant was removed, and an appropriate amount of infection solution (10 nM MES-KOH + 10 mM MgCl2 + 200 μM AS) was added to resuspend the culture. The D600 was adjusted to 0.8-1.0, and the culture was incubated at room temperature in the dark for 3 hours. Then, the culture was injected into the leaves of rapeseed No. 11 (hydroponic culture for 4 weeks). pCAMBIA1300 was used as a negative control.

[0039] (3) Extract leaf DNA and detect the insertion of exogenous gene pairs by PCR. The primers used are F primer (atacaccaaatcgactctagaATGATGATGGAAAGTAGAGATCCAGC) designed according to the vector backbone and R primer for cloning (atggtaccggatccactagtAACCCGTTCTTGGAAATTGAGTG).

[0040] (4) The transgenic positive rapeseed seedlings obtained by PCR were subjected to qRT-PCR to detect gene expression levels. The expression level of BnaDOF31 was analyzed by RT-qPCR, and the quantitative primer pairs were: ACATCAACCAGCCTCGCC and TTTTGTGCTTGCGGCGTC.

[0041] (5) After 24 hours of dark culture, the positive transgenic rapeseed leaves identified as having significantly decreased BnaDOF31 gene expression were subjected to an experiment of sclerotiorum infection of detached leaves. After 72 hours of infection, photographs were taken and the area of ​​the bacterial plaque was statistically analyzed.

[0042] (6) The results showed that the average bacterial patch area of ​​the injected uninfected rapeseed leaves 72 hours after infection with Sclerotinia sclerotiorum was 1221.89 mm. 2The bacterial patch area of ​​rapeseed leaves overexpressing BnaDOF31 was 1375.37, a significant increase of 12.6%. Figure 2 (A and B in the middle).

[0043] Example 3:

[0044] Application of BnaDOF31 gene knockout in enhancing resistance to Sclerotinia stem rot in Brassica napus:

[0045] The BnaDOF31 mutant of rapeseed was created using the CRISPR-Cas9 system from Wuhan Boyuan Biotechnology Co., Ltd. The experimental procedures are as follows:

[0046] (1) The target sequences selected are: TCCTTACTGGACCATCCCAATGG and TCATCACCTATGAGTCAAAAGGG.

[0047] (2) Design primers KO-BnaDOF31-F2:cagtGGTCTCaTGCATCCTTACTGGACCATCCCAAGTTTTAGAGCTAGAAATAGC and KO-BnaDOF31-R2:cagtGGTCTCaAAACTTTTGACTCATAGGTGATGATGCACCAGCCGGGAATCGAA, and use the DNA from rapeseed No. 11 to clone the target fragment.

[0048] (3) The target fragment cloned in (2) was constructed into the pHK2-Cas9-U6 vector (purchased from Wuhan Boyuan Biotechnology Co., Ltd.) by Golden Gate cloning, and then transformed into DH5α for sequencing. The plasmid was extracted from the E. coli bacterial culture with correct sequencing.

[0049] (4) The correct recombinant plasmid vector was introduced into Agrobacterium strain GV3101 and introduced into rapeseed leaves using the method in (2) of Example 2; the empty vector pHK2-Cas9-U6 introduced into Agrobacterium strain GV3101 was used as a control.

[0050] (5) Extract leaf DNA and detect the insertion of exogenous gene slice pairs by PCR. The primers used are F primer (TACAGCTAGAGTCGAAGTAG) designed according to the vector backbone and R primer for cloning (cagtGGTCTCaAAACTTTTGACTCATAGGTGATGATGCACCAGCCGGGAATCGAA).

[0051] (6) The transgenic positive rapeseed seedlings obtained by PCR were subjected to qRT-PCR to detect the gene expression level. The specific steps are as described in (4) of Example 2. Finally, the rapeseed mutant KO-BnaDOF31 with significantly reduced BnaDOF31 gene expression was obtained for phenotypic determination. This mutant contains the polynucleotide shown in SEQ ID NO.3.

[0052] (7) After 24 hours of dark culture, the leaves of positive transgenic rapeseed KO-BnaDOF31 with significantly decreased BnaDOF31 gene expression were subjected to sclerotium infection experiments on detached leaves. After 72 hours of infection, photos were taken and the area of ​​the bacterial plaque was statistically analyzed.

[0053] The results showed that the average plaque area of ​​rapeseed leaves injected with untreated bacteria was 1221.89 mm² 72 hours after infection with Sclerotinia sclerotiorum. 2 The area of ​​bacterial plaque on rapeseed leaves with BnaDOF31 knocked out was 1042.84 mm. 2 It decreased significantly by 14.7% ( Figure 3 (A and B)

[0054] Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0055] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be understood by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention.

Claims

1. The application of the Brassica napus gene BnaDOF31 in controlling resistance to Sclerotinia sclerotinia in Brassica napus, wherein the protein encoded by the gene is shown in SEQ ID NO.2, and the control is achieved by reducing the expression level of the Brassica napus gene BnaDOF31 to improve resistance to Sclerotinia sclerotinia in Brassica napus, wherein Sclerotinia sclerotinia is caused by Sclerotinia sclerotiorum.

2. The application according to claim 1, characterized in that: This involves introducing a substance that knocks out, inhibits, or silences the expression of the Brassica napus gene BnaDOF31 into the Brassica napus gene. The substance is an expression cassette, recombinant vector, or recombinant microorganism that reduces the expression level of the BnaDOF31 gene.

3. The application according to claim 2, characterized in that: The knockout method used is the CRISPR / Cas9 system. The knockout gene is either not expressed or has a significantly reduced expression level, which improves the resistance of Brassica napus to Sclerotinia stem rot.

4. The application according to claim 3, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are TCCTTACTGGACCATCCCAATGG and TCATCACCTATGAGTCAAAAGGG.

5. Application of reagents for detecting the BnaDOF31 gene in the screening or breeding of sclerotinia resistance in Brassica napus, wherein the protein encoded by the gene is shown in SEQ ID NO.2, and the determination method in the application is: if the expression level of the BnaDOF31 gene cannot be detected or is significantly lower than that of wild-type Brassica napus, then it is sclerotinia resistant Brassica napus.

6. The application of expression cassettes, recombinant vectors, or recombinant microorganisms that reduce the expression level of the BnaDOF31 gene in the creation of Sclerotinia sclerotinia resistant Brassica napus, wherein the protein encoded by the BnaDOF31 gene is shown in SEQ ID NO.

2.

7. The application according to claim 1, 5 or 6, wherein the Brassica napus gene BnaDOF31 is shown in SEQ ID NO.1.