A primer probe composition for detecting the DNA methylation level in the promoter region of the tmem213 gene and application thereof

By designing primer-probe compositions to detect the methylation status of the TMEM213 gene promoter region, the shortcomings of existing technologies have been overcome, achieving highly sensitive molecular diagnosis of renal cell carcinoma and providing new therapeutic targets and diagnostic methods.

CN121380352BActive Publication Date: 2026-08-25宿州学院
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511979444.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-25
Publication Date
2026-08-25
Estimated Expiration
2045-12-25

AI Technical Summary

Technical Problem

The lack of effective methods in the current technology to detect the DNA methylation status of the TMEM213 gene promoter region, especially in the application of clear cell renal cell carcinoma, has affected the development of molecular diagnostic and therapeutic targets for renal cell carcinoma.

Method used

A primer-probe composition, including specific primer pairs and fluorescently labeled probes, was designed to detect the methylation status of the TMEM213 gene promoter region, achieving accurate detection through real-time quantitative PCR technology.

Benefits of technology

This method enables precise detection of the methylation status of the TMEM213 gene promoter region, providing a new molecular diagnostic tool for renal cell carcinoma. It has high detection sensitivity and good reproducibility, and can meet the clinical needs of early screening, postoperative monitoring, and prognostic stratification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121380352B_ABST
    Figure CN121380352B_ABST
Patent Text Reader

Abstract

The application discloses a primer probe composition for detecting a DNA methylation level in a TMEM213 gene promoter region and application thereof, and belongs to the technical field of biology. The primer probe composition is designed according to a CpG site in a human TMEM213 gene promoter region, and after sample DNA is modified by a bisulfite reagent, methylation-specific real-time fluorescent quantitative PCR is used to detect the methylation site in the gene promoter region of the modified DNA; and based on the Ct value obtained through amplification, the methylation level of the target CpG site of the TMEM213 gene in the sample DNA can be accurately quantitatively analyzed. The primer probe composition can specifically combine with the target methylation DNA sequence, can efficiently distinguish the methylation template from the non-methylation template, has high detection sensitivity and good repeatability. The primer probe composition is combined with a primer probe combination of an internal reference gene ACTB, and can be applied to the preparation of a TMEM213 gene methylation level detection kit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a primer-probe composition for detecting DNA methylation levels in the promoter region of the TMEM213 gene and its applications. Background Technology

[0002] Kidney renal clear cell carcinoma (KIRC) is one of the most common malignant tumors of the kidney, accounting for 80-90% of all kidney malignancies. Although research on the pathogenesis of KIRC has made some progress in recent years, the relevant molecular mechanisms remain unclear. Therefore, elucidating the molecular mechanisms related to the occurrence and development of KIRC, and identifying new tumor molecular markers and therapeutic targets are crucial for improving the diagnosis and treatment of KIRC and developing targeted therapies.

[0003] CpG site methylation in gene promoter regions is a crucial epigenetic regulatory mechanism, influencing gene expression levels by affecting the binding of transcription factors to promoters. Numerous studies have confirmed that methylation of tumor suppressor gene promoters in tumor cells leads to gene silencing, a key mechanism in tumorigenesis and development. Therefore, screening for tumor-specific methylation sites as diagnostic biomarkers or developing demethylation therapy strategies targeting methylation sites has become a hot topic in current cancer research. Epigenomic studies have revealed aberrant methylation patterns in renal cell carcinoma (KIRC), including hypermethylation in numerous tumor suppressor gene promoter regions. However, most differentially methylated sites still lack experimental validation, and their diagnostic specificity, sensitivity, and clinical translational value require systematic evaluation. Therefore, screening and validating highly diagnostic methylation molecular biomarkers for renal cell carcinoma from a large pool of candidate sites is both a key challenge and a crucial step towards technological breakthroughs in this field.

[0004] TMEM213 (Tansmembrane Protein 213) is a member of the transmembrane protein family, and existing research indicates that it plays an important role in tumorigenesis and development. However, the specific regulatory mechanism of this gene in clear cell renal cell carcinoma remains unclear. Currently, there are no reports, either domestically or internationally, on methylation detection probes at specific CpG sites in the TMEM213 gene promoter region, nor have they been observed to have been used in the diagnosis of KIRC. Summary of the Invention

[0005] This invention relates to the TMEM213 gene promoter region, including its transcription start site and sequences within a certain range upstream and downstream, with particular focus on the methylation status of CpG islands within this region. The objective of this invention is to provide a primer-probe composition for detecting DNA methylation levels in the TMEM213 gene promoter region and its application, thereby addressing the problems existing in the prior art. The designed primer-probe composition enables accurate detection of the TMEM213 gene promoter methylation status in KIRC (Kidney Injection Respiratory Syndrome), thus providing a new technical means for the molecular diagnosis of clinical KIRC.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] The present invention provides a primer-probe composition comprising specific primer pairs as shown in SEQ ID NO. 1-2 and a probe as shown in SEQ ID NO. 3.

[0008] Preferably, the two ends of the probe are modified with a fluorescent group and a quenching group, respectively.

[0009] The present invention also provides the application of the primer-probe composition in the preparation of a kit for detecting the methylation level of the TMEM213 gene promoter region.

[0010] The present invention also provides the application of the primer-probe composition described herein in the preparation of a kit for identifying methylation and non-methylation of the TMEM213 gene promoter region.

[0011] Preferably, the methylation of the TMEM213 gene promoter region includes methylation of the CpG site in the TMEM213 gene promoter region in clear cell renal cell carcinoma.

[0012] Preferably, the CpG sites include cg02811197, cg02491878, cg07429038, cg06784539, cg25507767, cg26349773 and cg24798540.

[0013] The present invention also provides the use of the primer-probe composition in the preparation of a diagnostic kit for clear cell renal cell carcinoma.

[0014] The present invention also provides a kit comprising the aforementioned primer-probe composition.

[0015] This invention also provides a method for in vitro detection of methylation levels in the promoter region of the TMEM213 gene for non-disease diagnostic purposes, comprising the following steps:

[0016] Genomic DNA was extracted from the sample and subjected to bisulfite conversion;

[0017] Using the transformed DNA as a template, real-time quantitative PCR was performed using the primer and probe mixture.

[0018] The methylation level was calculated based on the Ct value and corrected using ACTB as an internal reference.

[0019] Preferably, the reaction system for the real-time quantitative PCR is as follows: 2 μL DNA template, 2 μL 2 μM mixed primers, 2 μM probe, 10 μL 2×TaqMan Probes Master Mix, and ddH2O to a final volume of 20 μL; the mixed primers are prepared by mixing upstream and downstream primers in an equimolar ratio.

[0020] The reaction program was 95℃ pre-denaturation for 5 min; 95℃ for 15 s, 60℃ for 1 min, for 40 cycles.

[0021] The present invention discloses the following beneficial effects:

[0022] (1) This invention is the first to discover that a total of 7 CpG sites, namely cg02811197, cg02491878, cg07429038, cg06784539, cg25507767, cg26349773 and cg24798540, in the promoter region of the TMEM213 gene are significantly hypermethylated in clear cell renal cell carcinoma and are negatively correlated with gene expression, filling the gap in the study of the epigenetic regulatory mechanism of this gene.

[0023] (2) After 5-Aza-CdR demethylation treatment, the methylation level of the TMEM213 gene at site cg06784539 in A498 renal cell carcinoma cells decreased significantly, while its mRNA expression was correspondingly upregulated. This indicates that the methylation status at this site is related to the expression of the TMEM213 gene, suggesting that it may be involved in regulating the silencing of this gene. This finding provides a potential target basis for the study of demethylation therapy.

[0024] (3) The present invention designs a primer-probe composition targeting the CpG site in the promoter region of the human TMEM213 gene. This primer-probe composition has high specificity and can efficiently distinguish between methylated and unmethylated templates, avoiding non-specific amplification, and has high detection sensitivity and good repeatability. This primer-probe composition, combined with the internal reference gene ACTB primer-probe composition, can be used to prepare a kit for detecting the methylation level of the TMEM213 gene.

[0025] (4) The primer and probe composition of the present invention can be used for high-throughput screening of TMEM213 gene promoter methylation and absolute quantification of TMEM213 gene promoter methylation, meeting various clinical needs such as early screening, postoperative minimal residual lesion monitoring and prognostic stratification. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 Example 1 illustrates the analysis of TMEM213 expression and promoter methylation in KIRC tissues based on the TCGA database. Specifically, A represents the difference in TMEM213 expression between KIRC and adjacent normal tissues analyzed using online tools from the TCGA database; B represents the difference in TMEM213 promoter methylation between KIRC and adjacent normal tissues; C represents the correlation between the degree of TMEM213 promoter methylation and its expression; and D represents the fold change in methylation at seven CpG sites in the TMEM213 promoter region between KIRC and adjacent normal tissues.

[0028] Figure 2 In Example 2, RT-PCR was used to detect the effect of different concentrations of 5-Aza-CdR on TMEM213 mRNA expression.

[0029] Figure 3 The images show the positions and amplification curves of the cg06784539 methylated probe and amplification primers; where A is the amplification curve of the unmethylated ACTB probe and amplification primers, B is the position of the cg06784539 probe and amplification primers in the bisulfite-modified DNA sequence, C is the amplification curve of the cg06784539 site methylated probe and amplification primers, and D is the amplification curve of the ACTB methylated probe and amplification primers.

[0030] Figure 4 To investigate the effect of methylation-specific PCR on the methylation level at site cg06784539 in A498 renal cell carcinoma cells;

[0031] Figure 5 To detect the methylation differences of cg06784539 site in KIRC tissue and adjacent normal tissue using methylation-specific PCR. Detailed Implementation

[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0037] Example 1: Expression of TMEM213 in KIRC and Screening of Differential Methylation Sites in Promoter Region

[0038] The data in this embodiment comes from the Cancer Genome Atlas (TCGA) database. The expression and promoter methylation of TMEM213 in KIRC were analyzed using the online tools UALCAN, DMNIVD, and SMART, and differentially methylated sites were screened. The standard TCGA-KIRC analysis cohort invoked by the aforementioned online tools automatically categorizes samples into primary tumor and normal tissue groups for analysis. This cohort excludes samples with incomplete or substandard data and is a widely accepted standard analysis dataset in the field. The analysis results showed that the expression level of TMEM213 in KIRC tissue was significantly lower than that in adjacent normal tissue, with a statistically significant difference (p < 0.0001); the methylation level of the TMEM213 gene promoter region was higher in KIRC than in adjacent normal tissue, with a statistically significant difference (p < 0.0001); the degree of methylation in the TMEM213 promoter region was significantly negatively correlated with its expression (r = −0.62, p = 4.56e-37); the methylation of seven probe sites (cg02811197, cg02491878, cg07429038, cg06784539, cg25507767, cg26349773, and cg24798540) showed significant differences between KIRC and adjacent normal tissue, see [link to analysis]. Figure 1 The methylation levels of the aforementioned probes were significantly negatively correlated with TMEM213 expression in KIRC tissues (p < 2.2e−16); the correlation coefficients were −0.77, −0.63, −0.54, −0.73, −0.72, −0.78, and −0.54, respectively. In terms of fold change in methylation, probe cg06784539 ranked second, slightly lower than probe cg07429038, but in terms of correlation with gene expression, cg06784539 (r = −0.73) was significantly higher than cg07429038 (r = −0.54). Therefore, this invention selected experimental verification of the methylation status at the cg06784539 site.

[0039] Example 2: 5-Aza-2'-deoxycytidine (5-Aza-CdR) treatment upregulates TMEM213 mRNA expression in A498 cells

[0040] The experimental method is as follows:

[0041] (1) Cell culture and drug treatment

[0042] A498 cells were cultured in MEM medium supplemented with a mixture of 10% fetal bovine serum and 1% penicillin-streptomycin. Cells were incubated at 37°C in a 5% CO2 incubator. Total RNA was extracted from A498 cells after treatment with 5-Aza-CdR (0, 5, and 10 μM) for 72 h.

[0043] (2) Extraction and reverse transcription of total RNA from cells

[0044] Total RNA extraction and reverse transcription were performed according to the kit instructions.

[0045] (3) The PCR reaction system and conditions are as follows:

[0046] Reaction system: 2 μL cDNA template, 2 μL mixed upstream and downstream primers (2 μM, upstream and downstream primer molar ratio of 1:1), 4 μL 5 × PCR Mix, and ddH2O to bring the total to 20 μL.

[0047] Reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ for 15 s, 60℃ for 1 min, 40 cycles.

[0048] The TMEM213 primers are shown below:

[0049] Upstream primer: TTTGCCTCCCTCCACTCG (SEQ ID NO.10);

[0050] Downstream primer: CCGTACTCGTCCACTCCTGT (SEQ ID NO.11).

[0051] The GAPDH primers are shown below:

[0052] Upstream primer: AACGGATTTGGTCGTATTG (SEQ ID NO.12);

[0053] Downstream primer: GGAAGATGGTGATGGGATT (SEQ ID NO.13).

[0054] Agarose gel electrophoresis results showed that the target band was almost invisible in the control group (DMSO), while the target band was visible in the 5-Aza-CdR treatment groups (5 and 10 μM), with the 10 μM band being clearer than the 5 μM band. This indicates that 5-Aza-CdR treatment can upregulate the expression level of TMEM213 in A498 cells. Figure 2 This result is consistent with the previous bioinformatics analysis, which showed that TMEM213 is expressed at low levels in clear cell renal cell carcinoma.

[0055] Example 3: 5-Aza-CdR treatment downregulates methylation level at site cg06784539 of TMEM213 gene in A498 cells

[0056] The experimental method is as follows:

[0057] (1) Cell culture and drug treatment

[0058] The method is the same as in Example 2, and genomic DNA of cells is extracted after 72 h of drug treatment.

[0059] (2) Extraction and bisulfite modification of cellular genomic DNA

[0060] The extraction and bisulfite modification of cellular genomic DNA were performed according to the kit instructions.

[0061] (3) Detection of methylation-specific PCR (Q-MSP)

[0062] This experiment uses 2 -△△Ct The results were analyzed using the following method, and the reaction system and conditions are as follows:

[0063] Reaction system: 2 μL DNA template, 2 μL upstream and downstream mixed primers (2 μM, upstream and downstream primer molar ratio of 1:1), 2 μL probe (2 μM), 10 μL TaqMan Probes Master Mix (2 ×), ddH2O to make up to 20 μL.

[0064] Reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ for 15 s, 60℃ for 1 min, 40 cycles.

[0065] The upstream primer for detecting the methylation site of cg06784539 is GAGGGAAAGAAGGAGGAG (SEQ ID NO.1), the downstream primer is CCCCTACCTAATCCTTCAA (SEQ ID NO.2), and the probe (5' end FAM modified, 3' end BHQ1 modified) is TCCTTCCTTTACGCAAAACCAACC (SEQ ID NO.3). ACTB is used as the internal reference gene in this invention. The upstream primer for detecting methylated ACTB gene DNA is TGGTGATGGAGGAGGTTTAGTAAGT (SEQ ID NO.4), the downstream primer is AACCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO.5), and the probe (5' end VIC modified, 3' end BHQ1 modified) is ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO.6). The ACTB upstream primer for detecting unmethylated DNA is GCGCCGTTCCGAAAGTT (SEQ ID NO.7), the downstream primer is CGGCGGATCGGCAAA (SEQ ID NO.8), and the probe (5' end modified with VIC, 3' end modified with BHQ1) is ACCGCCGAGACCGCGTC (SEQ ID NO.9).

[0066] First, it was determined whether the cg06784539 methylation probe and amplification primers of this invention could be used to analyze DNA methylation differences. The ACTB unmethylation probe was used to amplify A498 cell genomic DNA. Experimental results showed that the ACTB unmethylation probe could detect a fluorescent signal, indicating that the extracted DNA sample could be used for normal amplification of the target DNA fragment. The modified A498 cell genomic DNA was serially diluted (dilution gradient: 1× (stock solution), 10×...). -1 10 -2 10 -3 Then, real-time quantitative PCR was performed. The results showed that the Ct value gradually increased with decreasing template DNA concentration. The average Ct values ​​of the cg06784539 methylation probe were 28.19, 31.30, 34.86, and 38.91, with an amplification efficiency of 94.5%; the average Ct values ​​of the ACTB methylation probe were 26.95, 30.05, 33.52, and 36.74, with an amplification efficiency of 96.5%. Unmodified A498 cell genomic DNA could not be detected by either the cg06784539 or ACTB methylation probes. Figure 3The above results indicate that the cg06784539 probe and amplification primer sequences of this invention can effectively detect the methylation differences at this site. Next, this experimental system was used to detect the changes in the methylation level of the cg06784539 site of the TMEM213 gene in A498 cells after 5-Aza-CdR treatment. The experimental results showed that, compared with the control group (DMSO), the methylation level of the cg06784539 site in the promoter region of the TMEM213 gene was significantly reduced after 5-Aza-CdR treatment (5, 10 μM), and the difference was statistically significant (p < 0.01), indicating that methylation occurred at this site of the TMEM213 gene in A498 renal cell carcinoma cells. Figure 4 Furthermore, the results also demonstrate that the cg06784539 probe and amplification primer sequences can be used to detect the methylation level at the cg06784539 site.

[0067] Example 4: Application of TMEM213 gene promoter region methylation probe in the detection of clear cell renal cell carcinoma samples

[0068] The experimental method is as follows:

[0069] 1. Extraction of genomic DNA from tissues

[0070] Genomic DNA was extracted from 20 KIRC tissue samples and 20 paired adjacent normal tissue samples (a total of 40 samples). The DNA was then processed using a bisulfite modification kit, following the kit's instructions.

[0071] 2. Q-MSP testing

[0072] The probe, primer sequences, and methods used in this experiment are the same as those in Example 3.

[0073] Experimental results showed that the methylation level at site cg06784539 in clear cell renal cell carcinoma tissue was higher than that in adjacent normal tissue, and the difference was statistically significant (p < 0.01). Figure 5 .

[0074] Example 5: Validation of cg06784539 methylation probe in a large sample in the TCGA database

[0075] To further verify the diagnostic applicability of the methylation probe and detection method of this invention, this study conducted external large-sample validation using 470 samples (313 tumor tissues and 157 normal tissues) from the KIRC cohort in the TCGA database. ROC curve analysis was used to evaluate its diagnostic efficacy. The results showed that the methylation β value of the cg06784539 probe in clear cell renal cell carcinoma tissue was significantly higher than that in normal renal tissue, and 1.8 times higher in tumor tissue than in adjacent normal tissue. The difference between the two groups was statistically significant (p < 0.0001), highly consistent with the previous small-sample results (1.6 times) in clinical tumor tissue, confirming a significant difference in methylation at the probe site. ROC curve analysis further showed that the probe exhibited excellent performance in distinguishing KIRC tissue from normal tissue, with an area under the curve (AUC) of 0.9371 (95% CI: 0.9132–0.9610), a sensitivity of 90.42%, and a specificity of 97.45%, fully demonstrating its high discriminative ability in the diagnosis of clear cell renal cell carcinoma. In addition, ROC analysis was performed on the remaining six candidate methylation probes. The results showed that the AUCs of cg02811197, cg26349773, cg25507767, and cg07429038 were all higher than 0.9; the AUCs of cg02491878 and cg24798540 were also greater than 0.85, and all exhibited high sensitivity and specificity. Therefore, these probes also possess good diagnostic potential for KIRC (see Table 1). This embodiment, relying on the large sample resources of the TCGA database, not only fully demonstrates the diagnostic reliability of the cg06784539 probe and its supporting detection method, but also lays the foundation for the subsequent development of multi-marker combined diagnostic schemes.

[0076] Table 1. ROC curve analysis of differentially expressed CpG site methylation probes of the TMEM213 gene based on the TCGA database.

[0077]

[0078] Note: The probe p < 0.0001 above.

[0079] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a reagent for detecting the methylation level at the cg06784539 site in the promoter region of the TMEM213 gene in the preparation of products for diagnosing clear cell renal cell carcinoma, characterized in that, The reagents include specific primer pairs as shown in SEQ ID NO.1-2 and probes as shown in SEQ ID NO.3.

Citation Information

Patent Citations

  • Probe set and kit for detecting whole exons of extended genetic diseases and application of probe set

    CN110499364A

  • Methods for identifying activating antigen receptor (ACAR) / inhibitory chimeric antigen receptor (ICAR) pairs for use in cancer therapies

    CN113453705A