Low-temperature-resistant amicarbalide-degrading bacteria and application thereof
By using a microbial agent formed by loading the low-temperature copper-loving bacterium CS1 onto the surface of biochar, the problem of low degradation efficiency of microbial methods under low-temperature conditions was solved, achieving efficient and safe degradation of benzoxazole-fluoxad, with a degradation rate of over 90%.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- LIAONING HENGRUN AGRI CO LTD
- Filing Date
- 2025-10-29
- Publication Date
- 2026-05-19
AI Technical Summary
Existing microbial methods for degrading benzoxazole and fluazinam in farmland soil suffer from poor environmental adaptability of the degrading strains, low degradation efficiency, long degradation cycle, and risk of secondary pollution. Furthermore, they are difficult to efficiently remove pesticide residues under low-temperature conditions.
The low-temperature resistant copper-loving bacterium (Cupriavidus CS1) was loaded onto the surface of sesquiterpene biochar to form a biochar-loaded microbial agent, which was used to degrade benzoxazole-flufenoxam in the soil under low-temperature conditions. The degradation efficiency was improved by optimizing the culture medium and loading conditions.
At 15-25℃, biochar loaded with microbial agents significantly improves the degradation efficiency of benzoyl flufenoxuron, enabling efficient removal of benzoyl flufenoxuron residues from soil under low-temperature conditions, with a degradation rate of over 90%, thus avoiding secondary pollution.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbiology and its application technology, specifically relating to a low-temperature resistant benzoxazole-fluoxad oxadixyl-degrading bacterium and its application. Background Technology
[0002] Fenpyrazone is a novel pyrazolone herbicide that effectively controls or kills weeds such as barnyard grass and crabgrass. However, its half-life can last for several months, and its effectiveness is weakened in colder seasons. Long-term excessive use of fenpyrazone not only has a significant impact on non-target organisms in farmland soil (such as microorganisms and earthworms), but its residues in farmland soil can also threaten human health through the food chain and groundwater. With increasing environmental awareness, the residue levels of fenpyrazone in farmland soil have become a crucial aspect of the environmental safety assessment of this pesticide. Therefore, there is an urgent need to develop low-temperature, high-efficiency fenpyrazone degradation technologies for farmland soil.
[0003] Currently, methods for removing pesticide residues from farmland soil mainly include physical methods (such as thermal desorption and adsorption), chemical methods (such as soil washing and chemical oxidation), and microbial treatment. Physical methods have the advantages of simple operation, high treatment efficiency, and no secondary pollution. However, thermal desorption has high energy consumption, limiting its practical application in farmland soil pesticide residue treatment. Adsorption methods utilize widely available adsorbent materials; biochar, in particular, is highly efficient at pesticide removal and can also regulate the physicochemical properties of farmland soil, making it one of the effective methods for removing pesticide residues. Chemical methods primarily aim to remove and transform pesticide residues. Soil washing mainly separates pesticide residues by adding water or surfactants to the farmland soil; however, this process inevitably increases the risk of secondary chemical pollution and subsequent treatment costs. Chemical oxidation removes pesticide molecules by adding strong oxidants to contaminated farmland soil, offering advantages of simple operation and high efficiency. However, oxidation methods have high operating costs, require strict control of reaction conditions, and may generate secondary pollution. Microbial methods are characterized by high efficiency, low cost, and strong ecological safety, and have become the mainstream approach for the treatment of pesticide residues in farmland soil.
[0004] However, microbial methods still face significant bottlenecks in the practical control of herbicide pollution. Their main drawbacks include poor environmental adaptability of degrading strains, which are easily inactivated under complex temperature, pH, and competitive conditions in the field; low degradation efficiency and long cycles, making it difficult to cope with actual pollution loads; and the potential for some degradation processes to produce more toxic intermediate products, posing a risk of secondary pollution. Currently, various degrading strains have been isolated for different types of herbicides, such as *Pseudomonas* degrading atrazine, *Flavobacterium* decomposing glyphosate, and *Alcaligenes* mineralizing 2,4-D. However, these strains generally suffer from common problems such as narrow degradation spectrum, insufficient functional stability, and difficulties in large-scale application. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention aims to provide a low-temperature resistant benzoxazole-fluoxad ...
[0006] To achieve the above objectives, the following technical solution is adopted:
[0007] A low-temperature resistant benzoxazole-flufenican-degrading bacterium, strain *Cupriavidus*, was deposited on July 22, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 35332.
[0008] Application of a low-temperature resistant benzoxazole-flufenoxam-degrading bacterium, wherein the strain is used to degrade pyrazole herbicides in soil.
[0009] The application of the microbial agent in the degradation of benzoyl fluroxypyr in soil.
[0010] The application of the microbial agent in the degradation of benzoyl fluroxypyr in soil at 15-25℃.
[0011] A low-temperature resistant benzoyl flufenoxuron-methyl degrading bacterial agent, the bacterial agent containing the strain described above.
[0012] The bacterial agent is the strain loaded onto the surface of sesame biochar.
[0013] The bacterial strain in the bacterial agent is a culture of the bacterial strain; wherein, the culture is prepared by inoculating the bacterial strain into LB liquid medium, shaking and culturing, centrifuging, and diluting with NaCl solution to OD. 600 =1, pending.
[0014] The LB medium consists of: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, pH 7.0, autoclaved at 121 ℃ for 30 min; culture conditions: 120 rpm rotation speed, 15-25 ℃ culture temperature, and shaking culture for 48-60 h.
[0015] The guarana biochar was prepared by pulverizing guarana and then firing it in a muffle furnace at 500 °C under vacuum for 2 hours, resulting in a particle size of less than 0.25 mm.
[0016] The strain was obtained by mixing the strain with sesame biochar at a mass ratio of 1:1, rotating at 120 rpm, loading at a temperature of 15-25 ℃, and loading for 24-48 h.
[0017] A method for determining the residue concentration of benzoyl fluroxypyr in farmland soil includes the following specific steps:
[0018] Accurately weigh 2.0 g (±0.05 g) and place it in a 50 mL centrifuge tube. Add 20 mL of a mixed solution of acetonitrile and 0.2% formic acid (volume ratio 4:1). Place the tube in a constant temperature water bath shaker and shake for 1 h. After vacuum filtration through a Buchner funnel, collect the filtrate in a 50 mL centrifuge tube containing 2 g of NaCl. Shake back and forth 150 times and let stand for 20 min until the organic and aqueous phases separate. Shake again 100 times and let stand for 1 h to completely separate the organic and aqueous phases. Use a pipette to take 2.5 mL of the supernatant and place it in a 5 mL centrifuge tube containing 10 mg PSA and 100 mg anhydrous MgSO4. Shake up and down 100 times and vortex for 30 s. Centrifuge at 4000 rpm for 5 min. Take the supernatant and filter it through a 0.22 μm organic filter membrane for analysis.
[0019] The advantages of this invention are:
[0020] The strains of the present invention Cupriavidus CS1 can degrade benzoxazole using benzoxazole as the sole carbon and nitrogen source, and the biochar-loaded microbial agent can achieve the degradation of high concentrations of benzoxazole under low temperature conditions, demonstrating excellent degradation efficiency. Attached Figure Description
[0021] Figure 1 The strain provided in the embodiments of the present invention Cupriavidus Colony morphology diagram of CS1;
[0022] Figure 2 This is a scanning electron microscope image of biochar-supported microbial inoculant provided in an embodiment of the present invention;
[0023] Figure 3 This is a graph showing the changes in the degradation rate of benzoyl fluroxypyr in soil at different temperatures by the biochar-supported microbial agent provided in this embodiment of the invention.
[0024] Figure 4 This is a graph showing the changes in the degradation rate of different concentrations of benzoyl fluroxypyr in soil by the biochar-supported microbial agent provided in this embodiment of the invention.
[0025] Figure 5 This is a graph showing the effect of different dosages of biochar-supported microbial inoculant provided in this embodiment of the invention on the degradation rate of benzoyl fluroxypyr in soil;
[0026] Figure 6 This is a peak diagram of the liquid chromatography-mass spectrometry detection method for different concentrations of benzoxazole-fluoxad ... Detailed Implementation
[0027] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. It should be noted that the specific embodiments described herein are only for illustration and explanation of the present invention and are not intended to limit the present invention.
[0028] Example 1
[0029] Isolation and identification of low-temperature resistant strains that degrade benzoxazole and flufenoxuron:
[0030] (1) Source of the strain
[0031] It was obtained by screening from the 2-8 cm soil layer of a farmland in Shenyang.
[0032] (2) Culture medium formulation
[0033] The enrichment medium consisted of: 0.05 g / L benzoyl fluazinam, 1 g / L K2HPO4, 0.5 g / L KH2PO4, 0.2 g / L MgSO4·7H2O, 0.5 g / L NaCl, 0.1 g / L CaCl2, and 0.02 g / L FeSO4·7H2O.
[0034] The LB liquid culture medium consisted of: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, and pH 7.0.
[0035] The LB liquid medium consisted of: yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L, agar powder 20 g / L, and pH 7.0.
[0036] (3) Isolation of strains
[0037] Screening of low-temperature resistant bacterial strains from farmland soil: Strain isolation and purification process: Weigh 10 g of fresh soil sample collected from the 2-8 cm soil layer of farmland and place it in a 250 mL Erlenmeyer flask with oiled glass beads. Add 90 mL of sterile water, shake thoroughly, and let stand for 2 h. Take 1 mL of the supernatant and inoculate it into fresh enrichment medium. Incubate at 15 ℃ for 48 h in a shaker. Repeat the above operation 3 times. Inoculate the bacterial solution of the last repetition onto LB solid medium using the gradient streak method. Cultivate and observe for 1-7 days to observe its growth. After 7 days of cultivation, pick a single colony and repeatedly inoculate and streak it onto LB solid medium to finally obtain the isolated and purified single strain.
[0038] Screening of cryogenic strains: Prepare the purified single strains and inoculate them onto LB solid medium. Culture them at 0, 5, 10, 15 and 25 °C respectively. After 7 days, observe the growth of the strains on each medium. Record the strains that can grow at 0 °C and whose maximum growth temperature is higher than 25 °C and identify them as cryogenic strains.
[0039] Through enrichment culture, isolation and purification, and low-temperature screening, a strain with benzoyl flufenoxuron degradation function was finally screened from farmland soil and named CS1. Its colony morphology on LB solid medium is as follows: Figure 1 As shown.
[0040] (4) Identification of strains
[0041] The strain obtained above was identified as CS1 and deposited at the China General Microbiological Culture Collection Center on July 22, 2025, with accession number CGMCC No. 35332.
[0042] After DNA extraction, PCR amplification, sequence sequencing, and sequence alignment, the 16S rDNA sequence of strain CS1 was found to be similar to that of *Copper-loving Bacteria*. Cupriavidus With a homology of 99.8% and the closest kinship, it was identified as copper-loving bacteria, abbreviated as CS1.
[0043] The 16S rDNA sequence is as follows:
[0044] CS1 bacteria:
[0045] TCCGCGTCGACCGTGCCGTCGGCGCGCGTCACGCGGAAGGCGTCGTTGATGGCCCGGATGCTGTCGGCCTCAATGTCCATGTGCATCGCCGACAGGAAGCCGCCCGGCTGCACCACCGTGCCCGTCAC CACGTTCCAGCCGCCCTGCGCCTTGTACGCGTTGGTGCCGATCGACACCACGTTCGGGCTCAGGTCGATGCTTTCGGCCTTGACCGTCAGCGTGTCCCGCGCGACGACCTGCCCGGTGTTGCGAAGCTG GCCGTCGACGGTCAGCTTGATGTTCTCGCCGCTGATCGTGCCGCCAGTGGGCACAGCCAGCGCCTGGGCATAGCCTTCCGGCAGATAGACCTGCGGCACCAGCGCGTTGACGCTCGGGCAGATCGTGCT GGCCAGCGTGCAGCGCGGGTCGGGTACTGCTTGCTCGACGTACCACAGCATCGGTGCGTCGAGCGCCTTCACCTGATCCACGCTCAGGGCCTGGCCCAGCGCCAGGTTGTGTTCCTTCGCGTAGTCGGC
[0046] Example 2
[0047] Preparation of microbial agents:
[0048] The biochar-loaded microbial agent was prepared by inoculating the above-mentioned strain CS1 into a sterile enrichment medium for activation, followed by inoculation at a rate of 5 wt% into 100 mL of LB liquid medium. The culture was then carried out at 15 ℃ and 120 rpm in a constant temperature shaker until the logarithmic growth phase. After centrifugation, the precipitate was collected and washed with sterile physiological saline until the OD value was reached. 600 =1 bacterial solution.
[0049] Sesbania biochar was pulverized and sieved to obtain sesbania biochar with a particle size of less than 0.25 mm. After sterilization, it was subjected to shaking loading with the above-mentioned CS1 bacterial solution. The loading conditions were: mass ratio of the two to 1:1, rotation speed 120 rpm, loading temperature 15 ℃, and loading time 24 h, to obtain biochar-loaded microbial inoculant (see [link]). Figure 2 ).
[0050] Sesbania biochar is produced by first crushing collected sesbania, then placing the crushed material in a muffle furnace at a vacuum temperature of 500 °C for 2 hours, resulting in a particle size of less than 0.25 mm.
[0051] Depend on Figure 2 It is evident that after loading, the strain adhered to the porous inner wall of the biochar and maintained its morphology, indicating that the strain had successfully loaded onto the biochar and formed a carbon-based inoculant.
[0052] Example 3
[0053] The degradation of benzoyl fluroxypyr (200 ppb) in farmland soil at different temperatures (0 ℃, 5 ℃, 10 ℃, 25 ℃) was tested using the biochar-loaded microbial agent (2% by mass) obtained above.
[0054] To investigate the effect of different farmland soil ambient temperatures on the degradation of benzo[a]flufenican by biochar-loaded microbial agents, this embodiment set up four temperature treatment groups (5 ℃, 10 ℃, 15 ℃, and 25 ℃). The biochar-loaded microbial agent prepared in the above embodiment was added at a mass ratio of 2% to experimental soil containing 200 ppb benzo[a]flufenican, with three replicates for each treatment group. Samples were collected at 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h, and the concentration of residual benzo[a]flufenican in the soil was detected by high performance liquid chromatography-mass spectrometry (HPLC-MS / MS), and the degradation rate was calculated. Results are shown below. Figure 3 .
[0055] Depend on Figure 3The results indicate that under the conditions of a biochar-loaded biochar agent dosage of 2% and a soil benzoyl-fluorinated compound concentration of 200 ppb, treatment groups at temperatures of 5 ℃, 10 ℃, 15 ℃, and 25 ℃ all effectively removed benzoyl-fluorinated compound contamination from the soil. Within 48 h, the degradation rates of benzoyl-fluorinated compound in the soil for each treatment group were 54.79%, 83.62%, 87.23%, and 92.30%, respectively. At 72 h, the 15 ℃ and 25 ℃ treatment groups completely degraded benzoyl-fluorinated compound, while the degradation rates for the 5 ℃ and 10 ℃ treatment groups were 62.50% and 96.50%, respectively. The degradation rate increases were similar for the 10 ℃, 15 ℃, and 25 ℃ treatment groups, and were higher than those for the 5 ℃ treatment at all time points. In conclusion, this biochar-loaded microbial agent exhibits excellent removal efficiency for benzoyl-fluorinated compound contamination in contaminated farmland soil under ambient temperatures of 15-25 ℃.
[0056] Example 4
[0057] The degradation experiments of different concentrations of benzoyl flufenoxuron (200 ppb) in low-temperature farmland soil (15 ℃) were conducted using different dosages (2%, 4%, and 6% by mass) of the biochar-loaded microbial agent obtained above.
[0058] To investigate the effect of different dosage ratios of biochar-loaded microbial inoculant on the degradation of benzoyl flufenoxuron in farmland soil, this study established three dosage ratios (2%, 4%, and 6%). The biochar-loaded microbial inoculant was added at a dosage ratio of 2% to experimental soil containing 200 ppb benzoyl flufenoxuron at an ambient temperature of 15 ℃. Each treatment group was replicated three times. Samples were collected at 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h, and the concentration of residual benzoyl flufenoxuron in the soil was detected using high-performance liquid chromatography-mass spectrometry (HPLC-MS / MS). The degradation rate was calculated. Results are shown below. Figure 4 .
[0059] Depend on Figure 4 It was found that at a temperature of 15 ℃ and a soil benzoyl-fluorinated compound concentration of 200 ppb, the dosage ratio of biochar-loaded microbial inoculant was positively correlated with the degradation rate of benzoyl-fluorinated compound. Furthermore, the removal rates of benzoyl-fluorinated compound by dosage ratios of 2%, 4%, and 6% within 48 h were 87.23%, 89.16%, and 95.10%, respectively. Moreover, when the removal time was extended to 72 h, all three dosage ratios completely degraded benzoyl-fluorinated compound. Therefore, considering both application cost and pollution removal efficiency, a 2% biochar-loaded microbial inoculant is most suitable for removing benzoyl-fluorinated compound contamination from farmland soil in cold regions.
[0060] Example 5
[0061] The degradation experiments of different concentrations of benzoyl fluroxypyr (100 ppb, 200 ppb, 500 ppb) in low-temperature farmland soil environment (15℃) were conducted using the above-mentioned biochar-loaded microbial inoculant (2% by mass).
[0062] To investigate the effect of biochar-loaded microbial inoculant on the degradation of different concentrations of benzoylflufenican in farmland soil, this study established three treatment groups with benzoylflufenican concentrations (100 ppb, 200 ppb, and 500 ppb). Biochar-loaded microbial inoculant was added at a mass ratio of 2% to experimental soils containing 100 ppb, 200 ppb, and 500 ppb of benzoylflufenican, respectively, with three replicates for each treatment group. Samples were collected at 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h, and the residual benzoylflufenican concentration in the soil was detected using high-performance liquid chromatography-mass spectrometry (HPLC-MS / MS), and the degradation rate was calculated. Results are shown below. Figure 5 .
[0063] Depend on Figure 5 At a temperature of 15 ℃ and a biochar-loaded microbial agent dosage of 2%, the degradation rate of different concentrations of benzoylflufenicol in the soil by the biochar-loaded microbial agent showed that the concentration of benzoylflufenicol in the soil was inversely proportional to its degradation rate. At 48 h, the degradation rates of each treatment group (100 ppb, 200 ppb, and 500 ppb) were 90.5%, 87.23%, and 82.3%, respectively, and all three concentrations could be completely degraded by the biochar-loaded microbial agent within 72 h.
[0064] In summary, the above-mentioned biochar-loaded microbial agents showed excellent removal effects of benzoxazole-flufenicol from soil with pollution concentrations of 100 ppb, 200 ppb, and 500 ppb at an ambient temperature of 15 ℃.
Claims
1. A low-temperature resistant benzoyl flufenoxuron-methyl degrading bacterium, characterized in that: The strain is copper-loving bacteria ( Cupriavidus sp. It was deposited at the China General Microbiological Culture Collection Center on July 22, 2025, with accession number CGMCC No. 35332.
2. The application of the low-temperature resistant benzoxazole-fluoxad ... Application of the strain in the degradation of benzoxazole-fluoxadiazon in soil.
3. The application of the low-temperature resistant benzoyl flubendiamide degrading bacteria according to claim 2, characterized in that: Application of the strain in degrading benzoxazole-flufenoxam in soil at 15-25℃.
4. A low-temperature resistant benzoyl flubendioxonium-degrading bacterial agent, characterized in that: The microbial agent contains the strain described in claim 1.
5. The low-temperature resistant benzoyl fluroxypyr degrading microbial agent according to claim 4, characterized in that: The bacterial strain described in claim 1 is loaded onto the surface of sesquiton biochar in the bacterial agent.
6. The low-temperature resistant benzoyl fluroxypyr degrading microbial agent according to claim 4 or 5, characterized in that: The bacterial strain in the bacterial agent is a culture of the strain described in claim 1; wherein, the culture is prepared by inoculating the strain into LB liquid medium, shaking and culturing, centrifuging, and diluting with NaCl solution to OD. 600 =1, pending.
7. The low-temperature resistant benzoyl fluroxypyr degrading microbial agent according to claim 6, characterized in that: The LB medium consists of: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, pH 7.0, and autoclaved at 121°C for 30 min; culture conditions: 120 rpm rotation speed, 15-25°C culture temperature, and shaking culture for 48-60 h.
8. The low-temperature resistant benzoyl fluroxypyr degrading microbial agent according to claim 5, characterized in that: The sesame biochar is made by calcining sesame seeds in a muffle furnace at 500°C under vacuum for 2 hours after initial crushing, resulting in a particle size of less than 0.25 mm.
9. The low-temperature resistant benzoyl fluroxypyr degrading microbial agent according to claim 8, characterized in that: The bacterial strain and sesame biochar were mixed at a mass ratio of 1:1, rotated at 120 rpm, loaded at a temperature of 15-25℃, and loaded for 24-48 hours to obtain the bacterial agent.