Recombinant escherichia coli for synthesizing sialylated lacto-n-tetraose c and construction method and application thereof

Abstract

The present application relates to a kind of recombinant escherichia coli of synthetic sialyllactose-N-tetrasaccharide c and its construction method and application, by adding new synthetic pathway, the supply of its precursor CMP-Neu5Ac is optimized;By screening high-efficiency, specific strong alpha2,6-sialyltransferase, and it is integrated into escherichia coli BL21 (DE3) genome, further improve the yield of sialyllactose-N-tetrasaccharide c, reduce the accumulation of precursor LNnT, LNTII and by-product 6'-SL;By adding sugar efflux transporter gene, reduce the inhibitory effect brought by intracellular accumulation of high-concentration sugar product.Synthetic sialyllactose-N-tetrasaccharide c of high yield can be obtained by culturing and fermenting recombinant escherichia coli, and further improve the proportion of the obtained product sialyllactose-N-tetrasaccharide c in total HMO.

Description

Technical Field

[0001] This invention belongs to the field of metabolic engineering and relates to a recombinant Escherichia coli that synthesizes sialyl lactose-N-tetrasaccharide c, its construction method, and its application. Background Technology

[0002] Human milk oligosaccharides (HMOs) are the third largest solid component in human milk after lactose and lipids, enhancing infant health and promoting growth and development. Numerous animal and clinical trials have confirmed the beneficial properties of HMOs, including their role as prebiotics in maintaining gut microbiota balance, resisting pathogen adhesion, regulating the immune system, and promoting nervous system development and repair. Currently, over 200 HMOs have been identified and characterized, mainly including sialylated, fucosylated, and non-fucosylated types. Among these, the sialylated human milk oligosaccharide sialyl-N-tetrasaccharide c (LST-c) has a relatively high content during early lactation and shows broad research potential in the treatment of encephalopathy and influenza viruses. Therefore, the efficient synthesis of sialyl-N-tetrasaccharide c can provide a foundation for future research and applications related to sialyl-N-tetrasaccharide c.

[0003] Currently, the artificial synthesis of sialyl-N-tetrasaccharide c mainly relies on chemical synthesis and enzymatic methods, which involve numerous cumbersome procedures and steps, resulting in high production costs. The application of microbial synthesis of sialyl-N-tetrasaccharide c is limited. Compared with chemical methods, microbial synthesis is lower in cost, higher in yield, and more environmentally friendly, thus attracting widespread attention from researchers. There are existing studies on the production of sialyl-N-tetrasaccharide c through metabolic pathway modification using *E. coli* as a substrate bacterium. However, the generation of metabolic byproducts such as 6'-SL negatively impacts the production efficiency of sialyl-N-tetrasaccharide c; the efficiency of producing precursors such as LNTⅡ, LNnT, and CMP-Neu5Ac needs improvement; high concentrations of sugar products accumulate intracellularly, inhibiting bacterial growth; and most methods of increasing yield by introducing free plasmids result in unstable strain expression. Reports on genome integration modification are relatively few and difficult to achieve the requirements for large-scale production. Therefore, it is essential to further optimize the bioconversion rate of sialyl lactose-N-tetrasaccharide c and construct more stable and efficient engineered strains to increase the yield of sialyl lactose-N-tetrasaccharide c. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a recombinant Escherichia coli strain for synthesizing sialyl lactose-N-tetrasaccharide c, its construction method, and its applications.

[0005] The technical solution adopted in this invention is: a recombinant Escherichia coli that synthesizes sialyl lactose-N-tetrasaccharide c, which integrates and inserts a gene encoding β-1,3-acetylglucosyltransferase into the genome of the chassis host bacteria. lgtA Encoding β-1,4-galactosyltransferase lgtB Gene, encoding UDP-glucose 4-isomerase gene galE And the gene encoding α2,6-sialic acid transferase.

[0006] Preferably, the gene encoding N-acylneuraminic acid cytidine transferase is inserted or overexpressed in the genome of the chassis host bacteria. neuA Encoding N-acetylneuraminic acid synthase neuB and encoding UDP-acetylglucosamine N-acetyl isomerase neuC ;

[0007] And / or, insertion or overexpression of genes encoding glucosamine-N-acetyltransferase. GNA1 Gene encoding fructose-1-phosphate phosphatase yqaB and encoding N-acylglucosamine 2-isomerase age .

[0008] Preferably, the gene encoding β-galactosidase in the genome of the chassis host bacteria is knocked out. lacZ Gene encoding UDP-acetylglucosamine 2-isomerase wecB and the gene encoding UDP-glucose-6-dehydrogenase ugd Gene encoding N-acetylglucosamine-6-phosphate deacetylase nagA Gene encoding glucose-6-phosphate deaminase nagB Gene encoding N-acetylneuraminic acid hydrolase nanA Gene encoding N-acylglucosamine-6-phosphate diacetyl isomerase nanE Gene encoding sialic acid transporter nanT and the gene encoding N-acylmannosamine kinase nanK One or more of them.

[0009] Preferably, the gene encoding α2,6-sialyltransferase is derived from Photobacterium phosphoreum、 Photobacterium damselae, Photobacterium carnosum, Photobacterium kishitanii, Photobacterium leiognathi, Shewanella xiamenensis, Aeromonas caviae, Aeromonas bivalvium, Vibrio chemaguriensis, Vibrio parahaemolyticus or Enterovibrio baiacu .

[0010] Preferably, a sugar efflux transporter gene is integrated into the genome of the chassis host bacteria. setS .

[0011] Preferably, the gene encoding α2,6-sialyltransferase PdSTThe codon-optimized nucleotide sequence is shown in SEQ ID No. 1; encoding a gene for a sugar efflux transporter. setS The codon-optimized nucleotide sequence of the gene is shown in SEQ ID No. 2.

[0012] Preferably, integration and overexpression galE, lgtB, neuC, yqab and PdST When one or more genes are involved, the J23119, J23100 or J23104 promoter is linked before the gene sequence, and the RBS sequence is added after the promoter.

[0013] Preferably, the genome of *Escherichia coli* BL21(DE3) is edited using a λ-Red homologous recombination method to knock out... lacZ, wecB, ugd Integration / overexpression at the corresponding sites lgtA, lgtB, galE, neuA, neuB, neuC Knockout nagA, nagB Integration / overexpression at the corresponding sites neuB, neuC Knockout nanA, nanE, nanT, nanK Integration / overexpression at the corresponding sites GNA1, yqaB, age, PdST, setS A recombinant Escherichia coli strain capable of efficiently synthesizing sialyl lactose-N-tetrasaccharide c was obtained.

[0014] Preferably, gene editing is performed using a two-step homologous recombination method, with *Escherichia coli* BL21(DE3) as the starting strain, knocking out... lacZ Genes, and integrate them at the corresponding sites. lgtA - lgtB Gene; knockout wecB Genes, and integrate and overexpress them at the corresponding sites. galE Gene; knockout ugd Genes, and integrate and overexpress them at the corresponding sites. neuA - neuB - neuC Gene; knockout nagA Genes, and integrate and overexpress them at the corresponding sites. neuB Gene; knockout nagB Genes, and integrate and overexpress them at the corresponding sites. neuC Gene; knockout nanA Genes, and integrate them at the corresponding sites. GNA1 - yqaB - age Gene; knockout nanE Genes, and integrate and overexpress them at the corresponding sites. GNA1 - yqaB Gene; knockout nanT Genes, and integrate them at the corresponding sites. setS Gene; knockout nanK Genes, and integrate and overexpress them at the corresponding sites. PdST Gene.

[0015] In another aspect, the present invention provides a method for preparing sialyl lactose-N-tetrasaccharide c, which is prepared by recombinant Escherichia coli that synthesizes sialyl lactose-N-tetrasaccharide c.

[0016] Preferably, the recombinant Escherichia coli is cultured in shake flasks. The shake flask fermentation medium includes 13-15 g / L KH2PO4, 1-2 g / L (NH4)2HPO4, 2.5-3 g / L citric acid, 2-3 g / L peptone, 4-5 g / L yeast extract, 15-20 g / L glycerol, 1.3-1.7 g / L magnesium sulfate heptahydrate, and 6-10 ml / L trace elements.

[0017] Alternatively, recombinant *E. coli* can be fermented in a fermenter based on a shake-flask culture system. The seed culture used in the fermenter consists of: 2 g / L tryptone, 4 g / L yeast extract, 15–20 g / L glycerol, 10–13.5 g / L potassium dihydrogen phosphate, 3.0–5.0 g / L diammonium hydrogen phosphate, 1.0–2.0 g / L citric acid, 1.0–2.0 g / L magnesium sulfate heptahydrate, and 5–10 ml / L trace element solution. After inoculation, the culture is carried out at 37°C and 180 rpm until OD reaches [value missing]. 600 When the temperature reaches 12 h, add 10 g / L lactose, and then add 10 g / L lactose and 20 g / L glycerol every 12 h, and culture for 72 h.

[0018] The advantages and positive effects of this invention are as follows: By gene editing of the *Alternaria* genome, a recombinant strain with a metabolic pathway for producing sialyl lactose-N-tetrasaccharide c was successfully constructed; by introducing genes for new metabolic pathways into the *E. coli* genome and overexpressing / optimizing their nucleotide sequences, a new pathway for synthesizing the sialyl lactose-N-tetrasaccharide c precursor CMP-Neu5Ac was added, adjusting the carbon flow allocation of the metabolic pathway and further increasing the yield of sialyl lactose-N-tetrasaccharide c; and by screening for highly efficient PdST genes and heterologously introducing them into the *E. coli* genome. This method increases the yield of sialyl lactose-N-tetrasaccharide c while reducing the accumulation of precursors LNnT and LNTII, as well as the byproduct 6'-SL. It integrates sugar efflux transporter genes into the saccharidobacterium genome, reducing the inhibitory effect on strain growth caused by the intracellular accumulation of high-concentration sugar products. The recombinant strain obtained by this method has no exogenous plasmids, and all integrated genes are constitutively expressed. No antibiotics or inducers are needed during fermentation, thus ensuring high yield of sialyl lactose-N-tetrasaccharide c while reducing the complexity of the production process, lowering industrial costs, and improving the safety of the final product. Attached Figure Description

[0019] Figure 1 This invention describes the metabolic pathway by which recombinant Escherichia coli synthesizes sialyl lactose-N-tetrasaccharide C.

[0020] Figure 2To compare the yields of sialyl lactose-N-tetrasaccharide c and its precursors and byproducts obtained by shake-flask fermentation after sequential gene editing of recombinant E. coli E4-E9;

[0021] Figure 3 To screen different heterologous α2,6-sialyltransferases from the chassis bacteria and compare the yields of sialyl lactose-N-tetrasaccharide c, its precursors, and byproducts through fermentation in a fermenter;

[0022] Figure 4 This invention presents the dynamic changes of products and substrates, as well as the growth curves of recombinant Escherichia coli in a 5L fermenter. Detailed Implementation

[0023] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0024] This invention relates to a recombinant *Escherichia coli* strain that synthesizes sialyl lactose-N-tetrasaccharide c, its construction method, and its applications. This is achieved by integrating and inserting a gene encoding β-1,3-acetylglucosyltransferase into chassis cell host cells. lgtA Encoding β-1,4-galactosyltransferase lgtB Gene, encoding UDP-glucose 4-isomerase gene galE and the gene encoding α2,6-sialyltransferase PdST A metabolic pathway for the synthesis of sialyllactose-N-tetrasaccharide c was constructed. Further optimization of the precursor CMP-Neu5Ac synthesis pathway in chassis host cells was performed to increase the production of sialyllactose-N-tetrasaccharide c and reduce the accumulation of precursors LNnT, LNTII, and the byproduct 6'-SL. Furthermore, the inhibitory effect caused by the intracellular accumulation of high concentrations of sugar products was reduced by adding a sugar efflux transporter gene.

[0025] Using Escherichia coli BL21(DE3) as the chassis host cell, insertion / overexpression was performed in its genome. galE, lgtA, lgtB and PdST Genes were developed to construct the synthetic pathway for sialyl lactose-N-tetrasaccharide c. Furthermore, the synthesis of the precursor CMP-Neu5Ac, used for synthesizing sialyl lactose-N-tetrasaccharide c, can be further enhanced in chassis host cells through insertion / overexpression in the host cell genome. neuA, neuB and neuC To achieve, and / or insert / overexpress in the host cell genome GNA1, yqaB and age This provides a new pathway for the synthesis of CMP-Neu5Ac. To reduce the influence of side-branch metabolic pathways in the host cell genome, knockout of the chassis host cell genome... lacZ, wecB and ugdSimilarly, the synthetic pathway of the precursor CMP-Neu5Ac can be optimized, such as by knocking out CMP-Neu5Ac from the host cell genome. nagA, nagB, nanA, nanE, nanT and nanK To optimize the metabolic pathway for the synthesis of the sialyl lactose-N-tetrasaccharide C precursor CMP-Neu5Ac.

[0026] In some embodiments of the present invention, *Escherichia coli* BL21(DE3) is used as the chassis host cell, and the β-galactosidase gene in its genome is knocked out by λ-Red gene editing. lacZ (ID: 8181469), UDP-acetylglucosamine 2-isomerase gene wecB (ID: 8182212), UDP-glucose-6-dehydrogenase gene ugd (ID: 8182577), N-acetylglucosamine-6-phosphate deacetylase gene nagA (ID: 8180190), glucose-6-phosphate deaminase gene nagB (ID:8180191), N-acetylneuraminic acid hydrolase gene nanA (ID: 8180860), N-acylglucosamine-6-phosphate diacetyl isomerase gene nanE (ID: 8180858), Sialic acid transporter gene nanT (ID: 8180859) and N-acylmannosamine kinase gene nanK (ID: 8180857). The above genes can be knocked out in any order, either partially or entirely, preferably all of the above types of genes.

[0027] In addition, the UDP-glucose 4-isomerase gene, a precursor for the synthesis of sialyl lactose-N-tetrasaccharide c, was inserted into its genome. galE (ID: 945354), β-1,3-acetylglucosyltransferase lgtA ( Pasteurella multocida Source, ID: 77208143), β-1,4-galactosyltransferase lgtB ( P. multocida Source (ID: 77206459); insert genes related to the synthesis of CMP-Neu5Ac, the precursor of sialyl lactose-N-tetrasaccharide c, and N-acylneuraminic acid cytidine transferase gene into its genome. neuA (ID: 4494210), N-acetylneuraminic acid synthase neuB (ID: 4494211), UDP-acetylglucosamine N-acetyl isomerase neuC(ID: 4494209); The glucosamine-N-acetyltransferase gene, a gene related to the novel CMP-Neu5Ac synthetic pathway, was inserted into its genome. GNA1 (ID: 9140689), Fructose-1-phosphate phosphatase gene yqaB (ID: 945776) and N-acylglucosamine 2-isomerase age (ID: 15044898). This led to the construction of a complete pathway for the synthesis of sialyllactose-N-tetrasaccharide c.

[0028] Furthermore, the integration of species-derived components into the host genome Serratia sp. Glycoexisting transporter gene setS (ID: 57665493), which facilitates the outflow and transport of sugar.

[0029] α2,6-Sialyltransferase genes have a crucial impact on the efficiency of sialyl lactose-N-tetrasaccharide (SLT) synthesis. After enzyme screening, genes integrated into the host genome from, but not limited to, the following sources were identified. Photobacterium phosphoreum、 Photobacterium damselae, Photobacterium carnosum, Photobacterium kishitanii, Photobacterium leiognathi, Shewanella xiamenensis, Aeromonas caviae, Aeromonas bivalvium, Vibrio chemaguriensis, Vibrio parahaemolyticus or Enterovibrio baiacu The α2,6-sialyltransferase genes of various species can improve the synthesis efficiency of sialyl lactose-N-tetrasaccharide c to varying degrees.

[0030] In some embodiments of the present invention, the gene encoding α2,6-sialyltransferase is included. PdST The codon-optimized nucleotide sequence is shown in SEQ ID No. 1; encoding setS The codon-optimized nucleotide sequence of the gene is shown in SEQ ID No. 2.

[0031] SEQ ID No.1

[0032]

[0033] SEQ ID No.2:

[0034]

[0035] In gene editing of *Escherichia coli* BL21(DE3), the λ-Red two-step homologous recombination method was used to knock out or integrate relevant genes. The specific steps are as follows: First, the pKD46 plasmid (containing gentamicin resistance) was transformed into *Escherichia coli* BL21(DE3) to induce recombinase expression, followed by two-step homologous recombination. Before homologous recombination, overlap extension PCR was used to remove the chloramphenicol resistance gene (…). cat ) and sucrose-sensitive gene ( sacB ) fusion obtained catsacB Fragment. In the first step of homologous recombination, a fragment containing homologous arms at both ends of the gene to be knocked out is designed. catsacB Primers, PCR to obtain homologous arms catsacB Fragments, converted through electric shock catsacB The fragment is introduced into E. coli to replace the gene to be knocked out. catsacB Fragments were successfully integrated using chloramphenicol-gentamicin dual antibiotic plate screening. catsacB Single colonies of recombinant gene fragments. In the second step, homologous recombination, a gene fragment to be inserted containing homologous arms at both ends of the gene to be knocked out was designed. The resulting gene fragment was introduced into correctly identified recombinant *E. coli* via electroporation transformation, and unsuccessful replacements were initially ruled out using sucrose-containing medium. catsacB Recombinant E. coli fragments were again excluded from successful replacement using chloramphenicol-gentamicin dual-antibiotic agar plates and gentamicin single-antibiotic agar plate photocopying methods. catsacB The recombinant E. coli fragments were identified by PCR. Finally, the strains that were correctly identified by PCR were sequenced to ensure the successful knockout or integration of the relevant genes and to obtain the correct target strain.

[0036] The second step, homologous recombination, involves integrating a strong promoter and RBS sequence. Overlap extension PCR is used to fuse the strong promoter, RBS sequence, and inserted gene fragment (the construction order is promoter-RBS-gene fragment). For example, in overexpressed genes... galE, lgtB and PdST Using the J23119 starter, neuC Using the J23104 starter, yqab Using the J23100 promoter, the RBS sequences are all located 7 bp before the overexpressed gene and 30 bp after the promoter. Strong promoter sequences (J23119, J23100, and J23104) are shown in SEQ ID No. 3-5, and the DNA sequences of the RBS sequences are shown in SEQ ID No. 6.

[0037] SEQ ID No.3: J23119: TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC

[0038] SEQ ID No.4: J23100:TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC

[0039] SEQ ID No.5: J23104: TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGC

[0040] SEQ ID No.6 AGGAGGA

[0041] Following the above method, gene editing of the *Escherichia coli* BL21(DE3) genome was performed using a λ-Red homologous recombination-based approach. Using *Escherichia coli* BL21(DE3) as the starting strain, knockout was performed... lacZ Genes, and integrate at this site lgtA-lgtB Gene; knockout wecB Genes, and integrate and overexpress at this site. galE Gene; knockout ugd Genes, and integrate and overexpress at this site. neuA-neuB-neuC Gene; knockout nagA Genes, and integrate and overexpress at this site. neuB Gene; knockout nagB Genes, and integrate and overexpress at this site. neuC Gene; knockout nanA Genes, and integrate at this site GNA1-yqaB-age Gene; knockout nanE Genes, and integrate and overexpress at this site. GNA1-yqaB Gene; knockout nanT Genes, and integrate at this site setS Gene; knockout nanK Genes, and integrate and overexpress at this site. PdST The gene was eventually used to obtain recombinant E. coli capable of synthesizing sialyl lactose-N-tetrasaccharide c.

[0042] The production of sialyl-lactose-N-tetrasaccharide c was increased and the contents of precursors LNnT and LNTII, as well as the byproduct 6'-SL, were reduced by inserting genes related to the synthesis of sialyl-lactose-N-tetrasaccharide c into the *E. coli* genome, inserting selected glycosyltransferases, adding new precursor synthesis pathways, and increasing intracellular sugar efflux. The constructed recombinant *E. coli* strain can be used for the efficient production of sialyl-lactose-N-tetrasaccharide c, and a fermentation system based on recombinant *E. coli* capable of synthesizing sialyl-lactose-N-tetrasaccharide c was established. The fermentation system uses glycerol as the main carbon source and lactose as the fermentation substrate to synthesize sialyllactose-N-tetrasaccharide c. Optimized DM medium was used for fermentation, with the following formulation: KH₂PO₄ 13-15 g / L, (NH₄)₂HPO₄ 1-2 g / L, citric acid 2.5-3 g / L, peptone 2-3 g / L, yeast extract 4-5 g / L, glycerol 15-20 g / L, magnesium sulfate heptahydrate 1.3-1.7 g / L, and trace elements 6-10 ml / L. The trace element formulation was: zinc sulfate hydrate 2.25 g / L, ferrous sulfate 10 g / L, manganese sulfate monohydrate 0.35 g / L, anhydrous copper sulfate 1.0 g / L, sodium borate decahydrate 0.23 g / L, calcium chloride dihydrate 2.0 g / L, and ammonium molybdate 0.11 g / L.

[0043] In this study, a 5L fermenter containing 2L of DM medium was used to ferment the constructed recombinant Escherichia coli strain. The fermentation medium consisted of: tryptone 2 g / L, yeast extract 4 g / L, glycerol 15–20 g / L, potassium dihydrogen phosphate 10–13.5 g / L, diammonium hydrogen phosphate 3.0–5.0 g / L, citric acid 1.0–2.0 g / L, magnesium sulfate heptahydrate 1.0–2.0 g / L, and trace element solution 5–10 ml / L. First, single colonies from streaked agar plates were transferred to vials for shaker incubation. After overnight incubation, the entire bacterial culture in the vials was transferred to fermentation flasks containing 150 mL of DM medium for further incubation. The culture was continued until the bacterial density reached OD500. 600 When the bacterial culture reaches level 2, all the bacterial culture is transferred to a 5L fermenter and incubated at 37℃ until the bacterial cell density (OD) reaches level 2. 600When the pH reaches 15, lactose is added to the fermenter, and the culture temperature is adjusted to 30℃. During fermentation, the fermenter is periodically fed with 10 g / L lactose and 20 g / L glycerol every 12 hours. Concentrated ammonia is added during fermentation to maintain the pH of the liquid within the tank between 6.8 and 7.2. The aeration rate is set at 3 vvm to 7 vvm, and the stirring speed at 250-850 r / min. In shake flask and fermenter experiments, if the strain contains a pET plasmid, the corresponding antibiotic and IPTG inducer are added; otherwise, no antibiotics or IPTG are added. The optimal recombinant *E. coli* produced 1.972 g / L sialyl-lactose-N-tetrasaccharide c in shake flask fermentation, accounting for approximately 90% of the total HMO produced; in a 5L fermenter experiment, it produced 20.3 g / L sialyl-lactose-N-tetrasaccharide c, accounting for approximately 95% of the total HMO produced. These results demonstrate that the recombinant strain has a higher capacity to produce sialyl lactose-N-tetrasaccharide C while generating fewer byproducts, providing a foundation for further scientific research and industrial production.

[0044] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described are performed according to the respective product instructions. Unless otherwise specified, all instruments, reagents, and consumables used in the examples can be purchased from commercial companies. The plasmids, PCR enzymes, column-based DNA extraction kits, DNA gel recovery kits, and bacterial genome extraction kits used in the examples are operated according to the instructions within the kits. Colony PCR, agarose gel electrophoresis, electroporation, and preparation of competent cells are performed according to standard operating procedures. Plasmid construction was completed by the company, and DNA product sequencing and PCR primer synthesis were completed by BGI Genomics.

[0045] Example 1: Construction of a recombinant Escherichia coli strain that efficiently synthesizes sialyl lactose-N-tetrasaccharide C

[0046] 1.1 Gene knockout and integration in the Escherichia coli genome

[0047] To knock out lacZ Taking genes as an example, design primers lacZ-csB-F / R The primers contain 60bp homologous nucleotide arms at both ends of the gene to be knocked out, and contain... catsacB Using the plasmid fragment as a template, PCR amplification was performed. lacZ-catsacB Fragments were obtained by agarose gel electrophoresis and gel recovery. lacZ-catsacB Excerpt.

[0048] The PCR system consisted of: 25 μL of premixed high-fidelity enzyme, 1.5 μL of forward primer, 1.5 μL of reverse primer, 2 μL of genomic or plasmid template, and the remaining volume was prepared into 50 μL using ddH2O. The PCR program was as follows: 94 ℃ pre-denaturation for 2 min; 98 ℃ denaturation for 10 s, 55 ℃ extension for 30 s, 68 ℃ annealing for 30 s / kb, for 35 cycles; 68 ℃ final extension for 10 min, and incubation at 4 ℃.

[0049] Competent cells of *Escherichia coli* were prepared, and 0.5% arabinose was added to induce λ-Red recombinase expression. The pKD46 plasmid carrying the recombinase gene was introduced into *E. coli* via electroporation.

[0050] Competent cells of *E. coli* containing the pKD46 plasmid were prepared, and λ-Red recombinase expression was induced by adding 0.5% arabinose. The expression was then performed via electroporation. lacZ-catsacB The fragment was introduced into *E. coli*, and the transformed bacterial culture was added to 1 mL of 2YT resuscitation medium. After incubation at 30 °C for 2 hours on a shaker, the fragment was plated on a chloramphenicol-gentamicin dual antibiotic plate and incubated overnight at 30 °C to obtain and successfully replace the original genome. lacZ Recombinant Escherichia coli.

[0051] To integrate lgtA-lgtB Taking genes as an example, design primers lacZ-up-F / R, lacZ-down-F / R Using the BL21(DE3) genome as a template, PCR amplification was performed. lacZ-up and lacZ-down Fragment, primer design lgtA-lgtB-F / R The company synthesized the carrier lgtA-lgtB Using the gene plasmid as a template, PCR amplification was performed. lgtA-lgtB The fragments were then ligated together using overlap PCR, agarose gel electrophoresis, and gel recovery to obtain the desired fragments. up-lgtA-lgtB-down The fragment, PCR system, and procedure are the same as described above.

[0052] Preparation containing catsacB The competent cells of fragmented *E. coli* were induced to express λ-Red recombinase by adding 0.5% arabinose, and the spliced ​​recombinase was then converted by electroporation. up-lgtA-lgtB-down The fragment was introduced into *E. coli*, and the transformed bacterial culture was added to 1 mL of 2YT resuscitation medium. After resuscitation at 30 °C for 2 h on a shaker, the entire bacterial culture was poured into sucrose-free LB flasks and incubated overnight at 30 °C. Preliminary screening for bacteria without sucrose pressure was conducted. catsacB Recombinant E. coli fragments. Overnight sucrose-free LB vials were serially diluted and plated on gentamicin monotherapy plates. Single colonies were selected and further screened using chloramphenicol-gentamicin dual-antibiotic plate and gentamicin monotherapy plate replication methods to identify those lacking [the desired bacterial count].catsacB Recombinant E. coli fragments to achieve successful lgtA Genes are integrated into the genome and replaced catsacB Recombinant E. coli fragments were extracted and identified by PCR. Single colonies of the correctly identified recombinant E. coli were sequenced to ensure successful knockout or integration of the relevant genes, resulting in the correct target strain, named E1.

[0053] 1.2 Addition of strong promoters in the Escherichia coli genome

[0054] To integrate and overexpress galE Taking genes as an example, follow step 1.1 to knock out genes in the genome. wecB Genes. In construction galE When reassembling fragments, the fragments are composed of... wecB Upstream homologous arm, strong promoter, galE Genes and wecB The downstream homologous arm fragments were used to connect the four fragments together via overlap extension PCR. The resulting recombinant E. coli single colonies were sequenced to ensure successful knockout or integration of the relevant genes, thus obtaining the correct target strain.

[0055] 1.3 Construction of recombinant Escherichia coli

[0056] The gene editing methods in steps 1.1 and 1.2 were used to sequentially knock out E. coli BL21(DE3). lacZ, wecB, ugd, nagA, nagB, nanA, nanE, nanT, nanK Genes, and sequentially integrated into the genome for expression. lgtA, lgtB, galE, neuA, neuB, neuC, GNA1, yqaB, age, setS, PdST The gene was extracted, and finally, the pKD46 plasmid was eliminated at 37°C to obtain the final production strain. The specific steps are as follows:

[0057] Starting with BL21(DE3), the β-galactosidase gene was knocked out. lacZ And at this site, the β-1,3-acetylglucosamine transferase gene and the β-1,4-galactosyltransferase gene are integrated. lgtA-lgtB Strains were obtained, and strain E1 was obtained. Based on strain E1, the UDP-acetylglucosamine 2-isomerase gene was knocked out. wecB The UDP-glucose 4-epimerase gene is integrated and overexpressed at this site. galE Strains were obtained as strain E2; based on strain E2, the UDP-glucose-6-dehydrogenase gene was knocked out. ugd And at this site, the N-acylneuraminic acid cytidine transferase gene, the N-acetylneuraminic acid synthase gene, and the UDP-acetylglucosamine N-acetyl isomerase gene are integrated. neuA-neuB-neuC Strains were obtained, and strain E3 was obtained. Based on strain E3, the N-acetylglucosamine-6-phosphate deacetylase gene was knocked out.nagA And at this site, the N-acetylneuraminic acid synthase gene is integrated and overexpressed. neuB Strains were obtained, and the glucose-6-phosphate deaminase gene was knocked out from strain E4. nagB The UDP-acetylglucosamine N-acetyl isomerase gene is integrated and overexpressed at this site. neuC Strains were obtained, and strain E5 was obtained. Based on strain E5, the N-acetylneuraminic acid hydrolase gene was knocked out. nanA And at this site, the glucosamine-N-acetyltransferase gene, fructose-1-phosphate phosphatase gene, and N-acylglucosamine 2-isomerase gene are integrated. GNA1- yqaB-age Strains were obtained, and strain E6 was obtained. Based on strain E6, the N-acylglucosamine-6-phosphate diacetyl isomerase gene was knocked out. nanE Furthermore, at this site, the glucosamine-N-acetyltransferase gene and the fructose-1-phosphate phosphatase gene are integrated and overexpressed. GNA1-yqaB Strains were obtained, and strain E7 was obtained. Based on strain E7, the sialic acid transporter gene was knocked out. nanT And integrate a sugar efflux transporter gene at this site. setS Strains were obtained as strain E8; based on strain E8, the N-acylmannosamine kinase gene was knocked out. nanK The α2,6-sialyltransferase gene is integrated and overexpressed at this site. PdST Strains E9 were obtained. The compositions of strains E1-E9 are shown in Table 1, and the primers used to construct each strain are shown in Table 2.

[0058] Table 1. Construction of different strains

[0059]

[0060] Table 2. Primer sequences

[0061]

[0062] Example 2: Analysis of the ability of recombinant Escherichia coli to produce sialyl lactose-N-tetrasaccharide C

[0063] As with the E1-E9 strains prepared in Example 1, a metabolic pathway for producing sialyl lactose-N-tetrasaccharide c precursor was initially established in the recombinant strains E1-E3. A complete pathway for producing sialyl lactose-N-tetrasaccharide c was established by adding pET plasmids containing the basic α2,6-sialyl transferase gene sequence to the recombinant strains E4-E8. The effects of gene knockout, integration, and overexpression on the yield of sialyl lactose-N-tetrasaccharide c were further tested.

[0064] The E4-E9 recombinant strains constructed in Example 1 were subjected to shake-flask fermentation and fermenter culture, respectively. In the fermenter culture, each recombinant strain was transferred to the fermentation medium at a 5% inoculum and cultured at 37°C and 180 rpm. The fermentation medium composition was as follows: 2 g / L tryptone, 4 g / L yeast extract, 20 g / L glycerol, 13.5 g / L potassium dihydrogen phosphate, 1.4 g / L diammonium hydrogen phosphate, 1.7 g / L citric acid, 1.5 g / L magnesium sulfate heptahydrate, and 10 ml / L trace element solution. When the OD value of the culture medium reached 12, 10 g / L lactose was added, followed by the addition of 10 g / L lactose and 20 g / L glycerol every 12 hours, for a total fermentation time of 72 hours. The trace element solution contains: zinc sulfate heptahydrate 2.25 g / L, ferrous sulfate 10 g / L, manganese sulfate monohydrate 0.35 g / L, anhydrous copper sulfate 1.0 g / L, sodium borate decahydrate 0.23 g / L, calcium chloride dihydrate 2.0 g / L, and ammonium molybdate 0.11 g / L.

[0065] To analyze the fermentation results, the fermentation broth was centrifuged at 12,000 rpm for 5 min, and the supernatant was sterilized by passing it through a 0.22 μm aqueous filter membrane. A 940 Professional ICV Vario ion chromatograph equipped with a Hamilton RCX-30 anion exchange column (7 μm, 4.6 × 250 mm, PN: 79877) was used to detect the content of sialyl lactose-N-tetrasaccharide c. A gradient elution mode was used for the mobile phase: phase A consisted of 150 mM sodium hydroxide + 25 mM sodium acetate, and phase B consisted of 200 mM sodium hydroxide + 100 mM sodium acetate. An amperometric detector was used; the column temperature was controlled at 60 °C; and the injection volume was 10 μL. After fermentation, the fermentation broth was collected and processed to quantitatively analyze the yields of the target product sialyl lactose-N-tetrasaccharide c, as well as the precursors LNTII and LNnT, and the byproduct 6'-SL.

[0066] The expression of recombinant E. coli strains E4-E9 producing sialyl lactose-N-tetrasaccharide c in shake-flask fermentation is as follows: Figure 2 As shown, from Figure 2Data from E4 to E9 show that the yield of sialyl lactose-N-tetrasaccharide c in recombinant *E. coli* was significantly increased (1.972 g / L), while the fermentation broth contained its precursors LNnT 0.046 g / L and LNTⅡ 0.087 g / L, and the byproduct 6'-SL content was only 0.013 g / L. Figure 4 The figure shows the dynamic changes and growth curves of sialyl-lactose-N-tetrasaccharide c, its precursors LNTII and LNnT, and the byproduct 6'-SL produced by strain E9 in a 5L fermenter. The figure shows that the recombinant engineered bacteria continuously consume the substrates glycerol and lactose. With increasing OD values, the expression level of the target compound sialyl-lactose-N-tetrasaccharide c significantly increases. The fermentation broth contains extremely low levels of precursors LNnT (0.34 g / L), LNTII (0.23 g / L), and the byproduct 6'-SL (only 0.18 g / L), demonstrating that the constructed recombinant *E. coli* can efficiently produce sialyl-lactose-N-tetrasaccharide c and reduce the production of precursors LNnT, LNTII, and the byproduct 6'-SL.

[0067] Example 3: Effects of α2,6-sialyltransferases from different sources on recombinant Escherichia coli that efficiently synthesizes sialyl-lactose-N-tetrasaccharide C

[0068] To screen for enzymes that have a key impact on the efficiency of sialyl lactose-N-tetrasaccharide c synthesis, a systematic enzyme screening and evaluation of α2,6-sialyltransferase was conducted.

[0069] Multiple α2,6-sialyltransferase genes from different sources were selected from public databases such as NCBI, including those from... Photobacterium phosphoreum, Photobacterium damselae, Photobacterium carnosum, Photobacterium kishitanii, Photobacterium leiognathi, Shewanella xiamenensis , Aeromonas caviae, Aeromonas bivalvium, Vibrio chemaguriensis, Vibrio parahaemolyticus as well as Enterovibrio baiacu Candidate genes from various species, with sequence similarity of 70% to 80%, were selected. These genes underwent codon optimization based on E. coli preferences, and the entire genome was synthesized by the company.

[0070] The optimized α2,6-sialyltransferase genes were cloned into the expression vector pET to construct a series of recombinant plasmids. These recombinant plasmids were then transformed into the intermediate recombinant Escherichia coli E8 strain constructed in Example 1. This strain's genome already possesses the basic metabolic pathway for the synthesis of sialyl lactose-N-tetrasaccharide c, but it lacks the necessary α2,6-sialyltransferase activity for the production of sialyl lactose-N-tetrasaccharide c. This step was used to express and test the production effects of α2,6-sialyltransferases from different sources.

[0071] Shake-flask fermentation and fermenter culture experiments were conducted on each test strain to determine the yield of sialyl lactose-N-tetrasaccharide c from different strains. Fermentation conditions were the same as in Example 2. After fermentation, samples were taken and the yields of sialyl lactose-N-tetrasaccharide c, its precursors LNnT and LNTⅡ, and the byproduct 6'-SL were determined by HPLC. The results are as follows: Figure 3 As shown, the expression originates from P. damselae α2,6-sialyltransferase gene PdST The recombinant strain exhibited the highest sialyl lactose-N-tetrasaccharide C synthesis capacity, reaching a yield of 20.3 g / L in fermenter culture experiments, while the accumulation of the byproduct 6'-SL was the lowest, at only 0.013 g / L, which was significantly better than enzymes from other sources.

[0072] The embodiments of the present invention have been described in detail above, but the content described is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. A synthetic sialic acid lactose- N Recombinant Escherichia coli with tetrasaccharide C, characterized by: Gene editing of the genome of *Escherichia coli* BL21(DE3) was performed using λ-Red homologous recombination. Starting with BL21(DE3), the gene was knocked out... β -Galactosidase gene lacZ and integrate at this site β -1,3-acetylglucosamine transferase gene, β -1,4-galactosyltransferase gene lgtA-lgtB strain E1 was obtained; Based on strain E1, the UDP-acetylglucosamine 2-isomerase gene was knocked out. wecB The UDP-glucose 4-epimerase gene is integrated and overexpressed at this site. galE Strains were obtained as strain E2; based on strain E2, the UDP-glucose-6-dehydrogenase gene was knocked out. ugd And at this site, the N-acylneuraminic acid cytidine transferase gene, the N-acetylneuraminic acid synthase gene, and the UDP-acetylglucosamine N-acetyl isomerase gene are integrated. neuA-neuB-neuC Strains were obtained, and strain E3 was obtained. Based on strain E3, the N-acetylglucosamine-6-phosphate deacetylase gene was knocked out. nagA And at this site, the N-acetylneuraminic acid synthase gene is integrated and overexpressed. neuB strain E4 was obtained; Based on strain E4, the glucose-6-phosphate deaminase gene was knocked out. nagB The UDP-acetylglucosamine N-acetyl isomerase gene is integrated and overexpressed at this site. neuC strain E5 was obtained; Based on strain E5, the N-acetylneuraminic acid hydrolase gene was knocked out. nanA And at this site, the glucosamine-N-acetyltransferase gene, fructose-1-phosphate phosphatase gene, and N-acylglucosamine 2-isomerase gene are integrated. GNA1-yqaB-age Strains were obtained, and strain E6 was obtained. Based on strain E6, the N-acylglucosamine-6-phosphate diacetyl isomerase gene was knocked out. nanE Furthermore, at this site, the glucosamine-N-acetyltransferase gene and the fructose-1-phosphate phosphatase gene are integrated and overexpressed. GNA1-yqaB strain E7 was obtained; Based on strain E7, the sialic acid transporter gene was knocked out. nanT And integrate a sugar efflux transporter gene at this site. setS strain E8 was obtained; Based on strain E8, the N-acylmannosamine kinase gene was knocked out. nanK The α2,6-sialyltransferase gene is integrated and overexpressed at this site. PdST The strain E9 was found to synthesize sialyl lactose efficiently. N Recombinant Escherichia coli with tetrasaccharide C; Among them, β-galactosidase gene lacZ The sequence is shown in ID: 8181469, UDP-acetylglucosamine 2-isomerase gene. wecB The sequence is shown in ID: 8182212, UDP-glucose-6-dehydrogenase gene. ugd The sequence is shown in ID: 8182577, N-acetylglucosamine-6-phosphate deacetylase gene. nagA The sequence is shown in ID: 8180190, glucose-6-phosphate deaminase gene. nagB The sequence is shown in ID: 8180191, N-acetylneuraminic acid hydrolase gene. nanA The sequence is shown in ID: 8180860, N-acylglucosamine-6-phosphate diacetyl isomerase gene. nanE The sequence is shown in ID: 8180858, sialic acid transporter gene. nanT The sequence is shown in ID: 8180859 and the N-acylmannosamine kinase gene. nanK The sequence is shown in ID: 8180857; UDP-glucose 4-isomerase gene galE The sequence is shown in ID: 945354, β-1,3-acetylglucosyltransferase lgtA The sequence is shown in ID: 77208143, β-1,4-galactosyltransferase lgtB The sequence is shown in ID: 77206459, N-acylneuraminidine cytidine transferase gene. neuA The sequence is shown in ID: 4494210, N-acetylneuraminic acid synthase. neuB The sequence is shown in ID: 4494211, UDP-acetylglucosamine N-acetyl isomerase. neuC The sequence is shown in ID:4494209, glucosamine-phospho-N-acetyltransferase gene. GNA1 The sequence is shown in ID: 9140689, fructose-1-phosphate phosphatase gene. yqaB The sequence is shown in ID: 945776, N-acylglucosamine 2-isomerase. age The sequence is shown as ID:15044898; Gene encoding α2,6-sialyltransferase PdST The codon-optimized nucleotide sequence, as shown in SEQ ID No. 1, encodes a gene for a sugar efflux transporter. setS The codon-optimized nucleotide sequence of the gene is shown in SEQ ID No.

2.

2. A type of sialic acid lactose- N The method for preparing -tetrasaccharide C is characterized by: The synthetic sialic acid lactose according to claim 1 N Recombinant Escherichia coli containing tetrasaccharide C was prepared.

3. The sialic acid lactose according to claim 2 N The method for preparing -tetrasaccharide C is characterized by: Recombinant Escherichia coli was cultured in shake flasks. The shake flask fermentation medium included 13-15 g / L KH2PO4, 1-2 g / L (NH4)2HPO4, 2.5-3 g / L citric acid, 2-3 g / L peptone, 4-5 g / L yeast extract, 15-20 g / L glycerol, 1.3-1.7 g / L magnesium sulfate heptahydrate, and 6-10 ml / L trace elements. Alternatively, recombinant *E. coli* can be fermented in a fermenter based on the shake-flask culture system. The seed culture used in the fermenter consists of: 2 g / L tryptone, 4 g / L yeast extract, 15–20 g / L glycerol, 10–13.5 g / L potassium dihydrogen phosphate, 3.0–5.0 g / L diammonium hydrogen phosphate, 1.0–2.0 g / L citric acid, 1.0–2.0 g / L magnesium sulfate heptahydrate, and 5–10 ml / L trace element solution. After inoculation, the culture is carried out at 37°C and 180 rpm until OD reaches 10000. 600 When the temperature reaches 12 h, add 10 g / L lactose, and then add 10 g / L lactose and 20 g / L glycerol every 12 h, and culture for 72 h.

Images