Preparation method and application of autonomic ganglion organoid

Abstract

The invention discloses a preparation method and application of autonomic ganglion organoid, and relates to the technical field of biology. The method comprises the following steps: 1) providing neural crest stem cells; 2) differentiating the neural crest stem cells into autonomic ganglion-like organs through the combined action of added external factors and internal factors; wherein the external factors comprise a bFGF (basic fibroblast growth factor), an IGF-1 (insulin-like growth factor), a BDNF (brain-derived neurotrophic factor), a GDNF (brain-derived neurotrophic factor), an NGF (nerve growth factor), an NT-3, an EGF (epidermal growth factor), Forskolin, a DAPT (diaminopropyltriethoxysilane), an insulin, a Transferrin, an Activin A and a BMP4 (bone morphogenetic protein 4); the addition of the intrinsic factors is that the following four transcription factors, namely Ascl1, Hand2, Phox2a and Phox2b, are overexpressed in the neural crest stem cells at the same time. The organoid prepared by the scheme contains various neurons similar to the autonomic ganglion in vivo, Schwann glial cells and satellite glial cells. The prepared autonomic ganglion organoid can be applied to research on development regulation of autonomic ganglions and occurrence and development mechanisms of various human diseases, development of therapeutic drugs and the like.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing and applying an autonomic ganglion organoid. Background Technology

[0002] Organoid technology provides a platform, tools, and cell sources for studying tissue and organ development regulation, disease pathogenesis, drug development, and cell transplantation therapy. Organoids can be obtained through three main pathways: differentiation from pluripotent stem cells, differentiation from adult stem cells, and reassembly or reprogramming of somatic cells. Organoid chips can also be obtained through organ-on-a-chip technology. The peripheral nervous system originates from neural crest stem cells (NCCs) during its development, which have the potential to differentiate into a range of tissues, including intestinal and sensory neurons, glial cells, melanocytes, and chondrocytes.

[0003] As early as 2003, Mizuseki et al. discovered that embryonic stem cells, when co-cultured with PA6 cells, could differentiate into Nestin+ neural progenitor cells. The addition of BMP4 in the later stage caused the cells to differentiate into NCCs and could continue to differentiate into peripheral neurons (see Mizuseki, K., T. Sakamoto, K. Watanabe, K. Muguruma, M. Ikeya, A. Nishiyama, A. Arakawa, H. Suemori, N. Nakatsuji, H. Kawasaki, et al., Generation of neural crest-derived peripheral neurons and floor plate cells from mouse and primate embryonic stem cells. Proceedings of the National Academy of Sciences, 2003. 100(10): 5828-5833.).

[0004] In 2016, by adding small molecule inhibitors and morphogenetic BMP4 to the culture medium, Oh et al. differentiated human pluripotent stem cells into sympathetic neurons (see Oh, Y., G.-S. Cho, Z. Li, I. Hong, R. Zhu, M.-J. Kim, Yong J. Kim, E. Tampakakis, L. Tung, R. Huganir, et al., Functional Coupling with Cardiac Muscle Promotes Maturation of hPSC-Derived Sympathetic Neurons. Cell Stem Cell, 2016. 19(1): 95-106.).

[0005] Li et al. used intrinsic factors to overexpress seven transcription factors to reprogram mouse astrocytes and human / mouse fibroblasts into noradrenergic neurons (see Li, S., Y. Shi, X. Yao, X. Wang, L. Shen, Z. Rao, J. Yuan, Y. Liu, Z. Zhou, Z. Zhang, et al., Conversion of Astrocytes and Fibroblasts into Functional Noradrenergic Neurons. Cell Rep, 2019. 28(3): 682-697 e7.).

[0006] Frith et al. differentiated human pluripotent stem cells into somatic NCCs, which possessed the ability to further differentiate into sympathetic neurons (see Frith, TJR, I. Granata, M. Wind, E. Stout, O. Thompson, K. Neumann, D. Stavish, PR Heath, D. Ortmann, JOS Hackland, et al.). Human Axial progenitors generate trunk neural crest cells in vitro. eLife, 2018. 7:e35786.).

[0007] Liu et al. used a combination of three transcription factors (Ascl1, Phox2a or Phox2b, Hand2, abbreviated as APH) to reprogram mouse embryonic fibroblasts into autonomic ganglion organoids containing autonomous neurons (see Liu, S., K. Xiang, F. Yuan, and M. Xiang, Generation of self-organized autonomic ganglion organoids from fibroblasts. iScience, 2023. 26(3): 106241.). They also applied for a related patent (a method for reprogramming fibroblasts into autonomic ganglion organoids, patent application number: CN202210924977.7, application date: 2022-08-02).

[0008] Takayama et al. employed a stepwise induction method. In the first step, they induced human pluripotent stem cells (NCCs) into NCCs by activating the WNT signaling pathway while simultaneously inhibiting the BMP and TGFβ signaling pathways. In the second step, by continuing to activate the WNT signaling pathway while simultaneously inhibiting the TGFβ signaling pathway, sympathetic and parasympathetic neurons were generated after 11 days. After three weeks of continuous culture, the cells gradually matured, forming interconnected cell clusters after 52 days (see Takayama, Y., H. Kushige, Y. Akagi, Y. Suzuki, Y. Kumagai, and YS Kida, Selective Induction of Human Autonomic Neurons Enables Precise Control of Cardiomyocyte Beating. Scientific Reports, 2020.10(1): 9464. and Takayama, Y., Y. Akagi, and YS Kida, Deciphering the Molecular Mechanisms of Autonomic Nervous System Neuron Induction through Integrative Bioinformatics Analysis. Int J Mol Sci, 2023). 24(10).).

[0009] The aforementioned laboratories, by adding extrinsic factors or overexpressing key intrinsic factors, simulated the in vivo developmental trajectory of NCCs, enabling them to differentiate NCCs into autonomic neurons or autonomic ganglion organoids in vitro. However, they all employed a single approach using either extrinsic or intrinsic factors. Therefore, their approaches have several drawbacks, leading to: 1) lower maturity of the final peripheral neurons; 2) the inability to form organoid cell clusters; and 3) most importantly, their approaches fail to form glial cells, resulting in significant differences in cellular composition and function compared to in vivo autonomic ganglia.

[0010] For example, in Oh et al.'s scheme, the cells were mixed with sensory neurons, had low cell maturity, and existed mostly in discrete forms, making it difficult to form large cell clusters. Liu et al.'s scheme could only act on mouse embryonic fibroblasts to form organoid cell clusters. None of the published schemes could form cell clusters containing glial cells (Schwann and SGCs), thus failing to simulate real autonomic ganglia. Summary of the Invention

[0011] To address the technical problems existing in the prior art, embodiments of the present invention provide a method for preparing and applying autonomous ganglion organoids. The technical solution is as follows:

[0012] A method for preparing an autonomic ganglion organoid, the method comprising:

[0013] 1) Provide neural crest stem cells;

[0014] 2) By adding the combined effects of external and internal factors, the neural crest stem cells are differentiated into autonomic ganglion organoids;

[0015] The extrinsic factors include: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, EGF, Forskolin, DAPT, insulin, Transferrin, Activin A, and BMP4;

[0016] The addition of intrinsic factors involves the simultaneous overexpression of the following four transcription factors in the neural crest stem cells: Ascl1, Hand2, Phox2a, and Phox2b.

[0017] Optionally, step 2) includes the following steps:

[0018] (1) The following four transcription factors are simultaneously overexpressed in the neural crest stem cells: Ascl1, Hand2, Phox2a and Phox2b, to obtain cells overexpressing the genes;

[0019] (2) The overexpressing gene cells obtained in step (1) are placed in the first stage neuron induction medium for first stage culture. The first stage neuron induction medium contains basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF and DAPT. The basal medium includes DMEM / F-12 and B27.

[0020] (3) The cells obtained in step (2) are placed in the second stage neuron induction medium for second stage culture. The second stage neuron induction medium contains basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, Forskolin and Activin A. The basal medium includes DMEM / F-12 and B27.

[0021] (4) The cells obtained in step (3) are placed in the third-stage neuron induction medium for third-stage culture. The third-stage neuron induction medium contains basal medium and the following extrinsic factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, EGF, Forskolin, insulin, Transferrin, and BMP4. The basal medium includes DMEM / F-12, B27, and non-essential amino acids.

[0022] Optionally, step (1) includes the following steps: introducing transcription factors Ascl1, Hand2, Phox2a and Phox2b into neural crest stem cells to obtain cells overexpressing the genes;

[0023] And / or, the introduction is carried out by constructing lentiviral vectors, adeno-associated virus vectors, plasmid vectors or lipid vectors expressing the four transcription factors respectively, and then introducing them together into the neural crest stem cells;

[0024] And / or, the sequence of the transcription factor Ascl1 is shown in SEQ ID No. 1 or SEQ ID No. 2, the sequence of the transcription factor Hand2 is shown in SEQ ID No. 3 or SEQ ID No. 4, the sequence of the transcription factor Phox2a is shown in SEQ ID No. 5 or SEQ ID No. 6, and the sequence of the transcription factor Phox2b is shown in SEQ ID No. 7 or SEQ ID No. 8.

[0025] Optionally, in step (2), the first stage of cultivation lasts for 3 days;

[0026] And / or, in the first-stage neuron induction medium, each 50 mL contains:

[0027] DMEM / F-12: 49ml; 1×B27: 1ml; bFGF: 10ng / ml; IGF-1: 100ng / ml; BDNF: 10ng / ml; GDNF: 10ng / ml and DAPT: 10μM.

[0028] Optionally, in step (3), the second stage of cultivation lasts for 7-12 days;

[0029] And / or, in the second-stage neuron induction medium, each 50 mL contains:

[0030] DMEM / F-12: 49ml; 1×B27: 1ml; bFGF: 10ng / ml; IGF-1: 100ng / ml; BDNF: 10ng / ml; GDNF: 10ng / ml; NGF: 20ng / ml; NT-3: 20ng / ml; Forskolin: 10μM and Activin A: 25ng / ml or 125ng / ml;

[0031] And / or, in the second stage of culture, the neurons are first cultured for 3 days in a second-stage neuronal induction medium containing 25 ng / ml Activin A; then the concentration of Activin A is changed to 125 ng / ml, and the culture is continued for another 3 days.

[0032] Optionally, in step (4), the third stage of cultivation lasts for 15 days or more;

[0033] And / or, in the third-stage neuron induction medium, each 50 mL contains:

[0034] DMEM / F-12: 46.5 ml; 1×B27: 1 ml; Non-essential amino acids: 200 μM; bFGF: 10 ng / ml; IGF-1: 100 ng / ml; BDNF: 10 ng / ml; GDNF: 10 ng / ml; NGF: 20 ng / ml; NT-3: 20 ng / ml; EGF: 10 ng / ml; Forskolin: 10 μM; insulin: 25 μg / ml; Transferrin: 100 μg / ml and BMP4: 15 ng / ml.

[0035] The autonomic ganglion organoids obtained by the preparation method described above include autonomic neurons, Schwann glial cells, and satellite glial cells.

[0036] The aforementioned autonomic ganglion organoids are used in methods for studying the developmental regulation of autonomic ganglia, methods for studying the mechanisms of disease occurrence and development, and in screening and preparing therapeutic drugs.

[0037] A neural crest stem cell that simultaneously overexpresses the following four transcription factors: Ascl1, Hand2, Phox2a, and Phox2b;

[0038] And / or, the neural crest stem cells are prepared by introducing transcription factors Ascl1, Hand2, Phox2a and Phox2b into the neural crest stem cells;

[0039] And / or, the introduction is carried out by constructing lentiviral vectors, adeno-associated virus vectors, plasmid vectors or lipid vectors expressing the four transcription factors respectively, and then introducing them together into the neural crest stem cells;

[0040] And / or, the sequence of the transcription factor Ascl1 is shown in SEQ ID No. 1 or SEQ ID No. 2, the sequence of the transcription factor Hand2 is shown in SEQ ID No. 3 or SEQ ID No. 4, the sequence of the transcription factor Phox2a is shown in SEQ ID No. 5 or SEQ ID No. 6, and the sequence of the transcription factor Phox2b is shown in SEQ ID No. 7 or SEQ ID No. 8.

[0041] A culture medium for preparing autonomic ganglion organoids, said culture medium being selected from at least one of the following three culture media:

[0042] (1) The first stage neuron induction medium contains a basal medium and the following extrinsic factors: bFGF, IGF-1, BDNF, GDNF and DAPT, wherein the basal medium includes DMEM / F-12 and B27;

[0043] (2) The second-stage neuron induction medium contains a basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, Forskolin and Activin A, wherein the basal medium includes DMEM / F-12 and B27;

[0044] (3) The third-stage neuron induction medium contains a basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, EGF, Forskolin, insulin, Transferrin, and BMP4, wherein the basal medium includes DMEM / F-12, B27, and non-essential amino acids;

[0045] And / or, each 50 mL of the neuron induction medium in the first stage contains: DMEM / F-12: 49 mL; 1×B27: 1 mL; bFGF: 10 ng / mL; IGF-1: 100 ng / mL; BDNF: 10 ng / mL; GDNF: 10 ng / mL and DAPT: 10 μM;

[0046] And / or, the second-stage neuron induction medium contains per 50 mL: DMEM / F-12: 49 mL; 1×B27: 1 mL; bFGF: 10 ng / mL; IGF-1: 100 ng / mL; BDNF: 10 ng / mL; GDNF: 10 ng / mL; NGF: 20 ng / mL; NT-3: 20 ng / mL; Forskolin: 10 μM; and Activin A: 25 ng / mL or 125 ng / mL.

[0047] And / or, the third-stage neuron induction medium contains, per 50 mL: DMEM / F-12: 46.5 mL; 1×B27: 1 mL; non-essential amino acids: 200 μM; bFGF: 10 ng / mL; IGF-1: 100 ng / mL; BDNF: 10 ng / mL; GDNF: 10 ng / mL; NGF: 20 ng / mL; NT-3: 20 ng / mL; EGF: 10 ng / mL; Forskolin: 10 μM; insulin: 25 μg / mL; Transferrin: 100 μg / mL; and BMP4: 15 ng / mL.

[0048] The beneficial effects of the technical solutions provided in the embodiments of the present invention include at least the following:

[0049] This invention provides a novel technical solution utilizing a combination of external and internal factors to successfully reprogram human pluripotent stem cells into autonomic ganglion organoids. The prepared organoids contain various neurons, Schwann glial cells, and satellite glial cells similar to those found in in vivo autonomic ganglia. This overcomes the shortcomings of existing techniques, such as immature neurons, inability to form aggregated organoids, and the absence of glial cells in the organoids. The autonomic ganglion organoids prepared by this invention can be applied to research on the developmental regulation of autonomic ganglia, the mechanisms of various human diseases, and the development of therapeutic drugs. Attached Figure Description

[0050] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0051] Figure 1 This is an image provided in Embodiment 3 of the present invention demonstrating the successful acquisition of neural crest stem cells from human pluripotent stem cells; wherein, Figure 1 The diagram in Figure A shows the neural crest stem cells obtained from human pluripotent stem cells. Figure 1 Figure B is a diagram that validated the high expression of the specific molecular markers Sox10, NGFR, and TFAP2A in the obtained NCCs using real-time quantitative PCR; Figure 1 Image C is an immunofluorescence image showing the high expression of specific molecular markers TFAP2A, B3GAT1, NGFR, and SOX9 in NCCs cells;

[0052] Figure 2 This is a diagram of the maturation of autonomic ganglion organoids provided in Embodiment 3 of the present invention, wherein, Figure 2 A is a schematic diagram of the preparation method of the present invention; Figure 2 Figure B is a schematic diagram of reprogramming NCCs into autonomic ganglion organoids; Figure 2 Figure C shows the morphological changes of NCCs and the gradual emergence and maturation of autonomic ganglion organoids in the control and experimental groups after transfection with the virus.

[0053] Figure 3 This is a diagram of the organoid expression marker molecules provided in Embodiment 3 of the present invention, wherein... Figure 3 Figures A through D represent the levels of the following marker molecules expressed in organoids of the control and experimental groups: neurons (TUBB3, MAP2), sympathetic neurons (SLC6A2 / 3, SLC18A2, TH), serotonergic neurons (SSTR1), parasympathetic neurons (CHAT, CHRNA3 / A5 / B4), glutamatergic neurons (GRIN1, SLC1A1, SLC17A6), serotonergic neurons (HTR3A, HTR5A), GABAergic neurons (GABRA1, GAD2), and peptidergic neurons (VIPR2, CHGA, VIP). Figure 3Figures E to V in the diagram represent molecular markers for organoid expression of various neuronal types, including general neurons (TUBB3, MAP2, RBFOX3, PRPH, VBAMP1 / 2 / 3, SYN1), sympathetic neurons (TH, DBH, SLC8A3, NTRK1), parasympathetic neurons (NTRK3, CHAT), GABAergic neurons (GABA, GAD2), glutamatergic neurons (SLC17A6), serotonergic neurons (SST), and peptidergic neurons (VIP, NPY).

[0054] Figure 4 This is a graph showing the bulk RNA-seq analysis and protein level verification results provided in Example 3 of this invention; wherein, Figure 4 Figures A through C show the experimental results of bulk RNA-seq analysis; Figure 4 The graph from D to O represents the validation results of protein expression levels in cells;

[0055] Figure 5 This is a diagram showing the experimental results for testing neurons provided in Embodiment 3 of the present invention; wherein, Figure 5 Figure A shows the experimental steps for testing neurons; Figure 5 The diagram from B to C shows the sodium-potassium currents of neurons; Figure 5 Figures D to E show the ability of neurons to fire single-peak or multi-peak action potentials under current-clamp stimulation. Figure 5 The graph in F shows the ratio of multi-peaked action potentials to single-peaked action potentials in mature neurons. Figure 5 The graph in G shows the results of resting membrane potential, membrane capacitance, and membrane resistance for immature and mature neurons. Figure 5 The diagram from H to I shows how the action potentials of autonomic neurons can be reversibly blocked by TTX. Detailed Implementation

[0056] The technical solution of the present invention will now be described with reference to the accompanying drawings.

[0057] In this invention, the definitions of abbreviations, English terms, and key terms are listed below:

[0058] Autonomic ganglia: Ganglia composed of peripheral autonomic neurons, Schwann cells, satellite glial cells, fibroblasts, etc., mainly including sympathetic ganglia, parasympathetic ganglia, and gastrointestinal ganglia.

[0059] Organoids: tissue and organ analogs produced in vitro that partially or completely mimic the corresponding tissues and organs in vivo in terms of cellular composition, structure, and function.

[0060] Extrinsic factors are factors added to the culture medium, expressed outside the cell, that can interact with the cell through receptor ligands, enter the cell through channels, or act on the cell through the cell matrix. They can directly or indirectly affect cell proliferation, function, differentiation, and cell fate determination. These factors include growth factors, chemokines, morphogens, and chemical factors, and can be organic or inorganic.

[0061] Intrinsic factors are factors expressed within cells that influence cellular functions such as transcription, translation, and enzyme activity through interactions between proteins, nucleic acids, etc., thereby affecting cell proliferation, function, differentiation, and fate determination. Among these, transcription factors are generally considered to be the most important in fate determination.

[0062] Differentiation: The process by which stem cells, progenitor cells, or precursor cells gradually develop different morphologies and functions through a series of gene expression and changes, ultimately forming various types of cells.

[0063] During tissue development, the developmental direction of NCCs is jointly regulated by intrinsic and extrinsic factors. In terms of cellular composition, autonomic ganglia consist of various subtypes of autonomic neurons, Schwann cells, satellite glial cells (SGCs), fibroblasts, vascular endothelial cells, and pericytes. Among these, glial cells, especially Schwann and SGCs, are crucial for ganglion development and function, and are indispensable components.

[0064] The inventors have discovered that during in vivo development, both intrinsic and extrinsic factors must coexist and function to form a functional peripheral nervous system, including the development and function of autonomic ganglia. This invention utilizes a four-factor (AHP2ab) intrinsic factor reprogramming scheme. Therefore, this invention employs the aforementioned combined scheme integrating intrinsic and extrinsic factors.

[0065] This invention utilizes the combined effects of extrinsic and intrinsic factors to differentiate neural crest stem cells (NCCs) into autonomic ganglion organoids containing different types of autonomic neurons (e.g., sympathetic and parasympathetic neurons), Schwann cells, and satellite glial cells (SGCs). These organoids closely resemble in vivo organs, containing mature autonomic neurons of various types, Schwann glial cells, and satellite glial cells, and can be used to study the developmental regulation of autonomic ganglia, disease pathogenesis, and drug development.

[0066] Obtaining neural crest stem cells is a mature technology in this field and is well known to those skilled in the art. For example, human pluripotent stem cells can be first converted into neural crest stem cells.

[0067] There are various ways to deliver intrinsic factors. This scheme takes lentiviral vectors as an example, but it can also be achieved through other vector forms, including but not limited to other viral vectors (retroviral vectors, adeno-associated virus vectors, etc.), lipid vectors (various transfected lipid vectors, nanoliposomes, etc.), transposons, overexpression plasmids, messenger ribonucleic acid, etc.

[0068] The key technical point of this invention lies in the two-step method of reprogramming human pluripotent stem cells into autonomic ganglion organoids. Specifically, it employs a technical approach combining extrinsic and intrinsic factors to reprogram neural crest stem cells (NCCs) into autonomic ganglion organoids. This includes, for example, using culture media containing different formulations of extrinsic factors (growth factors, morphogenetics, small molecule inhibitors and activators of signaling pathways, etc.) at different time periods, and using a four-factor (AHP2ab) intrinsic factor reprogramming scheme.

[0069] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0070] Unless otherwise specified, the experimental methods described in the following embodiments are all conventional experimental methods well known to those skilled in the art. Where the experimental methods do not specify specific conditions, they are usually carried out in accordance with conventional techniques or conditions described in the literature in this field or in accordance with the product instructions.

[0071] Unless otherwise specified, all materials and reagents described in the following examples are commercially available.

[0072] Example 1

[0073] 1. Molecular cloning and lentivirus preparation

[0074] (1) Full-length codon reading frames of Ascl1 (mouse NM_008553.5, human NM_004316.4), Hand2 (mouse NM_010402.4, human NM_021973.3), Phox2a (mouse NM_008887.2, human NM_005169.4), and Phox2b (mouse NM_008888.4, human NM_003924.4) were amplified from mouse cDNA libraries or human cDNA libraries using a high-fidelity enzyme (purchased from Quanshijin Company, model AS122-1). The construction methods for mouse cDNA libraries and human cDNA libraries are routine experimental methods well-known to those skilled in the art. For example, the specific steps may be as follows: extract total RNA from cells or tissues, and perform reverse transcription using reverse transcriptase to obtain a library containing single-stranded cDNA. The methods for amplifying the full-length codon reading frames of Ascl1, Hand2, Phox2a, and Phox2b are also routine experimental methods well known to those skilled in the art; for example, refer to the instruction manual for high-fidelity enzymes.

[0075] The inventors tested mouse cDNA libraries and human cDNA libraries respectively, and the final results showed that the two achieved the same technical effect.

[0076] The sequence of mouse NM_008553.5 is as follows:

[0077] atggagagctctggcaagatggagagtggagccggccagcagccgcagcccccgcagcccttcctgcctcccgcagcctgcttctttgcgaccgcggcggcggcggcagcggcggcggccgcggcagctcagagcgcgcagcagcaacagccgcaggcgccgccgcagcaggcgccgcagctgagcccggtggccgacagccagccctcagggggcggtcacaagtcagcggccaagcaggtcaagcgccagcgctcgtcctctccggaactgatgcgctgcaaacgccggctcaacttcagcggcttcggctacagcctgccacagcagcagccggccgccgtggcgcgccgcaacgagcgcgagcgcaaccgggtcaagttggtcaacctgggttttgccaccctccgggagcatgtccccaacggcgcggccaacaagaagatgagcaaggtggagacgctgcgctcggcggtcgagtacatccgcgcgctgcagcagctgctggacgagcacgacgcggtgagcgctgcctttcaggcgggcgtcctgtcgcccaccatctcccccaactactccaacgacttgaactctatggcgggttctccggtctcgtcctactcctccgacgagggatcctacgaccctcttagcccagaggaacaagagctgctggactttaccaactggttctga (SEQ ID No.1).

[0078] The sequence of human NM_004316.4 is as follows:

[0079] atggaaagctctgccaagatggagagcggcggcgccggccagcagccccagccgcagccccagcagcccttcctgccgcccgcagcctgtttctttgccacggccgcagccgcggcggccgcagccgccgcagcggcagcgcagagcgcgcagcagcagcagcagcagcagcagcagcagcagcaggcgccgcagctgagaccggcggccgacggccagccctcagggggcggtcacaagtcagcgcccaagcaagtcaagcgacagcgctcgtcttcgcccgaactgatgcgctgcaaacgccggctcaacttcagcggctttggctacagcctgccgcagcagcagccggccgccgtggcgcgccgcaacgagcgcgagcgcaaccgcgtcaagttggtcaacctgggctttgccacccttcgggagcacgtccccaacggcgcggccaacaagaagatgagtaaggtggagacactgcgctcggcggtcgagtacatccgcgcgctgcagcagctgctggacgagcatgacgcggtgagcgccgccttccaggcaggcgtcctgtcgcccaccatctcccccaactactccaacgacttgaactccatggccggctcgccggtctcatcctactcgtcggacgagggctcttacgacccgctcagccccgaggagcaggagcttctcgacttcaccaactggttctga (SEQ ID No.2).

[0080] The sequence of mouse NM_010402.4 is as follows:

[0081] atgagtctggtggggggctttccccaccaccccgtggtgcaccatgagggctacccattcgccgcagccgccgccgccgctgccgccgccgccgccagccgctgcagccacgaggagaacccctacttccacggctggcttattggccacccggagatgtcgccccccgactacagtatggccctgtcctacagccccgagtacgccagcggtgccgcgggcctggaccactcccattatgggggagtgccgcccggcgccgggcctcccggcctgggggggccgcgcccggtgaagcgccggggcaccgccaaccgcaaggagcggcgcaggactcagagcatcaacagcgccttcgccgagctgcgcgagtgcatccccaacgtgcccgccgacaccaaactctccaagatcaagacactgcgcctggccaccagctacatcgcctacctcatggatctgctggccaaggacgaccagaacggagaggcggaggccttcaaggcggagatcaagaagaccgacgtgaaagaggagaagaggaagaaagagctgaatgagatcttgaaaagcacagtgagcagcaacgacaagaaaaccaaaggccggacaggctggccacagcacgtctgggccctggagctcaagcagtga (SEQ ID No.3).

[0082] The sequence of human NM_021973.3 is as follows:

[0083] atgagtctggtaggtggttttccccaccacccggtggtgcaccacgagggctacccgtttgccgccgccgccgccgcagctgccgccgccgccgccagccgctgcagccatgaggagaacccctacttccatggctggctcatcggccaccccgagatgtcgccccccgactacagcatggccctgtcctacagccccgagtatgccagcggcgccgccggcctggaccactcccattacgggggggtgccgccgggcgccgggcccccgggcctgggggggccgcgcccggtgaagcgccgaggcaccgccaaccgcaaggagcggcgcaggactcagagcatcaacagcgccttcgccgaactgcgcgagtgcatccccaacgtacccgccgacaccaaactctccaaaatcaagaccctgcgcctggccaccagctacatcgcctacctcatggacctgctggccaaggacgaccagaatggcgaggcggaggccttcaaggcagagatcaagaagaccgacgtgaaagaggagaagaggaagaaggagctgaacgaaatcttgaaaagcacagtgagcagcaacgacaagaaaaccaaaggccggacgggctggccgcagcacgtctgggccctggagctcaagcagtga (SEQ ID No.4).

[0084] The sequence of mouse NM_008887.2 is as follows:

[0085] atggactactcctacctcaattcgtacgattcgtgcgtggcggccatggaggcgtccgcctacggtgacttcggcgcctgcagccagcctggaggcttccaatacagtcccctgcggcctgccttccccgccgctgggccaccttgccccgcgctcggctcctccaactgtgcgcttggcgccctacgcgaccaccagcccgcaccctactcggcagttccctacaagttcttcccggagccgtccggcctgcatgagaagcgcaagcagcggcgcatccgcacaacgttcacgagtgctcagctcaaggagttggagcgcgtcttcgccgagacccactaccccgacatttacactcgcgaggaactggcgctcaagatcgacctcactgaggctcgcgtgcaggtctggttccagaaccgccgggccaagttccgcaaacaggagcgcgcggccagcgccaaaggcgcggcgggagcgacgggcgccaaaaagggcgaggcgcgttgctcgtcggaggacgacgactccaaggagtccacgtgcagccccacgcccgacagcaccgcgtcgctgccgccgccgcctgcacccagcctggccagcccgcgtctgagccccagccctctgcccgccgcgctgggctccgggcccgggccccagccgctcaagggagcgttgtgggcaggggtggcgggcggtggaggtggcggccccggcacgggcgcagcggagctgcttaaggcctggcagccggcggaacccgggccaggtcccttctctggagttctgtcctcctttcaccggaagcccggccccgccctgaagacaaacctcttctag (SEQ ID No.5).

[0086] The sequence of human NM_005169.4 is as follows:

[0087] atggactactcctacctcaattcgtacgactcgtgcgtggcggccatggaggcgtccgcctacggcgactttggcgcctgcagccagcccggcggcttccaatacagccccctgcggcccgctttccccgcggcagggccgccctgccccgcgctcggctcctccaactgcgcacttggcgccctacgcgaccaccagcccgcgccctactcggcagtgccctacaagttcttcccagagccatccggcctgcacgagaagcgcaagcagcggcgcatccgcaccacgttcaccagcgcgcagctcaaggagctggagcgcgttttcgctgagacccactaccccgacatttacacgcgtgaggagctggcgctcaagatcgacctcactgaggctcgcgtgcaggtctggttccagaaccgccgggccaagttccgcaaacaggagcgcgcggccagcgccaagggcgcggcgggcgcggcgggcgccaaaaagggcgaggcgcgctgctcctccgaggacgacgattccaaggagtccacgtgcagccccacgcccgatagcaccgcctcgctgccgccgccgcctgcgcccggcctggccagcccgcgcctgagccccagcccgctgcccgtcgcactgggctccgggccgggacctgggccggggccacagccgctcaagggcgcactgtgggccggtgtggcgggcggtgggggcggcgggcctggcgcgggagcggccgaactacttaaggcttggcagccggcggagtccggccccgggcccttctccggggttctgtcctcctttcaccggaagcccggccccgccctgaagaccaatctcttctag (SEQ ID No.6).

[0088] The sequence of mouse NM_008888.4 is as follows:

[0089] atgtataaaatggaatattcttacctcaattcctctgcctacgagtcctgtatggccgggatggatacctccagcttggcttcagcatatgcagacttcagttcctgcagccaggccagtggcttccagtataacccgataaggaccacttttggggccacgtccggttgcccgtccctcacgccgggatcctgcagcctgggcaccctcagggaccaccagagcagtccgtacgccgcagttccatacaaactcttcaccgaccacggcggcctcaacgagaaacgcaagcagcggcgcatccgcaccaccttcacaagcgcgcagctcaaagagttggagagggtcttcgctgagacgcactaccctgacatctacaccagggaagagctagcactgaagatcgacctcaccgaggcgagagtccaggtgtggttccagaaccgccgggctaagtttcgcaagcaggagcgcgcagccgccgctgctgccgccgccgccaaaaacggctcctccgggaagaagtctgactcctcccgggacgacgagagcaaagaggccaagagcactgatcccgacagcactgggggcccgggacccaaccccaacccgacccccagctgtggggcaaatggcggcggtggcggagggcccagcccagccggagctccgggggcggcgggcccggggggcccgggaggcgaacccggcaagggcggtgcggctgcggctgctgctgcagctgcagcggctgcagcggcggctgcggctgcggcggcgggaggcctggctgcggccggaggccccggacaaggctgggctcctggcccgggccccatcacctccatcccagattctcttggggggcccttcgccagcgtcttatcttcgctccaaagacccaacggtgccaaagccgccttagtgaagagcagtatgttctga(SEQ ID No.7)。

[0090] The sequence of human NM_003924.4 is as follows:

[0091] atgtataaaatggaatattcttacctcaattcctctgcctacgagtcctgtatggctgggatggacacctcgagcctggcttcagcctatgctgacttcagttcctgcagccaggccagtggcttccagtataacccgataaggaccacttttggggccacgtccggctgcccttccctcacgccgggatcctgcagcctgggcaccctcagggaccaccagagcagtccgtacgccgcagttccttacaaactcttcacggaccacggcggcctcaacgagaagcgcaagcagcggcgcatccgcaccactttcaccagtgcccagctcaaagagctggaaagggtcttcgcggagactcactaccccgacatctacactcgggaggagctggccctgaagatcgacctcacagaggcgcgagtccaggtgtggttccagaaccgccgcgccaagtttcgcaagcaggagcgcgcagcggcagccgcagcggccgcggccaagaacggctcctcgggcaaaaagtctgactcttccagggacgacgagagcaaagaggccaagagcactgacccggacagcactgggggcccaggtcccaatcccaaccccacccccagctgcggggcgaatggaggcggcggcggcgggcccagcccggctggagctccgggggcggcggggcccgggggcccgggaggcgaacccggcaagggcggcgcagcagcagcggcggcggccgcggcagcggcggcggcggcagcggcagcggcggcagctggaggcctggctgcggctgggggccctggacaaggctgggctcccggccccggccccatcacctccatcccggattcgcttgggggtcccttcgccagcgtcctatcttcgctccaaagacccaacggtgccaaagccgccttagtgaagagcagtatgttctga(SEQ ID No.8)。

[0092] (2) The human Sox2 gene in the Fuw-teto-hSOX2 (Addgene #20724) vector was removed by enzyme digestion with EcoRI (purchased from NEB, #B7006). The sequences of transcription factors Ascl1 (as shown in SEQ ID No.1 or SEQ ID No.2), Hand2 (as shown in SEQ ID No.3 or SEQ ID No.4), Phox2a (as shown in SEQ ID No.5 or SEQ ID No.6), and Phox2b (as shown in SEQ ID No.7 or SEQ ID No.8) were cloned into the Fuw-teto vector obtained above to obtain the target plasmid.

[0093] All cloned sequences were validated using Sanger sequencing.

[0094] (3) Lentiviral packaging plasmids (pMDLg / pRRE, pRSV-Rev, and pMD2.G) and tet-on activation plasmids (used to activate gene expression after the addition of Dox) (FUW-M2RTTA) were derived from Addgene (#12251, #12253, #12259, and #20342), respectively. Through testing by the inventors, other types of lentiviral vectors and packaging plasmids in the prior art (e.g., Takara's Lenti-X™ Tet-One™ Inducible Expression System, #631844) can achieve the same purpose, without depending on a specific viral vector or packaging plasmid type.

[0095] HEK-293T cells (ATCC #CRL-3216) were cultured and maintained in a normal medium consisting of (per 50 ml): 44 ml DMEM (Gibco), 5 ml FBS (fetal bovine serum, Gibco), 500 µl NEAA (Gibco), and 500 µl penicillin-streptomycin (Gibco). When cells reached 80% confluence in 10 cm culture dishes, they were transfected using a plasmid mixture (2.5 µg pRSV-Rev, 5 µg pMDLg / pRRE, 2.5 µg pMD2.G, 10 µg target plasmids (Ascl1 / Hand2 / Phox2a / Phox2b plasmids), 30 µl Neofect (Beijing Codey Co., Ltd.), and 500 µl opti-MEM medium (Gibco).

[0096] After incubating at 37℃ for 16 hours, the culture medium was switched to normal. The culture supernatant was collected 24 hours later, and this process was repeated for two consecutive days. Cell debris was removed by centrifugation at 4000 rpm for 15 minutes. The supernatant was then transferred to clean centrifuge tubes and centrifuged at 5000 rpm for 30 minutes to remove most of the supernatant, leaving a small amount of bottom supernatant. The supernatant was then mixed thoroughly with a pipette tip, aliquoted, and stored at -80℃ for later use.

[0097] The obtained Ascl1 lentivirus, Hand2 lentivirus, Phox2a lentivirus, Phox2b lentivirus and M2RTTA lentivirus were titered and mixed in a molar ratio of 1:1:1:1:1 to obtain Ascl1+Hand2+Phox2a+Phox2b (AHP2ab) lentivirus, which was used for transfection.

[0098] 2. Differentiating human pluripotent stem cells into neural crest stem cells (NCCs).

[0099] Obtaining neural crest stem cells is a mature technique in the prior art, as can be seen in the following literature: Chloé A. Paka, William B. Barrell, Anne H. Monsoro-Burq, Karen J. Liu, Chapter 6 - Differentiation of human-induced pluripotent stem cells to the neural crestlineage, Editor(s): Alexander Birbrair, In Advances in Stem Cell Biology, Current Progress in iPSC-derived Cell Types, Academic Press, Volume 10, 2021, Pages 117-147, ISBN 9780128238844. This embodiment of the invention uses the differentiation of human pluripotent stem cells into neural crest stem cells; however, those skilled in the art will understand that neural crest stem cells obtained by other methods in the field can also achieve the objectives of this invention, and the invention is not limited to this specific method.

[0100] The specific steps for obtaining neural crest stem cells are as follows:

[0101] Human embryonic pluripotent stem cells H9 were purchased from WiCell (#WA09) and maintained and cultured in ncEpic hPSC Medium (Nuwacell #RP01001).

[0102] H9 cells were digested with Accutase (purchased from Thermofisher #A1110501) and then dispersed into single-cell suspensions. These suspensions were then analyzed using Neural Crest Differentiation Medium (STEMdiff). TM Resuspend in the Neural Crest DifferentiationKit (Stemcell Technologies #08610).

[0103] The 6-well plate was pre-coated with MatriGel (Corning #354277), with approximately 2 × 10⁶ cells per well. 6 Add 2 mL of Neural Crest Differentiation Medium containing 10 µM Y-27632 (Selleck #S1049) to each cell. After one day, replace the medium with Neural Crest Differentiation Medium excluding Y-27632 and culture continuously for 6 days. Once the cells reach 95% confluence, they can be passaged in 2 mL of Neural Crest Differentiation Medium. Neural crest stem cells passaged 2 or 3 times can be used as seed cells for differentiating autonomic ganglion organoids.

[0104] Example 2: Differentiating human NCCs into autonomic ganglion organoids

[0105] 1. The 12-well plates were pre-coated with 15 µg / mL poly-L-ornithine (Sigma), 10 µg / mL fibronectin (Sigma), and 1 µg / mL laminin (Sigma).

[0106] Neural crest stem cells (NCCs) were produced at a rate of 6 × 10⁻⁶. 5 10 cells / well seeded into a pre-coated 12-well plate;

[0107] 2. On the second day, the Neural Crest Differentiation Medium (purchased from Stemcell Technologies) was replaced; the Ascl1+Hand2+Phox2a+Phox2b (referred to as the AHP2ab four-factor scheme) lentivirus prepared in Example 1 was added to the medium, and 5 µg / ml polybrene (purchased from Sigma) was added to promote transfection; after 16 hours of transfection, the medium was replaced with Neuron Stage I Medium; this day was marked as day 0.

[0108] Table 1. Components of Neuron Stage I Medium (50 mL)

[0109]

[0110] Among them, DMEM / F-12 is available from Gibco; 1×B27 refers to 1x B27, available from Gibco; bFGF refers to fibroblast growth factor 2, available from Thermofisher; IGF-1 refers to insulin-like growth factor 1, available from MedChemExpress; BDNF refers to brain-derived neurotrophic factor, available from MedChemExpress; GDNF refers to glial cell-derived neurotrophic factor, available from MedChemExpress; Dox refers to doxycycline, available from Sigma; DAPT refers to γ-secretase inhibitor, available from MedChemExpress.

[0111] 3. On day 3, the culture medium was changed to Neuron Stage II Medium, to which 25 ng / mL ACTIVINA was added;

[0112] Table 2. Components of Neuron Stage II Medium (50 mL)

[0113]

[0114] NGF refers to nerve growth factor, which can be purchased from MedChemExpress; NT-3 refers to neurotrophic factor 3, which can be purchased from Sigma; and Forskolin refers to forskolin, which can be purchased from Sigma.

[0115] 4. On day 6, the culture medium was changed to Neuron Stage II Medium, which was supplemented with 125 ng / mL ACTIVINA (activin A, purchased from MedChemExpress).

[0116] 5. On day 9, change the culture medium to Neuron Stage II Medium; change the culture medium every 2-3 days. Nerve cells will aggregate into clusters, and nerve fibers will connect the cell clusters, gradually forming autonomic ganglion organoids;

[0117] 6. On day 15, change the culture medium to Neuron Stage III Medium and add 15 ng / ml BMP4 (bone morphogenetic protein 4, purchased from MedChemExpress); thereafter, change the Neuron Stage III Medium every 2-3 days, but do not add BMP4.

[0118] Table 3. Components of Neuron Stage III Medium (50 mL)

[0119]

[0120] Transferrin is a protein that can be purchased from Sigma-Aldrich; insulin is a protein that can be purchased from Sigma-Aldrich; EGF is an epidermal growth factor that can be purchased from MedChemExpress; and AA is a non-essential amino acid that can be purchased from Gibco.

[0121] 7. After day 30, the cells in the autonomic ganglion organoids gradually mature and can be used for subsequent experiments.

[0122] Example 3: Cellular composition and functional verification of autonomic ganglion organoids

[0123] The inventors used techniques such as real-time quantitative PCR, immunofluorescence staining, and bulk RNA-seq to identify the autonomic ganglion organoids prepared in Example 2.

[0124] 1. Validation of the high expression of specific molecular markers Sox10, NGFR, and TFAP2A in NCCs using real-time quantitative PCR.

[0125] The specific steps of real-time quantitative PCR are as follows: extract total RNA from tissues and reverse transcribe it into single-stranded cDNA; design specific PCR primers, use cDNA as a template, and perform quantification using a real-time fluorescence quantitative PCR kit (purchased from Quanshijin Company); use 2...-ΔΔT Calculate the differences in gene expression levels.

[0126] Experimental results:

[0127] See the experimental results. Figure 1 This embodiment first demonstrates the successful acquisition of neural crest stem cells (NCCs) from human pluripotent stem cells. Figure 1 The diagram in Figure A shows how neural crest stem cells were obtained from human pluripotent stem cells.

[0128] Figure 1 Figure B is a diagram that validated the high expression of the specific molecular markers Sox10, NGFR, and TFAP2A in NCCs using real-time quantitative PCR. From Figure 1 As can be seen in B, human pluripotent stem cells are transformed into NCCs. Similarly, at the protein level, Figure 1 The image in section C is an immunofluorescence image showing that almost all NCCs cells highly express the specific molecular markers TFAP2A, B3GAT1, NGFR, and SOX9. From... Figure 1 As can be seen from the data in the middle section, almost all human pluripotent stem cells were reprogrammed into NCCs.

[0129] These results demonstrate that hPSCs were successfully differentiated into NCCs.

[0130] 2. Morphological changes of NCCs after transfection in the control group (NCC+GFP virus) and the experimental group (NCC+AHP2ab virus).

[0131] After transfection with the virus, the morphology of the cells in the control group (NCC+GFP virus) and the experimental group (NCC+AHP2ab virus) was photographed under a microscope.

[0132] Experimental results:

[0133] See the experimental results. Figure 2 . Figure 2 Figure A is a schematic diagram of the two-step method of this invention. The first step, differentiating hPSCs into NCCs, has already been... Figure 1 The process from A to C is demonstrated. In the second step, through different culture media and lentivirus induction, NCCs are reprogrammed into mature autonomic ganglion organoids. Figure 2 The Chinese B-type reprogramming scheme utilizes lentiviruses carrying the four key factors Ascl1+Hand2+Phox2a+Phox2b (abbreviated as AHP2ab) to reprogram NCCs into autonomic ganglion organoids. Figure 2 The image shows the morphological changes in NCCs and the gradual emergence and maturation of autonomic ganglion organoids in the control group (NCC+GFP virus) and the experimental group (NCC+AHP2ab virus) after viral transfection. Figure 2As can be seen from the results in C, the combination of AHP2ab and external factors reprograms NCCs into interconnected ganglion organoids.

[0134] 3. Identification of molecular markers at the transcriptional level for autonomic ganglion organoids.

[0135] The study was divided into four groups: control group, GFP virus transfection group, three-factor transfection group (Ascl1+Hand2+Phox2a and Ascl1+Hand2+Phox2b, respectively), and experimental four-factor (AHP2ab) transfection group.

[0136] The marker molecules expressed by the following neurons were detected in each of the above groups: TUBB3, MAP2; sympathetic neurons (SLC6A2 / 3, SLC18A2, TH); serotonergic neurons (SSTR1); parasympathetic neurons (CHAT, CHRNA3 / A5 / B4); glutamatergic neurons (GRIN1, SLC1A1, SLC17A6); serotonergic neurons (HTR3A, HTR5A); GABAergic neurons (GABRA1, GAD2); and peptidergic neurons (VIPR2, CHGA, VIP). The detection methods were as follows: After 20 days of cell culture, total RNA was extracted from all cells in each group and reverse transcribed into cDNA. Specific primer pairs targeting the above genes were designed, and quantitative analysis was performed using real-time quantitative PCR.

[0137] Experimental results:

[0138] See the experimental results. Figure 3 This invention found that the four-factor approach induced the best results in inducing autonomic ganglion organoids in the experimental group. From Figure 3 As shown in Figures A through D, compared to the control group, the experimental group exhibited significantly increased expression of marker molecules for neurons (TUBB3, MAP2), sympathetic neurons (SLC6A2 / 3, SLC18A2, TH), serotonergic neurons (SSTR1), parasympathetic neurons (CHAT, CHRNA3 / A5 / B4), glutamatergic neurons (GRIN1, SLC1A1, SLC17A), serotonergic neurons (HTR3A, HTR5A), GABAergic neurons (GABRA1, GAD2), and peptidergic neurons (VIPR2, CHGA, VIP). These results indicate the presence of multiple sympathetic and parasympathetic neuronal types in the organoids of the experimental group.

[0139] 4. At the protein expression level, organoids were identified using immunofluorescence staining.

[0140] The immunofluorescence staining procedure is as follows: AHP2ab-transfected NCCs are seeded onto a slide, and ganglion organoids are collected after 30 days of differentiation; fresh 4% paraformaldehyde (PFA) is used for fixation for 15 minutes, followed by washing with PBS three times for 5 minutes each time; PBS containing 5% serum is used for blocking at room temperature for 1 hour; specific primary antibody is added and the slide is incubated at 4°C overnight; PBS is used for washing three times for 5 minutes each time; fluorescently labeled secondary antibody and DAPI are added and the slide is incubated at room temperature for 1 hour; after washing three times with PBS, the slide is mounted; and images are acquired under a confocal microscope.

[0141] Experimental results:

[0142] For molecular markers expressing general neuronal types in organoids (TUBB3, MAP2, RBFOX3, PRPH, VBAMP1 / 2 / 3, SYN1), sympathetic neurons (TH, DBH, SLC8A3, NTRK1), parasympathetic neurons (NTRK3, CHAT), GABAergic neurons (GABA, GAD2), glutamatergic neurons (SLC17A6), serotonergic neurons (SST), and peptidergic neurons (VIP, NPY), please refer to [link to relevant documentation]. Figure 3 From E to V. Figure 3 As can be seen from E to V, these different subtypes of autonomic neurons are all present in autonomic ganglion organoids, and the expression levels of specific protein markers are very high.

[0143] 5. Bulk RNA-seq analysis of autonomic ganglion organoids cultured for 35 days.

[0144] The experimental steps for bulk RNA-seq analysis are as follows:

[0145] Total RNA was extracted from organoids cultured for 35 days using the Total Gold High Purity RNA Extraction Kit (#ER501-01-V2). The extracted RNA was quantified and quality-checked using two methods: (1) agarose gel electrophoresis and (2) NanoDrop assay. After the assays, usable RNA of ≥50 ng / μL and ≥2 μg was obtained for subsequent library construction.

[0146] Library construction was performed using the Yeasen Dual-Mode mRNA Library Construction Kit (#12309ES96). The process can be summarized as follows: (1) mRNA was captured and enriched using magnetic beads with polyT; (2) the captured mRNA was fragmented into short segments; (3) one-stranded and two-stranded cDNA were synthesized; (4) adapters were ligated; (5) the ligation products were then purified and fragments screened using the purification and sorting magnetic beads provided in the kit; (6) the ligation products were amplified using the index primer matched to the kit, and then the amplified products were purified and enriched using the purification and sorting magnetic beads provided in the kit; (7) finally, sequencing was performed using the DNBSEQ-T7 sequencer from BGI Genomics or the PE150 mode of the Illumina NovaSeq X plus sequencer. Sequencing results were analyzed using R language software packages (deseq2, etc.).

[0147] The experimental steps for verifying protein levels are basically the same as above. Immunofluorescence staining was used to identify organoids cultured for 35 days.

[0148] Experimental results:

[0149] See the experimental results. Figure 4 The experimental results for bulk RNA-seq analysis can be found in [link to relevant documentation]. Figure 4 From A to C. The results showed that, in addition to a significant increase in mRNA levels associated with the relevant neuron types, the results are shown in [see attached image]. Figure 4 Molecular markers of mid-A, Schwann, and satellite glial cells were also significantly increased; see results below. Figure 4 From B to C. The above results indicate that these two cell types were also induced to differentiate during the reprogramming process.

[0150] See the validation results for protein levels. Figure 4 From D to I. The results confirmed that Schwann cells showed high expression of the marker molecules MBP and MPZ; see [see results]. Figure 4 D to I. Some Schwann cells co-localize with nerve axons and are morphologically similar to mature Schwann cells; see results below. Figure 4 From F to G. Figure 4 As can be seen from E, H, and I, a large number of glial cells were generated during the reprogramming process, including mature Schwann cells, which wrapped around nerve fibers. Figure 4 The J to O sequence indicates the generation of satellite glial cells with the characteristic molecules NPAS3 and PTRRZ1.

[0151] Therefore, it has been confirmed that autonomic ganglion organoids contain various types of autonomic neurons, Schwann cells, and SGC glial cells.

[0152] 6. Neurons in immature autonomic ganglion organoids (days 17-25) or mature (days 25-40) were examined using patch clamps.

[0153] The experimental steps for examining neurons are as follows: autonomic ganglion organoids are cultured for 17-25 days (immature stage) and 35-40 days (mature stage), and autonomic neurons within the organoids are identified using patch clamp. Organoids were transferred to a recording tank and placed on an upright microscope (Olympus BX51WI), immersed in an oxygen-rich solution (140 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM HEPES, 10 mM glucose; pH 7.4) throughout the experiment, with a flow rate controlled at 2 ml / min and a temperature maintained at 30-32 degrees Celsius. The glass microelectrodes were made of 4-8 MΩ borosilicate glass. Before the experiment, the electrodes were filled with an internal electrolyte solution (105 mM K-gluconate, 5 mM KCl, 5 mM NaOH, 15 mM KOH, 0.5 mM CaCl2, 2 mM MgCl2, 5 mM EGTA, 2 mM MgATP, 0.5 mM NaGTP, 10 mM HEPES, and 2 mM L-ascorbic acid; pH 7.2, 280-290 μL). mOsm / L); whole-cell current, membrane capacitance, membrane resistance, membrane potential, action potential, etc. were recorded in cell adsorption mode and whole-cell mode; current changes were observed by adding TTX through the perfusion system.

[0154] Experimental results:

[0155] See the experimental results. Figure 5 The experimental procedures for testing neurons are described in [reference needed]. Figure 5 A. Figure 5 In cells B through C, these neurons were found to have sodium-potassium currents similar to those of normal neurons. Figure 5 Figures D through E show that neurons, under current clamp stimulation, have the ability to fire single-peak or multi-peak action potentials. Figure 5 The study showed that among mature neurons, approximately 10.7% had multi-peaked action potentials, 75% had single-peaked action potentials, and about 14.3% had no action potentials. Figure 5 The study showed that mature neurons are similar to in vivo neurons in terms of resting membrane potential, membrane capacitance, and membrane resistance. Similar to in vivo neurons, Figure 5 The H to I results show that the sodium-potassium current can be blocked by TTX, and can be partially restored after TTX is eluted.

[0156] The above results indicate that these autonomic neurons are similar to mature neurons in vivo in terms of electrophysiology.

[0157] In summary, this invention successfully reprogrammed neural crest stem cells into autonomic ganglion organoids. These organoids contain mature autonomic neurons, as well as Schwann and satellite glial cells.

[0158] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A method for preparing an autonomic ganglion organoid, characterized in that, The method includes: 1) Provide neural crest stem cells; 2) By adding the combined effects of external and internal factors, the neural crest stem cells are differentiated into autonomic ganglion organoids; The extrinsic factors include: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, EGF, Forskolin, DAPT, insulin, Transferrin, Activin A, and BMP4; The addition of intrinsic factors involves the simultaneous overexpression of the following four transcription factors in the neural crest stem cells: Ascl1, Hand2, Phox2a, and Phox2b.

2. The preparation method according to claim 1, characterized in that, Step 2) includes the following steps: (1) The following four transcription factors are simultaneously overexpressed in the neural crest stem cells: Ascl1, Hand2, Phox2a and Phox2b, to obtain cells overexpressing the genes; (2) The overexpressing gene cells obtained in step (1) are placed in the first stage neuron induction medium for first stage culture. The first stage neuron induction medium contains basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF and DAPT. The basal medium includes DMEM / F-12 and B27. (3) The cells obtained in step (2) are placed in the second stage neuron induction medium for second stage culture. The second stage neuron induction medium contains basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, Forskolin and Activin A. The basal medium includes DMEM / F-12 and B27. (4) The cells obtained in step (3) are placed in the third-stage neuron induction medium for third-stage culture. The third-stage neuron induction medium contains basal medium and the following extrinsic factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, EGF, Forskolin, insulin, Transferrin, and BMP4. The basal medium includes DMEM / F-12, B27, and non-essential amino acids.

3. The preparation method according to claim 2, characterized in that, In step (1), the following steps are included: transcription factors Ascl1, Hand2, Phox2a and Phox2b are introduced into neural crest stem cells to obtain cells overexpressing the genes; And / or, the introduction is carried out by constructing lentiviral vectors, adeno-associated virus vectors, plasmid vectors or lipid vectors expressing the four transcription factors respectively, and then introducing them together into the neural crest stem cells; And / or, the sequence of the transcription factor Ascl1 is shown in SEQ ID No. 1 or SEQ ID No. 2, the sequence of the transcription factor Hand2 is shown in SEQ ID No. 3 or SEQ ID No. 4, the sequence of the transcription factor Phox2a is shown in SEQ ID No. 5 or SEQ ID No. 6, and the sequence of the transcription factor Phox2b is shown in SEQ ID No. 7 or SEQ ID No.

8.

4. The preparation method according to claim 2, characterized in that, In step (2), the first stage of cultivation lasts for 3 days; And / or, in the first-stage neuron induction medium, each 50 mL contains: DMEM / F-12: 49ml; 1×B27: 1ml; bFGF: 10ng / ml; IGF-1: 100ng / ml; BDNF: 10ng / ml; GDNF: 10ng / ml and DAPT: 10μM.

5. The preparation method according to claim 2, characterized in that, In step (3), the second stage of cultivation lasts for 7-12 days; And / or, in the second-stage neuron induction medium, each 50 mL contains: DMEM / F-12: 49ml; 1×B27: 1ml; bFGF: 10ng / ml; IGF-1: 100ng / ml; BDNF: 10ng / ml; GDNF: 10ng / ml; NGF: 20 ng / ml; NT-3: 20 ng / ml; Forskolin: 10 μM and Activin A: 25 ng / ml or 125 ng / ml; And / or, in the second stage of culture, the neurons are first cultured for 3 days in a second-stage neuronal induction medium containing 25 ng / ml Activin A; then the concentration of Activin A is changed to 125 ng / ml, and the culture is continued for another 3 days.

6. The preparation method according to claim 2, characterized in that, In step (4), the third stage of cultivation lasts for 15 days or more; And / or, in the third-stage neuron induction medium, each 50 mL contains: DMEM / F-12: 46.5ml; 1×B27: 1ml; Non-essential amino acids: 200μM; bFGF: 10ng / ml; IGF-1: 100ng / ml; BDNF: 10ng / ml; GDNF: 10ng / ml; NGF: 20ng / ml; NT-3: 20ng / ml; EGF: 10ng / ml; Forskolin: 10μM; insulin: 25μg / ml; Transferrin: 100μg / ml and BMP4: 15ng / ml.

7. The autonomic ganglion organoid obtained by the preparation method according to any one of claims 1-6, characterized in that, The autonomic ganglion organoids comprise autonomic neurons, Schwann glial cells, and satellite glial cells.

8. The application of the autonomic ganglion organoids according to claim 7 in methods for studying the developmental regulation of autonomic ganglia, methods for studying the mechanisms of disease occurrence and development, and in screening and preparing therapeutic drugs.

9. A neural crest stem cell, characterized in that, The neural crest stem cells simultaneously overexpress the following four transcription factors: Ascl1, Hand2, Phox2a, and Phox2b; And / or, the neural crest stem cells are prepared by introducing transcription factors Ascl1, Hand2, Phox2a and Phox2b into the neural crest stem cells; And / or, the introduction is carried out by constructing lentiviral vectors, adeno-associated virus vectors, plasmid vectors or lipid vectors expressing the four transcription factors respectively, and then introducing them together into the neural crest stem cells; And / or, the sequence of the transcription factor Ascl1 is shown in SEQ ID No. 1 or SEQ ID No. 2, the sequence of the transcription factor Hand2 is shown in SEQ ID No. 3 or SEQ ID No. 4, the sequence of the transcription factor Phox2a is shown in SEQ ID No. 5 or SEQ ID No. 6, and the sequence of the transcription factor Phox2b is shown in SEQ ID No. 7 or SEQ ID No.

8.

10. A culture medium for preparing autonomic ganglion organoids, characterized in that, The culture medium is selected from at least one of the following three culture media: (1) The first stage neuron induction medium contains a basal medium and the following extrinsic factors: bFGF, IGF-1, BDNF, GDNF and DAPT, wherein the basal medium includes DMEM / F-12 and B27; (2) The second-stage neuron induction medium contains a basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, Forskolin and Activin A, wherein the basal medium includes DMEM / F-12 and B27; (3) The third-stage neuron induction medium contains a basal medium and the following exogenous factors: bFGF, IGF-1, BDNF, GDNF, NGF, NT-3, EGF, Forskolin, insulin, Transferrin, and BMP4, wherein the basal medium includes DMEM / F-12, B27, and non-essential amino acids; And / or, each 50 mL of the neuron induction medium in the first stage contains: DMEM / F-12: 49 mL; 1×B27: 1 mL; bFGF: 10 ng / mL; IGF-1: 100 ng / mL; BDNF: 10 ng / mL; GDNF: 10 ng / mL and DAPT: 10 μM; And / or, the second-stage neuron induction medium contains per 50 mL: DMEM / F-12: 49 mL; 1×B27: 1 mL; bFGF: 10 ng / mL; IGF-1: 100 ng / mL; BDNF: 10 ng / mL; GDNF: 10 ng / mL; NGF: 20 ng / mL; NT-3: 20 ng / mL; Forskolin: 10 μM; and Activin A: 25 ng / mL or 125 ng / mL. And / or, the third-stage neuron induction medium contains, per 50 mL: DMEM / F-12: 46.5 mL; 1×B27: 1 mL; non-essential amino acids: 200 μM; bFGF: 10 ng / mL; IGF-1: 100 ng / mL; BDNF: 10 ng / mL; GDNF: 10 ng / mL; NGF: 20 ng / mL; NT-3: 20 ng / mL; EGF: 10 ng / mL; Forskolin: 10 μM; insulin: 25 μg / mL; Transferrin: 100 μg / mL; and BMP4: 15 ng / mL.

Images