Fusion protein of targeted specific antigen MUC16 and application thereof

Abstract

The invention discloses a fusion protein of a targeted specific antigen MUC16 and application thereof, and relates to the technical field of biological medicines, the fusion protein Cltx-M64 is constructed by fusing 64 amino acid domains at the N end of mesothelin with an anti-tumor functional domain of chlorotoxin by utilizing the high affinity targeting characteristic of the 64 amino acid domains at the N end of the mesothelin. By designing a prokaryotic expression vector pSYPU-1b-Cltx-M64, soluble expression is realized in escherichia coli, and the recombinant protein with electrophoresis-grade purity is obtained through purification. In-vitro experiments prove that the fusion protein can significantly inhibit pancreatic cancer AsPC-1 cell viability and induce cell apoptosis, and the action mechanism of the fusion protein is related to targeted MUC16 mediated endocytosis and downstream signal channel regulation. The M64 targeting domain is combined with the antitumor function of Cltx for the first time, a new strategy is provided for targeted therapy of MUC16 high-expression pancreatic cancer, and clinical application potential is achieved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to a design method of a fusion protein Cltx-M64 targeting pancreatic cancer specific antigen MUC16, a preparation process and its application in anti-tumor. BACKGROUND

[0002] Chlorotoxin (CLTX) is derived from Leiurus quinquestriatus in Israel, which has the characteristics of high affinity, low toxicity and easy penetration into tumor tissue. Chlorotoxin can specifically bind to tumor cell surface proteins (MMP2, CLCN3, ANXA2), but it has not been applied to pancreatic cancer targeted therapy, and its targeting correlation with MUC16 has not been explored.

[0003] MUC16 is a cell membrane protein that is abnormally highly expressed in pancreatic cancer tissue, and this high expression is closely related to cancer progression, metastasis and poor prognosis of patients. MUC16 can play a role in various tumor-related signaling pathways, promoting tumor cell proliferation, migration and invasion; and tumor cells expressing MUC16 can achieve immune escape by interacting with various immune cells. Among them, the C-terminal fragment of MUC16 (MUC16c) can promote the enrichment of regulatory T cells (Treg) in pancreatic cancer by regulating the secretion of IL-6 in the tumor microenvironment, thereby driving the molecular mechanism of immune escape. In a mouse model of pancreatic cancer, MUC16 deletion can significantly delay cancer progression and metastasis, and prolong the survival of mice. In addition, MUC16 deletion can also remodel the tumor microenvironment by reducing tumor-related fibrosis, inhibiting the activation of cancer-associated fibroblasts (CAFs), and reducing endothelial cell binding capacity. Among the ligands of MUC16, mesothelin shows the strongest binding capacity, and the N-terminal 64 amino acid domain of mesothelin (Mesothelin-64, M64) is sufficient to achieve high-affinity binding with MUC16, can mediate cell adhesion, and promote tumor metastasis. MUC16 can drive immune escape and metastasis by regulating the tumor microenvironment (such as promoting Treg cell enrichment and CAF activation). Although ADC drugs targeting MUC16 (such as DMUC5754A) have shown some efficacy in clinical trials, antibody drugs generally have high production costs and poor tumor penetration.

[0004] Currently approved chemotherapy drugs for pancreatic cancer treatment include gemcitabine hydrochloride and irinotecan hydrochloride. The dose-limiting toxicity of these drugs to normal tissues is a factor influencing adjustments to chemotherapy regimens; in clinical practice, reducing drug dosage or using combination therapy is usually necessary to reduce side effects. Surgical resection is the most likely cure for pancreatic cancer, but it is only suitable for patients with early-stage pancreatic cancer. For patients with metastatic pancreatic cancer, current chemotherapy regimens can only extend their survival by a few months. The emergence of targeted therapies has provided new treatment possibilities for pancreatic cancer. Currently, globally approved antibody-drug conjugates (ADCs) for pancreatic cancer treatment include goxatuzumab, trastuzumab, and trastuzumab emtansine. In addition, synthetic peptides have shown significant performance in pancreatic cancer treatment. Given the poor efficacy of comprehensive treatment for pancreatic cancer and the lack of highly specific anti-tumor drugs, there is an urgent need to find and validate potential therapeutic targets and effective treatment methods for this malignant tumor.

[0005] Currently, there are no reports on the design of fusion proteins that target MUC16 using chlortoxin, nor are there any mature methods for efficiently expressing such fusion proteins in prokaryotic systems. Therefore, there is an urgent need to develop novel drugs that combine precise targeting with production feasibility. Summary of the Invention

[0006] The primary objective of this invention is to provide a fusion protein, Cltx-M64, that targets the specific antigen MUC16. The invention also includes providing a nucleic acid molecule encoding the fusion protein, an expression vector containing the nucleic acid molecule, and a host cell containing the expression vector; furthermore, it provides a method for preparing the fusion protein, a pharmaceutical composition containing the fusion protein, and the pharmaceutical use of the fusion protein or the pharmaceutical composition in the preparation of medicines for treating tumor-related diseases.

[0007] To achieve the above objectives, the present invention provides the following technical solution: A first aspect of the present invention provides a fusion protein targeting the specific antigen MUC16, comprising a first structural region and a second structural region, or the fusion protein further comprising a third structural region; the first structural region is Cltx, the second structural region is a truncated form of mesothelin-64 (M64), and the third structural region is a linker (GGGS)n, where G represents glycine, S represents serine, and n is a positive integer selected from 1 to 6; the Cltx or M64 comprises a functional fragment or variant thereof; the M64 structural region is capable of specifically binding to MUC16.

[0008] A second aspect of the invention provides a polynucleotide encoding a fusion protein of the target-specific antigen MUC16.

[0009] A third aspect of the invention provides an expression vector comprising the aforementioned polynucleotide.

[0010] A fourth aspect of the invention provides a host cell comprising the expression vector or genome in which the exogenous polynucleotide is integrated.

[0011] A fifth aspect of the present invention provides a method for preparing a fusion protein of the target-specific antigen MUC16, comprising the steps of: synthesizing the fusion protein of the target-specific antigen MUC16, and / or culturing the host cells under suitable expression conditions, and recovering and purifying the fusion protein of the target-specific antigen MUC16 from the culture.

[0012] A sixth aspect of the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a fusion protein of the target-specific antigen MUC16 and a pharmaceutically acceptable excipient or carrier.

[0013] A seventh aspect of the invention provides the use of the fusion protein of the target-specific antigen MUC16 or the pharmaceutical composition thereof in the preparation of an antitumor drug. The tumor is selected from carcinomas, lymphomas, blastomas (including medulloblastoma and retinoblastoma), sarcomas (including liposarcoma and synovial cell sarcoma), neuroendocrine tumors (including carcinoid tumors, gastrinomas, and islet cell carcinomas), mesotheliomas, schwannomas (including acoustic neuromas), meningiomas, adenocarcinomas, and melanomas.

[0014] An eighth aspect of the present invention provides a method of using the fusion protein of the target-specific antigen MUC16 or the pharmaceutical composition thereof in the prevention and / or treatment of tumors, comprising administering to a subject a pharmaceutically effective amount of the fusion protein of the target-specific antigen MUC16 or the pharmaceutical composition thereof.

[0015] The beneficial effects of this invention are: 1. This invention provides a novel targeted therapy approach, for the first time fusing a truncated form of mesothelin (i.e., a fragment containing 64 amino acid residues at the N-terminus, named M64) with chloramphenicol (Cltx) to construct the fusion protein Cltx-M64. The fusion protein Cltx-M64 of this invention specifically targets the MUC16 site, inducing cancer cell death by activating the apoptosis pathway. Its mechanism of action is clear and highly targeted, providing a new technical approach and solution for targeted cancer therapy.

[0016] 2. This invention, through extensive experimental screening, determined the optimal isolation and purification conditions for the fusion protein Cltx-M64, successfully obtaining high-purity Cltx-M64. Based on this, a series of experiments verified the specific targeting binding ability of this fusion protein to MUC16 and its potent anti-cancer activity, as well as its ability to effectively activate the apoptosis pathway. Compared to Cltx alone, the fusion protein Cltx-M64 exhibits superior anti-cancer activity, demonstrating more effective and broader therapeutic efficacy in related cancer treatments. Specifically, it significantly enhances its targeting binding ability to MUC16, resulting in more precise targeting; furthermore, it achieves high-efficiency anti-cancer activity at lower dosages, significantly improving efficacy. When applied to the clinical treatment of cancer, this fusion protein demonstrates significant benefits in multiple key dimensions, including efficacy, safety, stability, and duration of action, providing a more valuable candidate drug for cancer treatment.

[0017] 3. The method of the present invention is particularly suitable for targeted therapy of pancreatic cancer with high MUC16 expression, inhibiting tumor progression through targeted binding and cytotoxic effects mediated by fusion protein. Attached Figure Description

[0018] Figure 1 This is a map of the pSYPU-1b recombinant plasmid containing Cltx-M64 in this invention; Figure 2 This is a map of the PET-32a(+) recombinant plasmid containing Cltx in this invention; Figure 3 The image shows the protein purification results of Cltx-M64 in this invention; lane 1: protein molecular weight marker; lane 2: supernatant of Cltx-M64 induction group; lane 3: permeate of Cltx-M64 induction group; lane 4: 50 mmol / L imidazole elution phase; lane 5: 100 mmol / L imidazole elution phase; lane 6: 200 mmol / L imidazole elution phase; lane 7: 400 mmol / L imidazole elution phase. Figure 4 The image shows the protein purification results of TrxA-Clt in this invention; lane 1: protein molecular weight marker; lane 2: supernatant of TrxA-Cltx induction group; lane 3: permeate of TrxA-Cltx induction group; lane 4: elution phase of elution buffer A; lane 5: elution phase of elution buffer B; lane 6: elution phase of elution buffer C. Figure 5 This is the concentrated result of Cltx after thrombin digestion in TrxA-Clt in this invention; Figure 6The MTT results of Cltx and Cltx-M64 on pancreatic cancer cells AsPC-1 in this invention are shown; where A: Cltx results; B: Cltx-M64 results. Figure 7 The results of flow cytometry analysis of the effect of Cltx on apoptosis of pancreatic cancer cells AsPC-1 in this invention are shown; where A: scatter plot of apoptosis distribution of cancer cells, and B: bar chart of apoptosis rate of cancer cells. Figure 8 The results of flow cytometry analysis of the effects of Cltx-M64 on apoptosis of pancreatic cancer cells AsPC-1 in this invention are shown below; where A: scatter plot of apoptosis distribution of cancer cells; B: bar chart of apoptosis rate of cancer cells. Figure 9 The results of immunocytochemical analysis of Cltx and Cltx-M64 with pancreatic cancer AsPC-1 cells in this invention are shown. Figure 10 This is the result of Western blotting detection of Caspase-8 and Caspase-3 expression in pancreatic cancer AsPC-1 cells after treatment with different concentrations of Cltx and Cltx-M64 in this invention; where A: expression bands of Caspase-8 and Caspase-3 proteins; B: bar chart showing the effect of Caspase-8 and Caspase-3 protein relative expression. Detailed Implementation

[0019] The embodiments described below are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0020] Pancreatic cancer has an extremely poor prognosis, and existing treatments have limited effectiveness, necessitating the development of new targeted therapies. MUC16 is highly expressed in pancreatic cancer and is closely associated with tumor progression, immune escape, and poor patient prognosis. In the following examples, this invention utilizes the high-affinity targeting properties of the MUC16 ligand (the 64-amino acid domain at the N-terminus of mesothelin (M64)) to fuse it with the anti-tumor functional domain of chloramphenicol (Cltx), constructing the fusion protein Cltx-M64. Soluble expression was achieved in *E. coli* using a designed prokaryotic expression vector pSYPU-1b-Cltx-M64 (containing a 6×His tag), and the recombinant protein was purified to electrophoretic purity. In vitro experiments confirmed that this fusion protein significantly inhibited the viability of pancreatic cancer AsPC-1 cells and induced apoptosis; its mechanism of action is related to MUC16-mediated endocytosis and downstream signaling pathway regulation. This invention is the first to combine the M64 targeting domain with the anti-tumor function of Cltx, providing a new strategy for targeted therapy of pancreatic cancer with high MUC16 expression, and has potential for clinical application.

[0021] This invention provides a fusion protein Cltx-M64 that targets the specific antigen MUC16. This invention also provides a nucleic acid molecule of the fusion protein, an expression vector containing the nucleic acid molecule, and a host cell containing the expression vector; this invention further provides a method for preparing the fusion protein, a pharmaceutical composition containing the fusion protein, and the pharmaceutical use of the fusion protein or the pharmaceutical composition in the preparation of medicines for the prevention and / or treatment of cancer-related diseases.

[0022] A fusion protein Cltx-M64 targeting the specific antigen MUC16, comprising a first structural region and a second structural region, or the fusion protein further comprising a third structural region; the first structural region is Cltx, the second structural region is a truncated form of mesothelin-64 (M64), and the third structural region is a linker; the Cltx or M64 comprises a functional fragment (i.e., a partial amino acid sequence retaining the biological function of Cltx or M64) or a variant thereof; the M64 structural region is capable of specifically binding to MUC16. The fusion protein has at least 95%, 96%, 97%, 98%, or 99% sequence homology with the amino acid sequence shown in SEQ ID NO. 1. The variant has at least 80%, 85%, 90%, 95%, 98%, or 99% sequence identity with SEQ ID NO. 3 (standard Cltx sequence) or SEQ ID NO. 5 (standard M64 sequence), and retains the amino acid sequence binding to MUC16 and antitumor activity.

[0023] In an optional embodiment, the linker of the third structural region is (GGGS)n, where n is a positive integer from 1 to 6, G represents glycine, and S represents serine. When n=2, the amino acid sequence of the linker is GGGSGGGS, and the specific amino acid and nucleic acid sequences are shown in SEQ ID NO. 7 and SEQ ID NO. 8.

[0024] A polynucleotide encoding the fusion protein Cltx-M64 described in this invention.

[0025] In an optional embodiment, the polynucleotide comprises a nucleic acid sequence selected from SEQ ID NO. 2, SEQ ID NO. 4 and SEQ ID NO. 6.

[0026] SEQ ID NO. 1: Amino acid sequence of the fusion protein Cltx-M64; SEQ ID NO. 2: Nucleic acid sequence of the fusion protein Cltx-M64; SEQ ID NO. 3: Amino acid sequence of the first structural region Cltx; SEQ ID NO. 4: Nucleic acid sequence of the first structural region Cltx; SEQ ID NO. 5: Amino acid sequence of the second structural region M64; SEQ ID NO. 6: Nucleic acid sequence of the second structural region M64; SEQ ID NO. 7: The amino acid sequence of the linker; SEQ ID NO. 8: Nucleic acid sequence of the linker.

[0027] An expression vector comprising the polynucleotides described above.

[0028] A host cell comprising the expression vector or genome in which the exogenous polynucleotide is integrated.

[0029] A method for preparing the fusion protein includes the following steps: synthesizing the fusion protein, and / or culturing the host cells under suitable expression conditions, and recovering and purifying the fusion protein from the culture.

[0030] A pharmaceutical composition comprising a therapeutically effective amount of the fusion protein and pharmaceutically acceptable excipients and a carrier.

[0031] The fusion protein or the pharmaceutical composition described herein is used to prepare a drug for the prevention and / or treatment of tumors.

[0032] In optional embodiments, the tumor includes carcinoma, lymphoma, blastoma (including medulloblastoma and retinoblastoma), sarcoma (including liposarcoma and synovial cell sarcoma), neuroendocrine tumor (including carcinoid tumor, gastrinoma and islet cell carcinoma), mesothelioma, schwannoma (including acoustic neuroma), meningioma, adenocarcinoma and melanoma.

[0033] A method of using the fusion protein or the pharmaceutical composition described herein in the prevention and / or treatment of tumors, comprising administering a pharmaceutically effective amount of the fusion protein or the pharmaceutical composition to a subject.

[0034] In an optional implementation, the treatment of the tumor includes all cancer types that contain high / overexpression of MUC16. Tumors include carcinomas, lymphomas, blastomas (including medulloblastoma and retinoblastoma), sarcomas (including liposarcoma and synovial cell sarcoma), neuroendocrine tumors (including carcinoid tumors, gastrinomas, and islet cell carcinomas), mesotheliomas, schwannomas (including acoustic neuromas), meningiomas, adenocarcinomas, and melanomas.

[0035] In an optional embodiment, the method further includes administering a second active molecule. The second active molecule includes a cancer treatment drug.

[0036] In an optional implementation, the above-mentioned tumor treatment is related to the apoptosis pathway.

[0037] The amino acid sequences in this invention are arranged sequentially from the N-terminus to the C-terminus.

[0038] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.

[0039] Unless otherwise defined, all technical and scientific terms used in this invention shall have the meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0040] Cltx: The term "Cltx" refers to the full-length sequence or fragments of naturally occurring chlortoxin. Chlortoxin is a 36-amino acid peptide extracted from the venom of the Israeli scorpion (Scorpionus spp.). It is a chloride channel blocker and has anticancer activity.

[0041] M64: The term "M64" refers to the truncated form of mesothelin (the 64 amino acids at the N-terminus). MUC16 can interact with multiple tumor-associated signaling pathways, promoting tumor cell proliferation, tumor migration, and invasion. Tumor cells expressing MUC16 can also achieve immune escape by interacting with various immune cells. Mesothelin exhibits the strongest binding affinity to MUC16; its N-terminal 64-amino acid domain (Mesothelin-64, M64) is sufficient to achieve high affinity binding to MUC16, mediating cell adhesion and promoting tumor metastasis.

[0042] Sequence homology: Methods for determining sequence homology known to those skilled in the art include: *Computational Molecular Biology*, Lesk, AM (ed.), Oxford University Press, New York, 1988; *Biocomputing: Informatics and Genome Projects*, Smith, DW (ed.), Academic Press, New York, 1993; *Computer Analysis of Sequence Data*, Part I, Griffin, AM & Griffin, H. G (eds.), Humana Press, New Jersey, 1994; *Sequence Analysis in Molecular Biology*, von Heinje, G., Academic Press, 1987; *Sequence Analysis Primer*, Gribskov, M. & Devereux, J. (eds.), Stockton Press, New York, 1991; and Carillo, H. & Lipman, D., SIAM. J. Appl. Math., 48:1073 (1988). Preferred methods for determining homology aim to achieve the largest possible match between the tested sequences. Methods for determining homology are compiled into publicly available computer programs. Preferred computer program methods for determining homology between two sequences include, but are not limited to: the GCG package (Devereux, J. et al., 1984), BLASTP, BLASTN, and FASTA (Altschul, SF et al., 1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI, NLM, NIH, Bethesda, Md. 20894; Altschul, S. et al., 1990). The well-known Smith-Waterman algorithm can also be used to determine homology.

[0043] Fusion protein: The term "fusion protein" refers to a new polypeptide sequence obtained by fusing multiple identical or different polypeptide sequences. The term "fusion" refers to the connection by direct peptide bonds or by means of one or more linkers (peptide adapters). The term "linker (peptide adapter)" refers to a short peptide, typically 1-30 amino acids in length, capable of connecting two polypeptide sequences. Preferably, the peptide adapter is a flexible peptide adapter. Suitable examples of adapters include monoglycine (Gly) or serine (Ser) residues, and the identification and sequence of amino acid residues in the adapter can vary depending on the type of secondary structural element to be achieved in the adapter.

[0044] Multiple: The term "multiple" refers to at least two.

[0045] Nucleic acid encoding and expression vectors: This invention also provides a nucleic acid molecule encoding the aforementioned fusion protein. The nucleic acid of this invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, and artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The sequence of the DNA molecule of the fusion protein of this invention can be obtained using conventional techniques, such as PCR amplification. Alternatively, the relevant sequence can be synthesized artificially.

[0046] This invention also relates to vectors comprising the aforementioned suitable DNA sequences and suitable promoters or control sequences. These vectors can be used to transform suitable host cells to enable them to express proteins. The vectors described herein are conventional expression vectors in the art, referring to expression vectors containing suitable regulatory sequences, such as promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes and / or sequences, and other suitable sequences. The expression vectors can be viruses or plasmids, such as suitable bacteriophages or phage particles; for more technical details, please refer to, for example, Sambrook et al., *Molecular Cloning: A Laboratory Manual*, 2nd edition, Cold Spring Harbor Laboratory Press, 1989. Many known techniques and methods for nucleic acid manipulation can be found in *Current Protocols in Molecular Biology*, 2nd edition, edited by Ausubel et al. The expression vectors described in this invention are preferably pSYPU-1b and pET32a.

[0047] In this invention, the term "host cell" refers to any type of host cell conventional in the art, as long as it enables the vector to replicate stably and the carried polynucleotide molecules to be effectively expressed. The host cell includes prokaryotic expression cells and eukaryotic expression cells, and the preferred host cells are: COS, CHO, NSO, sf9, sf21, DH5α, BL21(DE3), TG1, BL21(DE3), 293F, or 293E cells.

[0048] Pharmaceutical composition: The term "pharmaceutical composition" refers to a single or compound pharmaceutical preparation consisting of the polypeptide or variant thereof, fusion protein of the present invention, together with pharmaceutically acceptable excipients and carriers. The excipients and carriers include those well known to those skilled in the art, and suitable carriers and excipients include human serum albumin, saline, buffer solution, glucose, water, glycerol, ethanol, glycine, sorbic acid, potassium sorbate, and combinations thereof.

[0049] The pharmaceutical compositions of the present invention can be in a variety of dosage forms, including liquid solutions or suspensions, injections, liposomes, etc. Preferred dosage forms depend on the administration method and the intended use. The pharmaceutical compositions of the present invention can be administered to subjects using conventional administration methods, including intravenous, peritoneal, intramuscular, and subcutaneous administration.

[0050] This invention, through multiple rounds of protein engineering and screening, has obtained a specific fusion protein, Cltx-M64, that can target MUC16. This protein exhibits anticancer activity that surpasses the use of Cltx or other fusion proteins alone, and will have a more effective and broader therapeutic effect in related cancer treatments.

[0051] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0052] Example 1: Molecular design of the Cltx-M64 gene Based on the reported amino acid sequence of scorpion venom chlortoxin (protein registry number: P45639), the nucleotide sequence encoding the protein was deduced using conventional methods, taking into account the codon bias of *E. coli*. Based on this, primers were designed for PCR amplification to obtain the target gene W1.

[0053] The forward primers are P1: 5'CGGGATCCATGCACCACCACCACCACCACCAC3' and P2: 5'TCCGCTTCCTCCTCCGCGACACAAACATT3'.

[0054] The reverse primers are P3: 5'GGAGGAGGAAGCGGAGGAGGAAG3' and P4: 5'CGGAATTCTTAGAGCTCATCCAGTTTATGCTTTAGG3'.

[0055] The first round of PCR amplification used primers P2 and P3, and the second round used primers P1 and P4. The reagents for the first round of PCR were as follows: 5 μL of 10xTaq polymerase buffer, 4 μL of dNTP mixture, 1 μL of primer P2, 1 μL of primer P3, 0.25 μL of Taq DNA polymerase, and 37.75 μL of sterile water. PCR reaction conditions: 94℃ pre-denaturation for 300 seconds, 94℃ denaturation for 45 seconds, 55℃ annealing for 45 seconds, 72℃ extension for 45 seconds, and a final extension at 72℃ for 200 seconds, repeated 32 times. For the second round of PCR, primers P1 and P4 were used, along with 1 μL of template diluted 50-fold in the first round of PCR amplification product; all other reaction conditions remained unchanged.

[0056] Example 2: Construction of the Cltx-M64 protein recombinant expression vector A: Double digestion and ligation of Cltx-M64 and pSYPU-1b; The PCR product obtained in Example 1 was extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with anhydrous ethanol (2.5 times volume), and the precipitate was dissolved in 50 μL of sterile water. The recovered PCR product and expression vector pSYPU-1b plasmid were digested with restriction endonucleases BamHI and EcoRI (Takara). Digestion reaction: 1 μL each of BamHI (14 U / μL) and XhoI (20 U / μL), 2.5 μL of 10-fold buffer, 50-100 ng of PCR product or pSYPU-1b plasmid, and sterile water were added to a total volume of 25 μL. The mixture was incubated at 37°C for 5 hours. The digested product was then extracted with phenol:chloroform:isoamyl alcohol, precipitated with anhydrous ethanol (2.5 times volume), and ligated with T4 DNA ligase (Takara) to the expression vector pSYPU-1b. Ligation reaction: 1 μL of T4 DNA ligase (1 U / μL), the molar ratio of PCR product to expression vector pSYPU-1b is 3:1, and the total amount of DNA is 0.1 μg. Add 4 μL of 5-fold ligase reaction buffer and sterile water to a total volume of 20 μL. Incubate at 16°C for 24 hours.

[0057] B: Preparation of Escherichia coli DH5α and Rossetta (DE3) competent cells; Preparation of competent cells of DH5α (purchased from China Center for Type Culture Collection, this strain DH5α is a common strain): Pick a single colony of DH5α from a streak plate, inoculate it into 5 mL of LB medium, and incubate overnight at 37°C and 250 rpm in a shaker; transfer 1% of the culture into 5 mL of LB medium, and grow until OD600 reaches 0.4-0.6. Take 1 mL of the bacterial culture into a pre-chilled 1.5 mL Eppendorf tube, incubate on ice for 5-10 minutes, centrifuge at 4°C and 12000 rpm for 20-30 seconds, collect the bacterial cells, invert for 1 minute, and then incubate on ice for 10 minutes; resuspend the precipitate in 1 mL of pre-chilled 0.1 M CaCl2, incubate on ice for 20-40 minutes, centrifuge at 4°C and 12000 rpm for 20-30 seconds, collect the bacterial cells, resuspend the bacterial cells in 150 μL of pre-chilled CaCl2, incubate on ice for 2-7 hours, and store at 4°C. If stored at -70°C, it can be stored for 6 months. The preparation of Rossetta (DE3) competent cells is the same as that of DH5α competent cells.

[0058] C: Transformation of the ligation product and identification of positive clones; Add 20 μL of the ligation reaction solution from step 2A of Example 2 to 100 μL of DH5α competent cells, mix well, incubate on ice for 30 minutes, incubate in a 42°C water bath for 90 seconds (without shaking), and then incubate on ice for 2 minutes; add an equal volume of 2×LB culture medium, and incubate at 37°C on a shaker (120 rpm) for 1 hour; shake well, take 200 μL and spread it on an LB / AP+ agar plate, aspirate the bacterial solution, and incubate upside down at 37°C for 12–16 hours, observing the results. Pick 10 single colonies from a kanamycin agar plate (LB / AP+), and incubate in 500 μL of LB liquid medium containing kanamycin at 37°C with shaking for 4 hours. Take 2 μL of the bacterial solution as a template and perform PCR using the forward and reverse primers P1, P2, P3, and P4 from Example 1. Positive clones selected by PCR were further identified using restriction enzyme digestion. Clones with positive results in both methods were sent to the company for sequencing analysis, and the sequencing results were consistent with expectations. Figures 1-2 ).

[0059] Example 3: Preparation of recombinant Cltx and Cltx-M64 genetically engineered bacteria The recombinant expression plasmid was extracted from the positive clones that were correctly sequenced in step 2C of Example 2 using the alkaline lysis method.

[0060] pSYPU-1b-Cltx-M64 (method described in *Molecular Cloning: A Laboratory Manual*, 2nd edition). The extracted pSYPU-1b-Cltx-M64 plasmid was transformed into *E. coli* competent Rossetta (DE3) cells prepared in Example 2B, following the transformation method described in Example 2C. LB agar plates were used. Single clones were picked to obtain the genetically engineered *Rossetta(DE3)* (pSYPU-1b-Cltx-M64).

[0061] Example 4: Expression and purification of recombinant Cltx and Cltx-M64 proteins Clones (recombinant E. coli Rossetta(DE3) / pSYPU-1b-Cltx-M64 and recombinant E. coli Rossetta(DE3) / pET-32a-TrxA-Cltx) were inoculated at a ratio of 1:100 in LB liquid medium containing kanamycin and penicillin. The cultures were incubated at 37°C until OD600 = 0.8, at which point IPTG (final concentration 0.1 mM) was added to induce expression. The cultures were then incubated at 28°C for 4 hours to express the target genes. The induced cultures were concentrated 50-fold, and cells were lysed by sonication (80 Hz, 30 seconds / cycle, until the culture became clear). The cultures were centrifuged at 12,000 rpm for 15 minutes, and the supernatant was added to a GST affinity gel and thoroughly mixed. The mixture was then incubated at 26°C for 1 hour to allow the Cltx-M64 and TrxA-Cltx proteins to fully bind to the GST affinity gel. The GST affinity gel was repeatedly washed with a Tris-HCl buffer (1.0 mM, pH 8.0) containing 50 mM EDTA (ethylenediaminetetraacetic acid) to remove contaminating proteins. Cltx-M64 and TrxA-Cltx proteins were then eluted with 10 mM GSH (reduced glutathione) at a culture concentration of 50 mL / L. The collected target protein TrxA-Cltx was digested with thrombin provided by Solarbio Science, yielding Cltx protein. The eluted Cltx-M64 and the thrombin-digested Cltx protein were concentrated and desalted by centrifugation in a 50 mL 10 kDa ultrafiltration tube (Millipore Centricon, USA) at 3500 rpm / min and 4 °C. The concentrated and desalted Cltx-M64 and TrxA-Cltx proteins were then purified by HPLC (Aegir, Inc., USA). The recombinant Cltx-M64 protein and Cltx protein in the collected solution were detected by SDS-PAGE with Tris-Tricine buffer and sodium dodecyl sulfate, and their contents were determined by the Bradford method. Figures 3-5 ).

[0062] Example 5: Cltx and Cltx-M64 proteins inhibit the proliferation of pancreatic cancer cells. AsPC-1 pancreatic cancer cells were seeded in 96-well plates, with 200 μL of cell suspension added to each well. Five replicates were made for each concentration group. Drugs were added when cell confluence reached 50%-60%. Different concentrations of Cltx and Cltx-M64 proteins (0.1, 1, and 10 μmol / L) were added to the corresponding wells. After culturing for 24 hours, 200 μL of 0.5 mg / mL MTT solution was added to each well. After incubation for 4 hours, the supernatant was removed, and 150 μL of DMSO was added to each well. The wells were then incubated at 37°C for 30 minutes to ensure complete dissolution of the crystals. Next, the absorbance (OD value) of each well was measured at 490 nm using a microplate reader. Cell viability was calculated using the formula: (Experimental group OD - Blank group OD) / (Control group OD - Blank group OD) × 100%. Results were statistically analyzed using GraphPad Prism8 software.

[0063] The results are as follows Figure 6 As shown, both Cltx and Cltx-M64 can inhibit the activity of pancreatic cancer cells AsPC-1 in a concentration-dependent manner: with increasing Cltx ( Figure 6 A) and Cltx-M64 ( Figure 6 B) As the concentration increased from 0.1 μmol / L to 10 μmol / L, cell viability gradually decreased, and highly significant inhibition was observed at 10 μmol / L (statistically significant difference). Furthermore, the results show that the inhibitory effect of Cltx-M64 is significantly better than that of the existing Cltx. At the same concentration, the decrease in cell viability in the Cltx-M64 group was more pronounced than that in the Cltx group, indicating that the fusion protein Cltx-M64 of this invention has a stronger inhibitory effect on pancreatic cancer cells AsPC-1 than Cltx.

[0064] Example 6: Cltx and Cltx-M64 proteins induce apoptosis in pancreatic cancer cells. AsPC-1 cells were seeded in 6 cm diameter culture dishes and incubated at 37°C in a 5% CO2 incubator. When cell confluence reached approximately 50%-60%, drug administration began. Cells were divided into three groups according to experimental requirements: a blank control group (unstained group), a single-stained group (FITC / PI), and a double-stained group (FITC and PI). Cell collection and detection: After 48 hours, the culture dishes were removed from the incubator, and the supernatant from each dish was collected using a pipette. The cells were then washed with PBS solution, followed by trypsin digestion. The collected supernatant and digested cells were centrifuged at 1000 rpm for 5 minutes and washed 2-3 times with PBS solution. 195 µL of binding buffer (10% binding buffer, 90% deionized water) and 5 µL of Annexin V-FITC were added, and the cells were incubated at room temperature in the dark for 15 minutes. After the staining process, the cells were washed 1-2 times with binding buffer, then 190 µL of binding buffer and 10 µL of propidium iodide were added. The cells were stained at room temperature in the dark for 15 minutes, and then apoptosis was detected using flow cytometry. Figures 7-8 ).

[0065] like Figures 7-8 As shown, both Cltx and Cltx-M64 can induce apoptosis in pancreatic cancer cells AsPC-1 in a concentration-dependent manner. As the drug concentration increased from 0 μM to 10 μM, the apoptosis rate gradually increased; at 10 μM, both significantly induced apoptosis. At the same concentration (e.g., 10 μM), the apoptosis rate induced by the Cltx-M64 group was significantly higher than that of the Cltx group. This indicates that Cltx-M64 of the present invention is significantly superior to Cltx in inducing apoptosis in pancreatic cancer cells AsPC-1. At concentrations of 0.1 μM and 1 μM, Cltx showed no significant induction of apoptosis; while Cltx-M64 showed an increasing trend in apoptosis rate at these concentrations, further demonstrating the superiority of Cltx-M64 in inducing apoptosis.

[0066] Example 7: Cltx and Cltx-M64 proteins specifically bind to the membrane protein MUC16 Cover cell slides with poly-lysine for 5 minutes at room temperature. Aspirate the liquid, allow the cell slides to dry completely, and then sterilize under UV light for at least 30 minutes. Add a small amount of complete culture medium to the desired location in a 24-well plate, then place the cell slide in the plate. Digest the cells and transfer them to the cell slides. Add 2.0 mL of complete culture medium around the cell slides and incubate at 37°C with 5% CO2 for 24 hours. Add 1.0 mL of 1 μmol / L target protein to each well and continue incubation for 48 hours. After 48 hours, aspirate the complete culture medium and wash the cell slides three times with 1.0 mL of PBS. Fix pancreatic cancer AsPC-1 and BxPC-3 cells in each well with 1.0 mL of 4% paraformaldehyde for 15 minutes at room temperature. Aspirate the 4% paraformaldehyde solution and wash the cells three times with PBS. Add 1.0 mL of 10% blocking sheep serum to each well and incubate at 28°C for 30 minutes. Aspirate the blocking sheep serum and wash the cells three times with PBS for 5 minutes each time. 200 μL of primary antibody was evenly dropped onto a cell slide and incubated overnight at 4°C. The primary antibody solution was aspirated, and the slide was rinsed three times with PBS for 5 minutes each time. At room temperature, a secondary antibody conjugated with a fluorescent dye was added to the surface of the cell slide, and the slide was incubated at 37°C in the dark for 1 hour. The slide was then rinsed three times with PBS in the dark for 5 minutes each time. Cells were stained with one drop of anti-fluorescence quenching mounting medium and mounted. The results were observed using a laser confocal microscope. DAPI-stained cell nuclei were observed at an excitation wavelength of 405 nm, phycoerythrin (PE)-stained M64 protein was observed at an excitation wavelength of 561 nm, and fluorescein isothiocyanate (FITC)-stained membrane protein MUC16 was observed at an excitation wavelength of 488 nm. Figure 9 ).

[0067] Example 8: Mechanism of Cltx and Cltx-M64 protein-induced apoptosis in pancreatic cancer cells Adherent pancreatic cancer AsPC-1 cells were treated with 0.1, 1, and 10 μmol / L Cltx or Cltx-M64 protein, respectively. The culture medium was discarded, and the cells were washed twice with pre-chilled PBS (1 mL). Cells were scraped off and centrifuged at 1000 rpm for 10 minutes to collect the pellet. The cells were resuspended in PBS and washed twice (1000 rpm, 5 minutes). The cell pellet was vortexed with lysis buffer (10 μL phosphatase inhibitor, 5 μL PMSF, and 1 μL protease inhibitor per 1 mL) for 30 seconds and incubated on ice for 4 minutes, repeated 5 times. The cells were centrifuged at 14000 rpm for 10 minutes at 4°C, and the supernatant was collected as the total protein extract. Protein concentration was subsequently determined using the BCA method.

[0068] Take 20-40 μg of protein sample and mix it with 5× loading buffer at a 4:1 ratio. Denature at 100℃ for 5 minutes. Perform SDS-PAGE (5% stacking gel, 8%-12% separating gel): stacking gel 80V for 30 minutes, separating gel 120V to the bottom of the bromophenol-landar gel. Cut the gel according to the target protein molecular weight, and activate the PVDF membrane (0.45 μm) with methanol for 5 minutes. The transfer sequence is: sponge → filter paper → gel → PVDF membrane → filter paper → sponge, removing air bubbles. Transfer at a constant current of 200mA (time adjusted according to molecular weight), with the transfer tank on ice. After transfer, block with 5% skim milk powder or 5% goat serum for 2 hours (28℃). Incubate the primary antibody (diluted with blocking buffer) at 4℃ overnight, and wash the membrane 3 times × 5 minutes with TBST; incubate the secondary antibody (diluted as above) at 37℃ for 2 hours, and wash 3 times × 5 minutes with TBST. A cover film was applied using ECL chemiluminescence solution (A:B=1:1), and the film was exposed in a darkroom. The film was developed for 3 minutes, washed with water, and fixed for 3 minutes. ImageJ software was used to analyze the target band and β-actin grayscale values ​​to calculate the relative expression level. Figure 10 ).

[0069] The results are as follows Figure 10 As shown, compared with the control group, 10 μmol / L Cltx and Cltx-M64 can significantly reduce the protein expression levels of Caspase-8 and Caspase-3, suggesting that the two proteins may induce apoptosis by increasing the cleavage of Caspase-8 and Caspase-3 proteins and reducing their expression levels.

[0070] It should be understood that after reading the above teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by this invention.

Claims

1. A fusion protein targeting the specific antigen MUC16, characterized in that, The fusion protein comprises a Cltx domain and a M64 domain, wherein the M64 domain specifically binds to MUC16; the Cltx stands for chlorotoxin, and the M64 stands for a truncated form of mesothelin, and the fusion protein has at least 95%, 96%, 97%, 98% or 99% sequence homology with the amino acid sequence shown in SEQ ID NO.

1.

2. The fusion protein targeting the specific antigen MUC16 according to claim 1, characterized in that, The Cltx domain and the M64 domain are connected by a linker, and the linker has an amino acid sequence of (GGGS)n, wherein G is glycine, S is serine, and n is a positive integer of 1-6.

3. The fusion protein targeting the specific antigen MUC16 according to claim 1, characterized in that, The Cltx domain or the M64 domain comprises a functional fragment or variant thereof that retains the function of targeting MUC16 or anti-tumor function.

4. The fusion protein targeting the specific antigen MUC16 according to claim 3, characterized in that, The variant is an amino acid sequence having at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity with SEQ ID NO. 3 or SEQ ID NO. 5, and retains the binding to MUC16 and the anti-tumor activity.

5. A polynucleotide comprising a nucleic acid sequence encoding a polypeptide of any one of claims 1-4. The fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4.

6. An expression vector, characterized by, The polynucleotide according to claim 5.

7. A host cell, characterized in that, The expression vector according to claim 6 or the genome integrated with the exogenous polynucleotide according to claim 5.

8. A method of making a fusion protein targeting the specific antigen MUC16, characterized in that, The method comprises the following steps: The fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4 is synthesized, and / or the host cell according to claim 7 is cultured under conditions suitable for expression, and the fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4 is recovered and purified from the culture.

9. A pharmaceutical composition, characterized by, The fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4 is synthesized, and / or the host cell according to claim 7 is cultured under conditions suitable for expression, and the fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4 is recovered and purified from the culture.

10. The use of the fusion protein targeting the specific antigen MUC16 according to any one of claims 1 to 4 or the pharmaceutical composition according to claim 9 for the preparation of a medicament for the prevention and / or treatment of a tumor, characterized in that, The fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4 is synthesized, and / or the host cell according to claim 7 is cultured under conditions suitable for expression, and the fusion protein targeting the specific antigen MUC16 according to any one of claims 1-4 is recovered and purified from the culture. The tumor is selected from the group consisting of carcinoma, lymphoma, medulloblastoma, retinoblastoma, liposarcoma, synovial cell sarcoma, carcinoid tumor, gastrinoma, islet cell carcinoma, mesothelioma, schwannoma, meningioma, adenocarcinoma and melanoma.

Images