Pantothenic acid synthase mutant as well as preparation method and application thereof
By mutating the 62nd amino acid of pantothenic acid synthase to A, a pantothenic acid synthase mutant V62A was prepared. The culture and catalytic conditions were optimized, which solved the problem of low enzyme activity and achieved a significant increase in D-pantothenic acid yield and conversion rate.
Patent Information
- Application Number
- CN202511713100.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-20
- Publication Date
- 2026-02-24
AI Technical Summary
The low enzyme activity of pantothenic acid synthase in existing technologies limits the yield of D-pantothenic acid.
A pantothenic acid synthase mutant, V62A, was prepared by mutating amino acid V at position 62 of pantothenic acid synthase to A. Enzyme activity was improved by controlling seed culture and fermentation temperatures as well as the final concentration of IPTG. Under specific conditions, the enzyme catalyzed the synthesis of D-pantothenic acid from the substrate.
It significantly improved the enzyme activity of pantothenic acid synthase and the yield of D-pantothenic acid, thereby increasing the substrate conversion rate.
Smart Images
Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
Technical Field
[0001] This invention relates to the field of pantothenic acid synthesis technology, and in particular to a pantothenic acid synthase mutant, its preparation method, and its application. Background Technology
[0002] Pantothenic acid, also known as vitamin B5, is a water-soluble B vitamin. It is optically active, and only its D form is biologically active. As a key precursor for coenzyme A synthesis in cells, D-pantothenic acid participates in the metabolism of carbohydrates, fats, and proteins in humans and animals, and is an essential trace element for maintaining normal physiological functions. Microorganisms and plants can synthesize D-pantothenic acid, but humans and other animals cannot. Therefore, D-pantothenic acid is widely used in the pharmaceutical, cosmetic, food, and animal feed industries.
[0003] Pantothenate synthetase (PS) is the expression product of the panC gene and exists in homodimer form. It is the last key enzyme in the pantothenate biosynthesis pathway, catalyzing the combination of D-pantolytic acid and β-alanine in an ATP-dependent reaction to form D-pantothenate.
[0004] In existing technologies, the production of D-pantothenic acid generally involves modifying the genome to construct engineered strains that can catalyze the production of D-pantothenic acid from glucose. However, the pantothenic acid synthase currently used has low enzyme activity, which limits the yield of D-pantothenic acid. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide a pantothenic acid synthase mutant, its preparation method and application, to overcome the defects of low pantothenic acid synthase activity and limited D-pantothenic acid yield in the prior art.
[0006] To achieve the above objectives, in a first aspect, the present invention provides a pantothenic acid synthase mutant, the mutant comprising: mutating V at position 62 of the amino acid sequence shown in SEQ ID NO.2 to A. The mutant is named V62A, and its amino acid sequence is shown in SEQ ID NO.8.
[0007] Compared with the prior art, the present invention significantly improves the enzyme activity of the pantothenic acid synthase mutant by mutating V to A at position 62 of the amino acid sequence shown in SEQ ID NO.2. Under the same substrate concentration, the pantothenic acid synthase mutant catalyzes the synthesis of D-pantothenic acid from the substrate to a significantly higher yield than the wild-type pantothenic acid synthase, thereby improving the conversion rate of D-pantothenic acid.
[0008] In a second aspect, the present invention provides a nucleic acid molecule encoding the pantothenic acid synthase mutant described above; wherein the nucleic acid molecule is shown in SEQ ID NO.7.
[0009] Thirdly, the present invention provides a recombinant vector containing the above-mentioned nucleic acid molecules.
[0010] Fourthly, the present invention provides a recombinant strain containing the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector.
[0011] Fifthly, the present invention provides a method for preparing a pantothenic acid synthase mutant, which includes the following steps: The above recombinant strains were seed cultured in LB medium for 12-16 h to obtain seed culture. The seed culture was inoculated into another LB medium for fermentation culture until OD was reached. 600 After the value is 0.6~0.8, the temperature is lowered and IPTG is added to induce the synthesis of the pantothenic acid synthase mutant, thus obtaining a fermentation broth containing the pantothenic acid synthase mutant. Centrifuge the fermentation broth, collect the cells, resuspend and break them, then centrifuge again, and take the supernatant as the crude enzyme solution.
[0012] Furthermore, the seed culture temperature is 35~40℃.
[0013] Furthermore, the fermentation culture temperature is 35~40℃.
[0014] Furthermore, the cooling is described as cooling to 16~20℃.
[0015] Furthermore, the final concentration of IPTG is 0.01 mM to 0.05 mM.
[0016] Compared with the prior art, the present invention further improves the enzyme activity of crude pantothenic acid synthase in the crude enzyme solution by controlling the seed culture temperature, fermentation temperature and final IPTG concentration when preparing pantothenic acid synthase mutant.
[0017] In a sixth aspect, the present invention provides the application of the above-mentioned pantothenic acid synthase mutant, nucleic acid molecule, recombinant vector or recombinant strain in the production of D-pantothenic acid.
[0018] Compared with existing technologies, the production of D-pantothenic acid using the pantothenic acid synthase mutant of the present invention, or a nucleic acid molecule encoding the pantothenic acid synthase mutant, or a recombinant vector or recombinant strain containing a nucleic acid molecule encoding the pantothenic acid synthase mutant, can significantly improve the yield and substrate conversion rate of D-pantothenic acid.
[0019] In a seventh aspect, the present invention provides a method for preparing D-pantothenic acid, wherein the crude enzyme solution obtained above catalyzes the synthesis of D-pantothenic acid from D-pantolytic acid and β-alanine; The concentrations of each component in the reaction system for synthesizing D-pantothenic acid are as follows: The mixture consists of a crude enzyme solution with a final concentration of 1 mg / mL to 5 mg / mL, a buffer solution of 40 mM to 60 mM with a pH of 6.5 to 7.5, 4 mM to 5 mM ATP, 10 mg / mL to 15 mg / mL D-pantolytic acid, 4 mg / mL to 8 mg / mL β-alanine, and 50 mM to 60 mM ion regulator.
[0020] It should be understood that "crude enzyme solution with a final concentration of 1 mg / mL to 5 mg / mL" means that after adding crude enzyme solution to the reaction system, the final concentration of pantothenic acid synthase crude enzyme in the reaction system is 1 mg / mL to 5 mg / mL.
[0021] Compared with the prior art, the present invention uses crude enzyme solution of pantothenic acid synthase mutant containing the above-mentioned specific mutation to prepare D-pantothenic acid. Under the same substrate concentration, the yield of D-pantothenic acid synthase mutant catalyzing substrate synthesis is significantly higher than that of wild-type pantothenic acid synthase catalyzing substrate synthesis.
[0022] Furthermore, the buffer solution includes sodium phosphate buffer, Tris-HCl buffer, or HEPES buffer.
[0023] Furthermore, the ion regulator comprises 25mM~30mM magnesium chloride and 25mM~30mM potassium chloride.
[0024] Furthermore, the catalytic temperature of the reaction system is 30℃~35℃.
[0025] Compared with the prior art, the present invention utilizes the above-mentioned specific pantothenic acid synthase mutant to catalyze the production of D-pantothenic acid from the substrate, and further improves the yield and substrate conversion rate of D-pantothenic acid by precisely controlling the enzyme concentration, substrate concentration, ion regulator concentration and catalytic temperature. Detailed Implementation
[0026] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.
[0027] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.
[0028] Example 1: Construction of the original plasmid pET28a-panC
[0029] The method for constructing the pET28a-panC plasmid is as follows: S1, pET28a vector linearization: Restriction endonucleases BamHI and Hind were added to the pET28a vector. The linearized pET28a vector was obtained by digestion at 37℃ for 20 min. The digestion system is shown in Table 1.
[0030] Table 1 Enzyme digestion system (50 μL) S2. The gene encoding pantothenic acid synthase derived from Bacillus brevis was optimized and synthesized to obtain the artificially synthesized panC gene. Using the artificially synthesized panC gene as a template, PCR amplification was performed using primers F1 and R1 to obtain the target gene with the same restriction sites at both ends as the linearized vector pET28a.
[0031] The nucleotide sequence of the wild-type pantothenic acid synthase gene panC is shown in SEQ ID NO.1, and the amino acid sequence of the wild-type pantothenic acid synthase it encodes is shown in SEQ ID NO.2.
[0032] The primer sequences are as follows: Forward primer: F1-CGCGGATCCGCGATGATGCAGACTATGATGCAAC, SEQ ID NO.3; Reverse primer: R1-CCAAGCTTGGCTATTTGATAGAGGTGATGGTG, SEQ ID NO.4.
[0033] The PCR amplification system is shown in Table 2, and the amplification conditions are shown in Table 3.
[0034] Table 2 Amplification system (20 μL) Table 3 Amplification conditions It should be understood that the pre-denaturation and preservation steps are not involved in the cycling process, and the entire PCR process is performed only once.
[0035] The target fragment obtained after the above amplification was digested according to the enzyme digestion system shown in Table 1. The template (panC fragment) in Table 1 was replaced with the target fragment obtained after amplification. After digestion, the fragment carrying BamHI and Hind was obtained. The target gene with sticky ends.
[0036] S3. Ligation: At 16℃, the linearized pET28a vector was mixed with the enzyme-digested target gene, gently shaken, and ligation was completed after 12 hours to obtain the recombinant plasmid. The ligation system is shown in Table 4.
[0037] Table 4. Connecting system (20 μL) S4. The above recombinant plasmid was transformed into E. coli DH5α competent cells using a chemical transformation method. Specifically, the recombinant plasmid was added to E. coli DH5α competent cells. The mixture was placed on ice for 30 min, then heat-shocked in a 42℃ water bath for 60 s, followed by incubation on ice for 5 min. The mixture was then transferred to 500 μL of LB broth and incubated at 37℃ with shaking for 1 h. 100 μL of the bacterial culture was plated. Single colonies were picked from the plate for plasmid extraction and DNA sequencing. The successfully sequenced plasmid was named pET28a-panC plasmid, which contains the wild-type pantothenic acid synthase gene.
[0038] Example 2: Mutant plasmid pET28a-panC V62A Construction: Construction of mutant plasmid pET28a-panC V62A The method is as follows: S1. Using the plasmid pET28a-panC obtained in Example 1 as a template, reverse PCR was performed on the template using V62A mutation primers to obtain the mutant plasmid pET28a-panC containing the mutant nucleotide fragment. V62A .
[0039] The primer sequences for the V62A mutation are as follows: Forward primer: V62A-F: TCTATCTTCGCCAACCCGCTGCAGTTCGGTCC, SEQ ID NO.5.
[0040] Reverse primer: V62A-R: GGGTTGGCGAAGATAGACATCACCACCAGATCG, SEQ ID NO.6.
[0041] The sequence of the mutant nucleotide fragment is shown in SEQ ID NO.7, and the amino acid sequence it encodes, namely the amino acid sequence of the pantothenic acid synthase mutant V62A, is shown in SEQ ID NO.8.
[0042] The reaction system for reverse PCR is shown in Table 5, and the reaction conditions are shown in Table 6.
[0043] Table 5. Reaction system for reverse PCR (20 μL) Note: In Table 5, the concentrations of V62A-F and V62A-R are both 10 pmol / μL, and the concentration of the template DAN pET28a-panC is 50 ng / μL.
[0044] Table 6 Reverse PCR Reaction Conditions It should be understood that the 94℃ pre-denaturation and 4℃ storage steps are not included in the cycle, and the entire reverse PCR process is performed only once.
[0045] S2, Template Elimination: Add 1 μL of restriction endonuclease DpnⅠ to the reaction solution after the above reverse PCR, mix well by pipetting; react at 37℃ for 1 h to obtain the digestion solution, and then verify the digestion solution by agarose gel electrophoresis.
[0046] S3. PCR product self-cyclization: Prepare the reaction solution according to Table 7, mix gently, and react at 16℃ for 1 h to obtain the cyclized product.
[0047] Table 7 Product cyclization system (15 μL) S4. Mutant Plasmid Verification: The circularized product was transformed into E. coli DH5α competent cells via chemical transformation. The specific procedure was as follows: the circularized product was added to E. coli DH5α competent cells, placed on ice for 30 min, then heat-shocked in a 42℃ water bath for 60 s, followed by incubation on ice for 5 min. Finally, 500 μL of LB broth was added, and the cells were allowed to recover at 37℃ with shaking for 1 h. 100 μL of the bacterial culture was plated, and single colonies were picked for plasmid extraction and DNA sequencing. The successfully mutated plasmid was named... .
[0048] Example 3 Construction and Induced Expression of Recombinant Strains S1. Take 1 μL of the correctly sequenced sample from Example 2. Recombinant plasmids were added to *E. coli* BL21(DE3) competent cells, placed on ice for 30 min, then heat-shocked in a 42°C water bath for 60 s, and finally incubated on ice for 5 min. Then, 500 μL of LB liquid culture was added, and the cells were allowed to recover at 37°C with shaking for 1 h. 100 μL of the bacterial culture was then plated. Positive transformants were picked and inoculated into liquid LB medium, and cultured at 37°C and 120 rpm for 16 h to obtain seed culture. The seed culture was then inoculated into fresh LB medium at 2% of the total LB medium volume and cultured at 37°C until OD (Organic Difference) was reached. 600 The value was 0.8, then the temperature was lowered to 18℃, and IPTG with a final concentration of 0.01mM was added for induction for 18h to obtain the fermentation broth.
[0049] Example 4: Preparation of crude enzyme solution The crude enzyme solution was prepared using the fermentation broth obtained in Example 3, as follows: The fermentation broth obtained in Example 3 was centrifuged at 8000 rpm for 15 min at 4 °C. The precipitated bacterial cells were collected and resuspended in 50 mmol / L sodium phosphate buffer (pH 7.5). The bacterial cells were then disrupted using an ultrasonic cell disruptor at 70 W. During disruption, the cells were disrupted for 2 seconds, paused for 3 seconds, and continued for 20 min. Then, the mixture was centrifuged at 12000 rpm for 1 h at 4 °C. The supernatant was collected, which was the crude enzyme solution of pantothenic acid synthase mutant V62A. The concentration of pantothenic acid synthase mutant V62A crude enzyme in this crude enzyme solution was 6 mg / mL.
[0050] Then, the recombinant strain was constructed using plasmid pET28a-panC according to the method in Example 5, and expression was induced to obtain fermentation broth. Crude enzyme solution was prepared according to the method in Example 4 to obtain crude wild-type pantothenic acid synthase solution, in which the concentration of crude wild-type pantothenic acid synthase was 6 mg / mL.
[0051] Example 5 Enzyme Activity Assay The relative enzyme activity of pantothenic acid synthase mutant V62A was determined, and the procedure is as follows: S1. Prepare two enzymatic hydrolysis reaction systems, each 10 mL, including: 50 mmol / L sodium phosphate buffer (pH 7.5), 25 mM D-pantolytic acid, 25 mM β-alanine, 4.5 mM ATP, 10 mM magnesium chloride, and 15 mM potassium chloride.
[0052] S2. Add the crude enzyme solution of pantothenic acid synthase mutant V62A and the crude enzyme solution of wild-type pantothenic acid synthase to the two enzymatic reaction systems mentioned above, so that the final concentrations of the crude enzyme of pantothenic acid synthase mutant V62A and the crude enzyme of wild-type pantothenic acid synthase in the reaction system are both 2 mg / mL, and react at 30℃ for 45 min.
[0053] The relative activity of the crude pantothenic acid synthase mutant V62A was calculated with 1 μM D-pantothenic acid produced per minute as one unit of activity and wild-type enzyme activity as 100%. The results are shown in Table 8.
[0054] Table 8 Enzyme activity of crude enzyme solution
[0055] As shown in Table 8, the crude enzyme activity of mutant V62A was increased by 48% compared with that of wild type.
[0056] Example 6: Preparation of D-pantothenic acid and determination of substrate conversion. The process for preparing D-pantothenic acid is as follows: S1. Prepare two reaction systems, each 10 mL, including: 50 mmol / L sodium phosphate buffer (pH 7.5), 12 mg / mL L-pantolytic acid, 6 mg / mL β-alanine, 4.5 mM ATP, 25 mM magnesium chloride, and 30 mM potassium chloride.
[0057] S2. Add the crude enzyme solution of pantothenic acid synthase mutant V62A and the crude enzyme solution of wild-type pantothenic acid synthase prepared in Example 4 to the two reaction systems respectively, so that the final concentration of the crude enzyme of pantothenic acid synthase mutant V62A and the crude enzyme of wild-type pantothenic acid synthase in the reaction system is 2 mg / mL, and react at 30°C for 45 min.
[0058] S3. The residual content of D-pantothenic acid and the yield of D-pantothenic acid in the reaction system were detected by HPLC, and the conversion rate of D-pantothenic acid was calculated.
[0059] The conversion rate of D-pantothenic acid is [(mass of initial D-pantothenic acid - mass of remaining D-pantothenic acid after reaction) / mass of initial D-pantothenic acid] × 100%.
[0060] The elution conditions for D-pantolytic acid and D-pantothenic acid using the HPLC method are as follows: The mobile phase is an aqueous solution containing 4.9% acetonitrile and 1‰ phosphoric acid by mass.
[0061] Column type: C18 column (4.6×250 mm, 5μm).
[0062] Liquid chromatography parameters: column temperature 30℃, sample injection volume 10μL, flow rate 1.0mL / min.
[0063] Then, detection was performed at a wavelength of 200 nm based on the peak area, with a detection time of 20 minutes.
[0064] The results are shown in Table 9.
[0065] Table 9. D-Pantothenic Acid Yield and D-Pantothenic Acid Conversion Rate As shown in Table 9, compared with the wild-type pantothenic acid synthase, the pantothenic acid synthase mutant V62A improved the conversion rate of the substrate D-pantolysin during the synthesis of D-pantothenic acid, and the yield of D-pantothenic acid was increased by 30.80% compared with the wild type.
[0066] The embodiments of this disclosure have been described above. However, these embodiments are for illustrative purposes only and are not intended to limit the scope of this disclosure. The scope of this disclosure is defined by the appended claims and their equivalents. Various substitutions and modifications can be made by those skilled in the art without departing from the scope of this disclosure, and all such substitutions and modifications should fall within the scope of this disclosure.
Claims
1. A pantothenic acid synthase mutant, characterized in that, The mutant includes a mutation of V at position 62 of the amino acid sequence shown in SEQ ID NO.2 to A.
2. A nucleic acid molecule encoding the pantothenic acid synthase mutant of claim 1.
3. A recombinant vector containing the nucleic acid molecule of claim 2.
4. A recombinant strain containing the nucleic acid molecule of claim 2 or the recombinant vector of claim 3.
5. A method for preparing a pantothenic acid synthase mutant, used to prepare the pantothenic acid synthase mutant of claim 1, characterized in that, The process includes the following: The recombinant strain described in claim 4 was seed cultured in LB medium for 12-16 h to obtain a seed solution; The seed culture was inoculated into another LB medium for fermentation culture until OD was reached. 600 After the value is 0.6~0.8, the temperature is lowered and IPTG is added to induce the synthesis of the pantothenic acid synthase mutant, thus obtaining a fermentation broth containing the pantothenic acid synthase mutant. Centrifuge the fermentation broth, collect the cells, resuspend and break them, then centrifuge again, and take the supernatant as the crude enzyme solution.
6. The method for preparing the pantothenic acid synthase mutant according to claim 5, characterized in that, The seed culture temperature is 35-40℃; and / or, The fermentation culture temperature is 35~40℃; and / or, The cooling is to reduce the temperature to 16~20℃; and / or, The final concentration of IPTG is 0.01 mM to 0.05 mM.
7. The use of the pantothenic acid synthase mutant of claim 1, the nucleic acid molecule of claim 2, the recombinant vector of claim 3, or the recombinant strain of claim 4 in the production of D-pantothenic acid.
8. A method for preparing D-pantothenic acid, characterized in that, The crude enzyme solution prepared according to claim 6 catalyzes the synthesis of D-pantothenic acid from D-pantothenic acid and β-alanine; The concentrations of each component in the reaction system for synthesizing D-pantothenic acid are as follows: The mixture consists of a crude enzyme solution with a final concentration of 1 mg / mL to 5 mg / mL, a buffer solution of 40 mM to 60 mM with a pH of 6.5 to 7.5, 4 mM to 5 mM ATP, 10 mg / mL to 15 mg / mL D-pantolytic acid, 4 g / L to 8 g / L β-alanine, and 50 mM to 60 mM ion regulator.
9. The method for preparing D-pantothenic acid according to claim 8, characterized in that, The buffer solution includes sodium phosphate buffer, Tris-HCl buffer, or HEPES buffer; and / or, The ion regulator comprises 25mM~30mM magnesium chloride and 25mM~30mM potassium chloride.
10. The method for preparing D-pantothenic acid according to claim 8 or 9, characterized in that, The catalytic temperature of the reaction system is 30℃~35℃.