Inositol dehydrogenase mutant and preparation method of D-chiral inositol

Abstract

The invention discloses an inositol dehydrogenase mutant and a preparation method of D-chiral inositol, and belongs to the technical field of genetic engineering. The inositol dehydrogenase mutant is obtained by mutating an amino acid sequence as shown in SEQ ID NO.2 through the following mutations: the 200th amino acid is mutated into C from V, the 234th amino acid is mutated into Q from V, and the 256th amino acid is mutated into E from R. According to the invention, the amino acid sequence of wild type inositol dehydrogenase is mutated to obtain the inositol dehydrogenase mutant which is a high-activity mutant capable of catalyzing conversion of myo-inositol into 2-keto-myo-inositol; therefore, when the inositol dehydrogenase mutant and keto isomerase act together to prepare D-chiral inositol by taking myo-inositol as a substrate, the yield of the D-chiral inositol is effectively improved.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an inositol dehydrogenase mutant and a method for preparing D-chiral inositol. Background Technology

[0002] D-Chiral Inositol is one of the nine isomers of inositol that is optically active. In nature, it is commonly found in compound form in plants such as legumes and buckwheat, as well as in insects. In the pharmaceutical and health product fields, D-chiral inositol can be used as an ingredient in diabetes management preparations and adjunctive treatment products for polycystic ovary syndrome. In the food industry, D-chiral inositol can be added to beverages and dairy products as a nutritional fortifier, and can also be formulated into dietary supplements such as capsules and tablets. In the cosmetics industry, D-chiral inositol can be used in functional skincare products due to its antioxidant properties.

[0003] In existing technologies, firstly, D-chiral inositol can be obtained by chemical hydrolysis, mixing an aqueous solution of kasugamycin with a strongly acidic ion exchange resin and carrying out the hydrolysis reaction under heating conditions. After the reaction, it is purified by separation through an ion exchange resin column and finally crystallized. However, the raw material kasugamycin is limited in source and expensive. Secondly, D-chiral inositol can also be extracted from plants, but the content of D-chiral inositol in plants is very low, the separation cost is high, and it is not easy to scale up production. Finally, D-chiral inositol can be produced by biocatalysis, using inositol dehydrogenase and ketoisomerase to catalyze the reaction of muscle inositol. However, this method is greatly affected by enzyme activity, resulting in low yield of D-chiral inositol. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide an inositol dehydrogenase mutant and a method for preparing D-chiral inositol, so as to overcome the problem of low D-chiral inositol yield due to the influence of enzyme activity in the prior art.

[0005] In a first aspect, the present invention provides an inositol dehydrogenase mutant, said inositol dehydrogenase mutant being obtained by mutagenesis of the amino acid sequence shown in SEQ ID NO.2 as follows: The 200th amino acid is mutated from V to C, the 234th amino acid is mutated from V to Q, and the 256th amino acid is mutated from R to E.

[0006] Compared with the prior art, the amino acid sequence of wild-type inositol dehydrogenase obtained by the present invention is a highly active mutant that catalyzes the conversion of muscle inositol to 2-keto-muscle inositol. Therefore, when the inositol dehydrogenase mutant works together with ketoisomerase to prepare D-chiral inositol using muscle inositol as a substrate, it effectively increases the yield of D-chiral inositol.

[0007] Secondly, the present invention provides a nucleic acid molecule that encodes the above-mentioned inositol dehydrogenase mutant.

[0008] Optionally, the nucleotide sequence of the nucleic acid molecule encoding the above-mentioned inositol dehydrogenase mutant is shown in SEQ ID NO.3.

[0009] Thirdly, the present invention provides an expression vector containing the above-mentioned nucleic acid molecules.

[0010] Fourthly, the present invention provides a recombinant strain containing the aforementioned nucleic acid molecule or expression vector.

[0011] Fifthly, the present invention provides a method for preparing an inositol dehydrogenase mutant, which includes the following steps: The above recombinant strains were cultured in LB medium for 12-16 hours to obtain seed culture. The seed culture was inoculated into another LB medium at a volume ratio of 1% to 5% for fermentation culture, and the OD was calculated. 600 When the concentration is 0.6~0.8, add IPTG to a final concentration of 0.01~1mM for induction culture, and cultivate OD... 600 The concentration was 2.0~5.0, resulting in a fermentation broth containing an inositol dehydrogenase mutant; Centrifuge the fermentation broth, collect the bacterial cells, resuspend the bacterial cells, break the bacterial cells, centrifuge and collect the supernatant to obtain the crude enzyme solution of inositol dehydrogenase mutant.

[0012] Compared with the prior art, the present invention can prepare crude enzyme solution of inositol dehydrogenase mutant simply, conveniently and quickly using the above method.

[0013] Furthermore, the seed culture temperature is 35℃~40℃, and the rotation speed is 180~250 rpm; and / or, The fermentation temperature was 35℃~40℃, and the rotation speed was 180~250 rpm; and / or, The induction culture temperature is 16℃~35℃, and the rotation speed is 180~250 rpm.

[0014] In a sixth aspect, the present invention provides the use of the above-mentioned inositol dehydrogenase mutant, the above-mentioned nucleic acid molecule, the above-mentioned expression vector or the above-mentioned recombinant strain in the preparation of D-chiral inositol.

[0015] In a seventh aspect, the present invention provides a method for preparing D-chiral inositol, using the above-mentioned inositol dehydrogenase mutant and ketoisomerase to catalyze the reaction of muscle inositol and NAD. + The reaction produces D-chiral inositol.

[0016] Compared with existing technologies, the inositol dehydrogenase mutant obtained by mutation in this invention has higher enzyme activity, capable of catalyzing the conversion of muscle inositol to 2-keto-muscle inositol, and catalyzing the reaction of muscle inositol and NAD together with ketoisomerase. + The reaction further improved the substrate conversion and the yield of D-chiral inositol when D-chiral inositol was generated.

[0017] Furthermore, the preparation method for the reaction system to generate D-chiral inositol is as follows: Add muscle inositol and NAD to the reaction system + The reaction system contains crude enzyme solution of inositol dehydrogenase mutant, ketoisomerase enzyme solution, metal ions, and phosphate buffer to achieve a concentration of 25-35 mM in muscle inositol and NAD+. + The concentrations of the enzymes were 1-3 mM, the crude inositol dehydrogenase mutant was 0.5-5 mg / mL, the ketoisomerase was 0.5-5 mg / mL, the metal ion concentration was 0.1-2.5 mM, and the phosphate buffer concentration was 50-100 mM.

[0018] Furthermore, the reaction temperature is 35℃~40℃, and the pH value is 7.0~8.0; and / or, The metal ions originate from manganese chloride, zinc chloride, or cobalt chloride. Detailed Implementation

[0019] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0020] It should be understood that, unless otherwise specified, all raw materials used in the following examples are commercially available.

[0021] Example 1 Construction of plasmid pET28a-IDH The nucleotide sequence of the wild-type inositol dehydrogenase gene was codon optimized to obtain the optimized wild-type inositol dehydrogenase gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the wild-type inositol dehydrogenase it encodes is shown in SEQ ID NO.2.

[0022] An optimized wild-type inositol dehydrogenase gene was artificially synthesized, and BamHI and HindIII restriction sites and protective bases were added to both ends of it.

[0023] The expression vector pET28a and the artificially synthesized optimized wild-type inositol dehydrogenase gene (IDH gene) were double-digested using restriction endonucleases BamHⅠ and HindⅢ, respectively, to obtain the linearized vector pET28a and the digested target gene IDH. The double digestion system is shown in Table 1.

[0024] Table 1 The target gene IDH, digested with T4 DNA ligase, was ligated with the linearized vector pET28a at 16°C for 2 hours to obtain the plasmid pET28a-IDH. The ligation system is shown in Table 2.

[0025] Table 2 Connection System The plasmid pET28a-IDH was transformed into Escherichia coli BL21(DE3) competent cells via chemical transformation, and then plated on LB agar containing kanamycin and incubated overnight at 37°C. Positive clones containing the pET28a-IDH plasmid were selected, which are the recombinant Escherichia coli BL21-pET28a-IDH expressing wild-type inositol dehydrogenase.

[0026] Example 2 Construction of plasmid mutant libraries The wild-type inositol dehydrogenase gene sequence (IDH) was randomly mutated using error-prone PCR to construct a mutant library: using the plasmid pET28a-IDH as a template and F1 and R1 as primers, the gene was amplified using the StarMut Random Mutagenesis Kit. The amplification system is shown in Table 3, and the amplification program is shown in Table 4.

[0027] F1: ATGGCTCTGACTGTGGGTGTTATTG (SEQ ID NO.5); R1: TTAGATAGCAGCAGCTGGGTTCACC (SEQ ID NO. 6).

[0028] Table 3 Table 4 It should be understood that the pre-denaturation, final extension, and storage steps do not participate in the cycle and are performed only once during the PCR amplification process.

[0029] After the error-prone PCR was completed, the PCR product was purified to obtain the mutant gene fragment of IDH. The expression vector pET28a and the mutant gene fragment of IDH were double-digested using restriction endonucleases BamHI and HindIII, respectively, to obtain the linearized vector pET28a and the digested mutant gene fragment of IDH. The digested mutant gene fragment of IDH was ligated to the linearized vector pET28a using T4 DNA ligase at 16℃ for 2 hours to obtain a plasmid containing the mutant gene of IDH. The double digestion system is shown in Table 5, and the ligation system is shown in Table 6.

[0030] Table 5 Table 6 After the ligation product was transferred into *E. coli* DH5α competent cells, the *E. coli* were incubated in a shaker for 50 min. After incubation, the *E. coli* were plated and incubated at 37°C for 10 h. After colony growth, 10 single-clone strains were randomly selected, cultured, and plasmids were extracted and sequenced. After ensuring that the mutation success rate, diversity, and randomness met the basic requirements for subsequent high-throughput screening, the colonies on the plates were collected, plasmids were extracted, and a plasmid mutant library was obtained and stored at -20°C for subsequent high-throughput screening of the mutant library.

[0031] Example 3 High-throughput screening of mutant libraries After the plasmid mutant library was constructed, the mixed plasmid was transformed into the expression host *Escherichia coli* BL21(DE3). Single colonies were picked from the plate and inoculated into the wells of a 96-well plate containing 800 μL of LB medium (containing 50 μg / mL kanamycin sulfate). The 96-well plate was placed in a shaker and cultured at 37°C and 350 rpm for 24 h to obtain the seed culture.

[0032] Dip the inoculation needle into the seed culture and transfer it to a new 96-well plate containing 800 μL of LB medium per well (LB medium contains 50 μg / mL kanamycin sulfate). Incubate at 37°C and 350 rpm until... When the concentration was 0.7, IPTG was added to a final concentration of 0.05 mM for induction culture, and the culture was carried out at 30℃ and 350 rpm for 20 h.

[0033] After induction culture, the 96-well plate was centrifuged at 4000 rpm for 30 min, the supernatant was discarded, and the bacterial cells remained in the wells. 100 μL of 1.5 mg / mL lysozyme solution was added to each well, and the mixture was thoroughly mixed to allow the lysozyme to fully act on the cells, lysing them and releasing the intracellular enzyme. After cell lysis, the 96-well plate was centrifuged in a refrigerated centrifuge at 4°C and 8000 rpm for 30 min. The resulting supernatant was the crude enzyme solution containing inositol dehydrogenase mutants with different mutation sites.

[0034] Enzyme activity detection: Using the crude enzyme solutions of inositol dehydrogenase mutants containing different mutation sites obtained above, reaction systems with a total volume of 1 mL were prepared. The reaction systems contained the following components: 2 mM muscle inositol, 0.2 mM 0.5 mg / mL crude inositol dehydrogenase mutant enzyme, 100 mM phosphate buffer at pH 7.5.

[0035] The reactions of each of the above reaction systems were terminated after being reacted at 37°C for 5 minutes.

[0036] In this reaction, when In its presence, inositol dehydrogenase reversibly catalyzes the conversion of the substrate myositol to 2-keto-myositol. Convert to NADH.

[0037] Detection of enzyme activity of inositol dehydrogenase mutants in the above reaction systems: .

[0038] Where ΔA refers to the change in absorbance at 340 nm over 5 minutes; V is the total volume of the reaction system (mL); 6220 refers to the molar extinction coefficient of NADH (…). ); l is the optical path distance, i.e., the optical path of the cuvette (cm).

[0039] The inositol dehydrogenase mutant used in the reaction solution with high enzyme activity was screened out and verified in shake flasks.

[0040] Shaking bottle verification: After screening with 96-well plates to obtain the inositol dehydrogenase mutant used in the reaction solution with high enzyme activity, single colonies expressing the corresponding high-activity inositol dehydrogenase mutant and recombinant Escherichia coli expressing wild-type inositol dehydrogenase in Example 1 were picked. The seed culture was obtained by inoculating the seed culture into test tubes containing LB medium (containing 50 μg / mL kanamycin sulfate) and placing them in a shaker at 37°C and 220 rpm for 12 h.

[0041] The seed culture was inoculated into 20 mL of LB medium (containing 50 μg / mL kanamycin sulfate) at a volume ratio of 1%, and cultured with shaking at 37°C and 220 rpm until... When the concentration was 0.7, IPTG was added to a final concentration of 0.05 mM for induction culture, and the culture was carried out at 30℃ and 220 rpm for 18 h. With a value of 3.0, fermentation broths containing inositol dehydrogenase mutants and fermentation broths containing wild-type inositol dehydrogenase were obtained, respectively.

[0042] The fermentation broths obtained after the induction culture were centrifuged at 400 rpm for 20 min, and the cells were collected. The cells were resuspended in 100 mM phosphate buffer (pH 7.5) and then sonicated using an ultrasonic cell disruptor at 450 W for 2 seconds followed by a 3-second pause, for a total of 15 min. After sonication, the bacterial culture was centrifuged at 8000 rpm for 10 min, and the supernatant was collected to obtain crude enzyme solutions of inositol dehydrogenase mutant and wild-type inositol dehydrogenase, respectively.

[0043] The enzyme activity of crude enzyme solutions of inositol dehydrogenase mutant and wild-type inositol dehydrogenase obtained by shake-flask culture was detected using the same method described above.

[0044] After multiple initial screenings and shake-flask verifications of the mutant library using 96-well plates, a superior inositol dehydrogenase mutant, named MIDH, was finally obtained. Its enzyme activity is higher than that of wild-type inositol dehydrogenase, as shown in Table 7.

[0045] Table 7 Sequencing revealed that the inositol dehydrogenase mutant MIDH was obtained by mutating the amino acid sequence of wild-type inositol dehydrogenase as follows: amino acid position 200 was mutated from V to C, amino acid position 234 was mutated from V to Q, and amino acid position 256 was mutated from R to E.

[0046] The gene sequence of the above-mentioned inositol dehydrogenase mutant MIDH is shown in SEQ ID NO.3; the amino acid sequence of the inositol dehydrogenase mutant MIDH is shown in SEQ ID NO.4.

[0047] Example 4 Preparation of D-chiral inositol Reaction System 1: Add muscle inositol to the reaction system, The reaction mixture consisted of crude wild-type inositol dehydrogenase solution, ketoisomerase solution, manganese chloride, and phosphate buffer, with a total volume of 5 mL and a muscle inositol concentration of 30 mM. The concentrations of the following enzymes were: 2 mM of iodine dehydrogenase, 2 mg / mL of crude wild-type inositol dehydrogenase, 2 mg / mL of ketoisomerase, 1 mM of manganese chloride, 100 mM of phosphate buffer, and pH 7.5.

[0048] Reaction System Two: Add muscle inositol to the reaction system, The reaction mixture consisted of crude MIDH inositol dehydrogenase mutant enzyme solution, ketoisomerase enzyme solution, manganese chloride, and phosphate buffer, with a total volume of 5 mL. The concentration of muscle inositol in the reaction mixture was 30 mM, and NAD+ was also present. + The concentrations of the following enzymes were: 2 mM of iodine dehydrogenase mutant MIDH crude enzyme, 2 mg / mL of ketone isomerase, 1 mM of manganese chloride, 100 mM of phosphate buffer, and pH 7.5.

[0049] The two reaction systems were reacted at 37℃ for 90 min to obtain reaction solutions. The content of D-chiral inositol in the two reaction solutions was determined by high performance liquid chromatography (HPLC), and the conversion rate was calculated.

[0050] Conversion rate = (number of moles of D-chiral inositol at the reaction endpoint / number of moles of muscle inositol at the initial reaction) × 100%. The results are shown in Table 8.

[0051] Detection method: The chromatographic column is a 4.6 × 250 mm, 5 μm amino column; Mobile phase: Acetonitrile: 50 mM ammonium acetate aqueous solution = 75: 25 (volume ratio); The column temperature was set to 30℃ and the flow rate to 1.0 mL / min.

[0052] Table 8 The results above show that, compared with wild-type inositol dehydrogenase, the inositol dehydrogenase mutant MIDH screened in this invention has higher enzyme activity, which further improves the conversion rate of reaction substrates and the yield of D-chiral inositol.

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An inositol dehydrogenase mutant, characterized in that, The inositol dehydrogenase mutant was obtained by mutagenesis of the amino acid sequence shown in SEQ ID NO.2 as follows: The 200th amino acid is mutated from V to C, the 234th amino acid is mutated from V to Q, and the 256th amino acid is mutated from R to E.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the inositol dehydrogenase mutant of claim 1.

3. An expression carrier, characterized in that, The expression vector contains the nucleic acid molecule as described in claim 2.

4. A recombinant bacterial strain, characterized in that, The recombinant strain contains the nucleic acid molecule of claim 2 or the expression vector of claim 3.

5. A method for preparing an inositol dehydrogenase mutant, used to prepare the inositol dehydrogenase mutant of claim 1, characterized in that, Includes the following steps: The recombinant strain described in claim 4 was cultured in LB medium for 12-16 hours to obtain seed culture. The seed culture was inoculated into another LB medium at a volume ratio of 1% to 5% for fermentation culture, and the OD was calculated. 600 When the concentration is 0.6~0.8, add IPTG to a final concentration of 0.01~1mM for induction culture, and cultivate OD... 600 The concentration was 2.0~5.0, resulting in a fermentation broth containing an inositol dehydrogenase mutant; Centrifuge the fermentation broth, collect the bacterial cells, resuspend the bacterial cells, break the bacterial cells, centrifuge and collect the supernatant to obtain the crude enzyme solution of inositol dehydrogenase mutant.

6. The preparation method according to claim 5, characterized in that, The seed culture temperature is 35℃~40℃, and the rotation speed is 180~250 rpm; and / or, The fermentation culture temperature is 35℃~40℃, and the rotation speed is 180~250 rpm; and / or, The induction culture temperature is 16℃~35℃, and the rotation speed is 180~250 rpm.

7. The use of the inositol dehydrogenase mutant of claim 1, the nucleic acid molecule of claim 2, the expression vector of claim 3, or the recombinant strain of claim 4 in the preparation of D-chiral inositol.

8. A method for preparing D-chiral inositol, characterized in that, Using the inositol dehydrogenase mutant and ketoisomerase as described in claim 1, catalyze the reaction of muscle inositol and NAD. + The reaction produces D-chiral inositol.

9. The preparation method according to claim 8, characterized in that, The preparation method of the reaction system for generating D-chiral inositol is as follows: Add muscle inositol and NAD to the reaction system + The reaction system contains crude enzyme solution of inositol dehydrogenase mutant, ketoisomerase enzyme solution, metal ions, and phosphate buffer to achieve a concentration of 25-35 mM in muscle inositol and NAD+. + The concentrations of the enzymes were 1-3 mM, the crude inositol dehydrogenase mutant was 0.5-5 mg / mL, the ketoisomerase was 0.5-5 mg / mL, the metal ion concentration was 0.1-2.5 mM, and the phosphate buffer concentration was 50-150 mM.

10. The preparation method according to claim 9, characterized in that, The reaction temperature is 35℃~40℃, and the pH value is 7.0~8.0; and / or, The metal ions are derived from manganese chloride, zinc chloride, or cobalt chloride.

Images