Application of reagent and kit for detecting tsRNA for colon cancer diagnosis

Abstract

The invention belongs to the field of biomedicine, and relates to application of a reagent and a kit for detecting tsRNA for colon cancer diagnosis. The invention relates to application of a reagent for detecting tsRNA for colon cancer diagnosis in preparation of a product for detecting or predicting colon cancer. The sequence of the tsRNA for colon cancer diagnosis is GTAGAATTTCGCCTGCCACG. The tsRNA is separated through a large number of experiments, it is verified that the expression level of the tsRNA in a colon cancer patient is obviously higher than that of a healthy person, the high-level exosome tRF-21-S2I7L7P50 is remarkably related to T staging, lymph node metastasis and TNM staging characteristics of the patient, the AUC value of an ROC curve of serum tRF-21-S2I7L7P50 in colon cancer diagnosis is 0.870, and the tsRNA can be applied to diagnosis of colon cancer. The molecular marker is expected to become a novel biological marker for colon cancer screening and individualized treatment, and provides a new direction for colon cancer treatment.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedicine, and relates to the application of reagents and kits for detecting tsRNA for colon cancer diagnosis. BACKGROUND

[0002] Colon cancer has become a major public health problem worldwide, and the incidence of age is showing a trend of younger, which seriously threatens people's life and health. Although molecular typing and targeted therapy have improved the prognosis of colon cancer patients to some extent, the exploration of the mechanism of its occurrence and development is still insufficient, which restricts the further breakthrough of diagnosis and treatment strategies. Therefore, in-depth study of the molecular mechanism of the occurrence and development of colon cancer, and finding effective biomarkers and therapeutic targets, are of great significance for improving the early diagnosis rate of colon cancer and improving the survival prognosis of patients.

[0003] In recent years, liquid biopsy technology has become an important research direction to break through the bottleneck of early diagnosis of colon cancer due to its non-invasiveness and high sensitivity, etc. Compared with traditional tissue biopsy, liquid biopsy has the following advantages: (1) minimally invasive: only a small amount of peripheral blood needs to be collected for detection, avoiding the risk of complications such as bleeding and infection of traditional biopsy; (2) dynamic: real-time monitoring of treatment response can be achieved; (3) early: compared with imaging examination, it can detect tumor traces 3-6 months earlier; (4) comprehensive: through synchronous detection of circulating tumor nucleic acid, circulating tumor cells and exosomes, etc., the tumor heterogeneity can be overcome. Among them, circulating nucleic acid shows important value in early diagnosis of colon cancer due to its long half-life in blood circulation and strong anti-nucleic acid enzyme degradation ability. As a natural carrier of these circulating nucleic acids, exosomes not only provide a physical protection barrier for nucleic acids through their special double-layer membrane structure, but also retain the molecular characteristic information of the donor cells, which can significantly improve the sensitivity and specificity of circulating nucleic acid as a diagnostic marker.

[0004] In the post-genomic era, non-coding RNA research has made breakthrough progress. Among them, tRNA-derived small RNA (tsRNA) as a new type of regulatory molecule has attracted attention. tsRNA is a functional small RNA produced by precursor tRNA or mature tRNA through specific nuclease cleavage. According to the difference of enzyme cutting site, tsRNA can be divided into two subcategories of tRNA-derived stress-induced RNA (tiRNA) and tRNA-derived fragment (tRF). Studies have shown that tsRNA plays an important role in tumor occurrence and development by regulating epigenetic modification, transcription factor activity and translation process, etc. For example, it was found that 5'-tRF-Gly-GCC was significantly highly expressed in the plasma of patients with colon cancer, and was closely related to the progression and metastasis of colon cancer, which could be used as a potential diagnostic marker for colon cancer. It is worth noting that tsRNA can be selectively packaged by exosomes and stably exist in various body fluids, and plays an important role in cell communication. At present, the specific mechanism of tsRNA in colon cancer has not been fully elucidated. There are few reports on the role of serum exosomal tsRNA in the occurrence of colon cancer. SUMMARY

[0005] The purpose of the present application is to provide the application of reagent and kit for detecting tsRNA for colon cancer diagnosis.

[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is: The application of reagent for detecting tsRNA for colon cancer diagnosis in the preparation of products for detecting or predicting colon cancer, the sequence of the tsRNA for colon cancer diagnosis is GTAGAATTCTCGCCTGCCACG (SEQ ID NO. 1).

[0007] The tsRNA is named tRF-21-S2I7L7P50 in the present application. The particle size of the tsRNA is 30-150 nanometers; the marker of the tsRNA is CD9, CD81, TSG101, and does not express calnexin.

[0008] The present application selects 82 cases of colon cancer patients and 69 cases of healthy controls as research objects, finds that the serum exosomes of the colon cancer group can stably express tRF-21-S2I7L7P50, and the expression level is significantly higher than that of the healthy control group. Further research also found that higher levels of serum tRF-21-S2I7L7P50 were significantly related to T stage, lymph node metastasis and TNM stage characteristics of colon cancer patients. In summary, serum tRF-21-S2I7L7P50 has obvious advantages in the diagnosis of colon cancer, and is expected to become a new biological marker for colon cancer screening.

[0009] According to the embodiments of the present application, the present application can be further optimized, and the following is the technical solution formed after optimization:

[0010] In one preferred embodiment, the tsRNA for colon cancer diagnosis is derived from serum.

[0011] Compared with detecting the level of tRF-21-S2I7L7P50 in tissue, detecting the expression level of tRF-21-S2I7L7P50 in patient serum exosomes is less traumatic, so exploring the level of tRF-21-S2I7L7P50 in serum exosomes has the potential to become a colon cancer screening marker.

[0012] Based on the same inventive concept, the present application also claims the use of a reagent for detecting the above-mentioned tsRNA in the preparation of an early diagnosis of colon cancer product.

[0013] In one preferred embodiment, the expression amount of the above-mentioned tsRNA in colon cancer patients is 3.765 times different from that in healthy controls.

[0014] In one preferred embodiment, the product includes a kit, a reagent.

[0015] In one preferred embodiment, the reagent for detecting the above-mentioned tsRNA includes a specific probe, a primer, a chip or a nuclease.

[0016] In one preferred embodiment, the chip is any one of a small RNA expression chip or a PCR chip.

[0017] In one preferred embodiment, the small RNA expression chip is an Arraystar Small RNA expression chip.

[0018] In one preferred embodiment, the primers include: an upstream PCR primer F: GCGCGTTGGTCTAGGGGTAT (SEQ ID NO. 2); a downstream PCR primer R: AGTGCAGGGTCCGAGGTATT (SEQ ID NO. 3); a stem loop reverse transcription primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAATC (SEQ ID NO. 4).

[0019] Based on the same inventive concept, the present application also claims a kit for preparing a product for detecting or predicting colon cancer, the kit comprising the above-mentioned tsRNA or a reagent for detecting the above-mentioned tsRNA.

[0020] In one preferred embodiment, the kit further comprises PCR buffer, DNA polymerase and deionized water.

[0021] Compared with the prior art, the present application has the following beneficial effects: The present application isolates a tsRNA, tRF-21-S2I7L7P50, through a large number of experiments. It is verified that the expression level of the tsRNA in colon cancer patients is significantly higher than that in healthy people, and a higher level of exosome tRF-21-S2I7L7P50 is significantly related to patient T stage, lymph node metastasis and TNM stage characteristics. The AUC value of the ROC curve of serum tRF-21-S2I7L7P50 in colon cancer diagnosis is 0.870. The median expression amount of tRF-21-S2I7L7P50 as a threshold has a sensitivity of 0.826 and a specificity of 0.756, and is expected to become a new biological marker for colon cancer screening and individualized treatment, and provides a new direction for the treatment of colon cancer. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 A volcano plot of differentially expressed tsRNAs.

[0023] Figure 2 An electron transmission microscope graph of the characteristic morphology of exosomes.

[0024] Figure 3 A particle size detection graph of exosomes.

[0025] Figure 4 A Western blotting detection graph of exosome proteins.

[0026] Figure 5 A dot plot of the expression level of serum exosome tRF-21-S2I7L7P50 in colon cancer patients and healthy controls detected by qRT-PCR.

[0027] Figure 6 Dot plot of serum exosomal tRF-21-S2I7L7P50 expression levels for colon cancer patients as T1-T2 or T3-T4.

[0028] Figure 7 Dot plot of serum exosomal tRF-21-S2I7L7P50 expression levels for colon cancer patients with or without lymph node metastasis.

[0029] Figure 8 Dot plot of serum exosomal tRF-21-S2I7L7P50 expression levels for colon cancer patients as stage I-II or stage III-IV.

[0030] Figure 9 ROC curve plot of serum tRF-21-S2I7L7P50 as a biomarker for screening colon cancer. DETAILED DESCRIPTION

[0031] The present application is not limited to the following detailed description, and those skilled in the art can implement the present application in other various embodiments according to the disclosure of the present application, or any simple changes or modifications made by using the design structure and ideas of the present application, fall within the scope of the present application. It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict.

[0032] The present application uses SPSS 23.0 and GraphPad Prism 9.5 to statistically analyze the data. The statistical differences between groups are determined by Mann-Whitney U test or t-test, and the chi-square test is used for comparison between two groups of count data. In all tests, P<0.05 indicates a statistically significant difference.

[0033] Example 1

[0034] Isolation of tRF-21-S2I7L7P50 in serum exosomes

[0035] I. Experimental methods

[0036] 1. Clinical specimens Peripheral blood clinical samples were obtained from Xiangya Hospital of Central South University. All sample sources have signed informed consent, and other clinical information of the collected samples is complete. The experiment has obtained the approval of the Ethics Committee of Xiangya Hospital of Central South University.

[0037] The inclusion criteria for clinical specimens of peripheral blood clinical samples are as follows: (1) Histopathologically diagnosed as colon cancer; (2) No radiotherapy, chemotherapy or hormone therapy before admission; (3) Complete clinical data and related laboratory examination results; (4) Healthy controls were individuals without major disease history or chronic diseases recruited in the health examination center; (5) All enrolled patients signed the informed consent form.

[0038] Exclusion criteria for clinical specimens: (1) Presence of other malignancies; (2) Presence of severe dysfunction of important organs such as heart and lung; (3) Pregnant or lactating women.

[0039] 2. Extraction of peripheral blood exosomes

[0040] Peripheral blood collection: Serum samples from 82 colon cancer patients and 69 healthy controls were collected in the Department of Clinical Laboratory of Xiangya Hospital, Central South University. After collection, the venous blood samples were strictly controlled within 2 hours for processing. The venous blood samples were processed by standardized two-step centrifugation: first, 2000 x g centrifugation for 10 minutes to obtain cell-free serum, then 10,000 x g centrifugation at 4°C for 30 minutes to remove cell debris and platelets. Then the clear supernatant was collected and stored at -80°C for experimental analysis.

[0041] Exosome extraction: Serum was separated by exosome separation reagent (Yeasen, China) according to the manufacturer's instructions as follows: 1 ml of serum sample was centrifuged at 3000 x g for 10 minutes at 4°C, and the supernatant was transferred to a new centrifuge tube. The new centrifuge tube was centrifuged at 10,000 x g for 20 minutes at 4°C, and the precipitate was discarded. Then the supernatant was transferred to a clean tube containing 4 volumes of PBS and 1 volume of exosome separation reagent, mixed well to obtain a mixture. The mixture was incubated at 4°C for 2 hours, then centrifuged at 10,000 x g for 60 minutes, the supernatant was discarded, and PBS solution was added to the precipitate and blown to obtain a resuspension. The resuspension was centrifuged at 12,000 x g for 2 minutes at 4°C to obtain the exosome-rich supernatant for subsequent studies.

[0042] 3. Exosome identification

[0043] 3.1 Transmission electron microscopy (Hitachi, Japan) detection of exosomes

[0044] An appropriate amount of sample was added to the copper grid, and after standing for 3 minutes, the excess liquid was absorbed with a dry filter paper strip from the edge of the copper grid. Then 3% phosphotungstic acid staining solution (pH 7.0) was added to the copper grid, and after standing for 3 minutes, the excess staining solution was again absorbed with a dry filter paper. Finally, double distilled water (ddH2O) was added for washing, and after the water was absorbed, it was dried at room temperature. The exosomes were then observed under a transmission electron microscope for morphology and size.

[0045] 3.2, Particle size detection of exosomes

[0046] The size distribution of serum exosomes was analyzed using nanoscale flow cytometry (Reference: Welsh JA, Goberdhan DCI, O'Driscoll L, et al. Minimal information for studies of extracellular vesicles (MISEV2023): From basic to advanced approaches. J Extracell Vesicles. 2024;13(2):e12404.). After instrument calibration and performance verification using standardized nanospheres, 10 μL samples were analyzed using a N30E Nanoparticle Analyzer (NanoFCM Inc., China).

[0047] 3.3, Western blotting

[0048] The protein sample concentration was quantified using the BCA method, then 5x SDS-PAGE loading buffer was added at a ratio of 1:5, heated in a dry oven at 100°C for 5 minutes, and then stored at -80°C for later use. Prepare the appropriate concentration of separating gel and concentrated gel, and add the denatured protein sample to the loading well, and perform SDS-PAGE at a constant voltage of 100V for about 90 minutes. Before transferring the membrane, activate the PVDF membrane with methanol for 30 seconds and place it in the transfer solution. Place the sponge, filter paper, gel, PVDF membrane, filter paper, and sponge in the transfer clamp in order, paying attention to the electrode direction (black to black, white to red), and complete the transfer under a constant current of 200mA. After the transfer is complete, place the membrane face up in 5% skim milk blocking solution and incubate on a shaker at room temperature for 1 hour. After blocking, wash the membrane with PBST, cut the target band and place it in an antibody incubation box, add the corresponding primary antibody diluent (dilution ratio 1:1000), and incubate overnight at 4°C on a shaker. The information of the primary antibodies used is as follows: CD9 (Boster, BM4212), TSG101 (Abcam, ab125011), CD81 (SAB, 41779), calnexin (SAB, 12186). Then wash the membrane with PBST 3 times for 5 minutes each time, add the corresponding secondary antibody (Invitrogen, 31460), and incubate at room temperature on a shaker for 1 hour. Wash the membrane with PBST again 3 times for 5 minutes each time, prepare the chemiluminescence developing solution at a ratio of 1:1, absorb the residual liquid on the membrane surface, and then evenly drop the developing solution. Use the chemiluminescence imaging system for development and image acquisition.

[0049] The results of transmission electron microscopy observation are as follows Figure 2As shown, the results showed that the extracted exosomes were cup-shaped structures with a diameter of 30-150 nanometers, consistent with the size characteristics of exosomes.

[0050] The results of nanoflow cytometry detection are shown in Figure 3 As shown, the results showed that the exosome particles were monodisperse distribution, with a peak diameter of about 80 nanometers.

[0051] The results of Western blotting are shown in Figure 4 As shown, the results showed that specific marker proteins (CD9, CD81 and TSG101) were present in the exosomes, while the non-exosomal protein calnexin was not detected Figure 4 ). The above results showed that the exosome extraction was successful.

[0052] 4. Isolation and sequencing of tsRNAs

[0053] According to the manufacturer's instructions, Trizol reagent was used to extract total RNA of exosomes in serum of colon cancer patients and healthy controls. The company (Aksomics (Shanghai, China)) used agarose gel electrophoresis and NanoDrop ND-1000 (Thermo Fisher Scientific, Wilmington, USA) to evaluate the purity and concentration of RNA. And using Agilent Bioanalyzer 2100 for quantification, by setting the screening criteria (|log2FC|≥2, FDR<0.05) to draw the volcano plot of differentially expressed tsRNAs, as shown in Figure 1 The results showed that the number of up-regulated (red) tsRNAs was 3118, the number of non-differentially expressed (gray) tsRNAs was 5631, and the number of down-regulated (green) tsRNAs was 293. The first 6 differentially expressed tsRNAs were verified by subsequent PCR using an Illumina sequencer. Verification, sequencing and screening were commissioned by the same company. The first 6 serum exosome tsRNAs with the highest expression difference are shown in Table 1.

[0054] P refers to whether there is a statistically significant difference in the expression value of each group with 3 repeated statistics, i.e. P<0.05.

[0055] The sequence of tRF5c-1-29-chrM.tRNA4-IleGAT is: AGAAATATGTCTGATAAAAGAGTTACTTT (SEQ ID NO. 20).

[0056] The sequence of itRF-8-29-Glu-TTC-1 is: TGGTCTAGCGGTTAGGATTCCT (SEQ ID NO. 21).

[0057] The sequence of tRF3b-56-75-Trp-CCA-4 is: GAATCACGTCGGGGTCACCA (SEQ ID NO.22).

[0058] The sequence of tRF-21-S2I7L7P50 is: GTAGAATTCTCGCCTGCCACG (SEQ ID NO.1).

[0059] The sequence of Other-1-35-chrM.tRNA4-IleGAT is: AGAAATATGTCTGATAAAAGAGTTACTTTGATAGA (SEQ ID NO.23).

[0060] The sequence of itRF-7-27-Pro-AGG-1 is: TTGGTCTAGGGGTATGATTCT (SEQ ID NO.24).

[0061] The results showed that the fold change values ​​of all tsRNAs were greater than 10 and were upregulated; the P values ​​were all less than 0.05, indicating that the expression differences of these tsRNAs were statistically significant and may serve as candidates for molecular markers related to colorectal cancer.

[0062] Example 2

[0063] Verification of the relationship between the top 6 serum exosomal tsRNAs with the highest expression levels and colorectal cancer

[0064] Specific primers were used for reverse transcription and PCR amplification. The PCR amplification instrument was a Thermo Fisher QuantStudio 5. The specific procedure is as follows:

[0065] tsRNA reverse transcription (stem-loop method) was performed using a kit (Aikerui cDNA First-Strand Synthesis Kit), as follows:

[0066] (1) Take 1 μg tsRNA and mix it with 0.25 µM stem-loop reverse transcription primer, reverse transcriptase and buffer to form a 20 µL system. Gently mix and run in a PCR instrument under the following conditions: 25 °C for 5 minutes; reverse transcription at 42 °C for 15 minutes; heat at 85 °C for 5 seconds to terminate the reaction and obtain the template. Store the template at -20 °C for subsequent tsRNA qRT-PCR analysis.

[0067] (2) Perform tsRNA qRT-PCR analysis according to the instructions of the kit (Aikerui), and the corresponding primers are shown in Table 2.

[0068] The qPCR system contained 2×SYBR Green Pro Taq HS Premix I, ROX Reference Dye (4µM), and specific primers (0.2µM each of upstream PCR primer F and downstream PCR primer R). 1µL of reverse transcription product was added to each well, and enzyme-free water was added to a final volume of 20µL. Reaction conditions: 95℃ pre-denaturation for 30 seconds, 40 cycles (95℃ for 5 seconds, 60℃ for 30 seconds). The reaction was carried out using a 2-ΔΔ... CT Calculate the expression level. Where ΔΔ CT =(Ct target gene - Ct internal reference gene) 实验组 -(Ct target gene-Ct internal reference gene) 对照组 .

[0069] The results of tRF-21-S2I7L7P50 qRT-PCR are as follows: Figure 5 As shown, the results indicated that the expression level of tRF-21-S2I7L7P50 in colorectal cancer patients was significantly higher than that in healthy controls. Figure 5 ).

[0070] The results of qRT-PCR for the top 6 serum exosomal tsRNAs with the highest expression levels during sequencing are summarized in Table 3.

[0071] All six tsRNAs showed an upregulation trend in colorectal cancer patients, but tRF-21-S27L7P50 showed the largest upregulation (4.5315-fold). The expression differences of tRF3b-56-75-Trp-CCA-4, tRF-21-S27L7P50, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were statistically significant (P < 0.05). Although tRF5c-1-29-chrM.tRNA4-IleGAT and iiRF-8-29-Glu-TTC-1 showed the largest expression differences in previous studies, their P values ​​were greater than 0.05, indicating weaker statistical significance. tRF-21-S27L7P50 exhibits both "large upregulation magnitude + smallest P value," suggesting it could be a potential molecular marker for serum exosomal tsRNA in colorectal cancer.

[0072] Furthermore, this invention performed a correlation analysis between the expression level of tRF-21-S2I7L7P50 and clinicopathological parameters of colorectal cancer patients, and the results are shown in Tables 4 and 5.

[0073] Based on the median expression of tRF-21-S2I7L7P50 (fold change of 3.765), 82 patients with colorectal cancer were divided into a high-expression group and a low-expression group. The results showed that the expression level of tRF-21-S2I7L7P50 was significantly correlated with T stage, lymph node metastasis, and TNM stage characteristics (P<0.05); however, it was not correlated with gender, age, tumor size, metastasis, or CEA and CA199 expression levels (P>0.05).

[0074] Example 3

[0075] Serum exosomes tRF-21-S2I7L7P50 from colorectal cancer patients can serve as a biomarker for colorectal cancer screening.

[0076] Further subgrouping of 82 colorectal cancer patients into smaller groups and sequentially examining the expression differences of tRF-21-S2I7L7P50 between each group of colorectal cancer patients and controls, the results showed that the expression level of serum exosomal tRF-21-S2I7L7P50 in the T3-T4 group of colorectal cancer patients was significantly higher than that in the T1-T2 group. Figure 6 The expression level of serum exosomal tRF-21-S2I7L7P50 in colon cancer patients with lymph node metastasis was significantly higher than that in the non-metastatic group. Figure 7 The expression level of serum exosomal tRF-21-S2I7L7P50 in stage III-IV colorectal cancer patients was significantly higher than that in stage I-II. Figure 8 This suggests that serum exosome-derived tRF-21-S2I7L7P50 could serve as a biomarker for screening colon cancer and aid in the early diagnosis of colon cancer patients.

[0077] Example 4

[0078] Validating the feasibility of serum tRF-21-S2I7L7P50 as a biomarker for colorectal cancer screening

[0079] Serum samples from 80 colorectal cancer patients and healthy controls at the Department of Laboratory Medicine, Xiangya Hospital, Central South University, were collected again for blind testing. The inclusion criteria for cases were: (1) histopathological diagnosis of colorectal cancer; (2) no prior radiotherapy, chemotherapy or hormone therapy before admission; (3) complete clinical data and relevant laboratory test results; (4) healthy controls were individuals recruited from health check-up centers without a history of major diseases or chronic diseases; and (5) all included patients signed informed consent forms.

[0080] The exclusion criteria for cases were: (1) the presence of other malignant tumors; (2) the presence of severe dysfunction of vital organs such as the heart and lungs; and (3) pregnant or lactating women.

[0081] tRF-21-S2I7L7P50 was isolated according to the method in Example 1, and then reverse transcribed and amplified by PCR. Using the expression level of tRF-21-S2I7L7P50 as a predictive factor, the sensitivity and specificity at different disease thresholds were calculated, and ROC curves were plotted. The results are as follows: Figure 9 As shown.

[0082] The results showed that the AUC of the ROC curve was 0.870. Using the median expression of tRF-21-S2I7L7P50 (fold change of 3.765) as the cutoff value, samples with tRF-21-S2I7L7P50 levels above the median were predicted as colorectal cancer samples, while samples below the median were predicted as healthy samples. The sensitivity was 0.826, and the specificity was 0.756. This indicates that serum exosome tRF-21-S2I7L7P50 has good feasibility as a biomarker for colorectal cancer screening.

[0083] tRF3b-56-75-Trp-CCA-4, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were isolated using the same method and subjected to reverse transcription and PCR amplification. The expression levels of tRF3b-56-75-Trp-CCA-4, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were used as predictive factors. Sensitivity and specificity were calculated at different disease thresholds, and ROC curves were plotted. The results showed that the AUC of tRF3b-56-75-Trp-CCA-4, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were all below 0.7, and therefore could not be used independently as biomarkers for colorectal cancer screening.

[0084] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. The application of a reagent for detecting tsRNA used in the diagnosis of colorectal cancer in the preparation of products for detecting or predicting colorectal cancer, characterized in that, The sequence of the tsRNA used for colorectal cancer diagnosis is GTAGAATTCTCGCCTGCCACG.

2. The application according to claim 1, characterized in that, tsRNA is derived from serum.

3. The application according to claim 1, characterized in that, Compared to healthy controls, the expression level of the tsRNA used for colorectal cancer diagnosis differed by 3.765 fold in colorectal cancer patients.

4. The application according to claim 1, characterized in that, The products include reagent kits and reagents.

5. The application according to claim 1, characterized in that, Reagents for detecting tsRNA used in the diagnosis of colorectal cancer include specific probes, primers, chips, or nucleases.

6. The application according to claim 5, characterized in that, Primers include: upstream PCR primer F: GCGCGTTGGTCTAGGGGTAT; downstream PCR primer R: AGTGCAGGGTCCGAGGTATT; stem-loop reverse transcription primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAATC.

7. The application of a reagent kit in the preparation of products for detecting or predicting colorectal cancer, characterized in that, The kit includes tsRNA for colorectal cancer diagnosis or reagents for detecting tsRNA for colorectal cancer diagnosis; the sequence of the tsRNA for colorectal cancer diagnosis is GTAGAATTCTCGCCTGCCACG.

8. The application according to claim 7, characterized in that, The kit also includes PCR buffer, DNA polymerase, and deionized water.

9. The application according to claim 7, characterized in that, Reagents for detecting tsRNA used in the diagnosis of colorectal cancer include specific probes, primers, chips, or nucleases.

Images