Nucleic acid molecule for inhibiting or reducing expression of ANGPTL3 target gene and application thereof
By using a specially modified siRNA sequence and a GalNAc conjugate delivery system, highly efficient targeted inhibition of the ANGPTL3 gene was achieved, solving the problem of inhibiting ANGPTL3 expression in existing technologies, reducing blood lipid levels, and preventing and treating hyperlipidemia and cardiovascular diseases.
Patent Information
- Application Number
- CN202511133188.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-08-14
- Filing Date
- 2025-08-13
- Publication Date
- 2026-03-03
AI Technical Summary
Existing technologies are insufficient to effectively inhibit the expression of the ANGPTL3 gene, leading to an increased risk of hyperlipidemia and atherosclerotic cardiovascular disease. Furthermore, the liver targeting and tolerability of existing siRNA drugs need to be improved.
We designed and synthesized specially modified siRNA sequences, including nucleotides modified with 2'-O-methyl and 2'-fluorine, as well as thiophosphate bond substitutions, and combined them with the GalNAc conjugate delivery system to achieve highly efficient targeted inhibition of the ANGPTL3 gene.
It significantly inhibits ANGPTL3 gene expression, reduces LDL-C, VLDL-C and triglyceride levels in the blood, effectively prevents and treats hyperlipidemia and related cardiovascular diseases, and improves liver targeting and drug tolerance.
Smart Images

Figure BDA0005547325800000021 
Figure BDA0005547325800000037 
Figure BDA0005547325800000041
Abstract
Description
Technical Field
[0001] This invention relates to the field of siRNA, specifically to a nucleic acid molecule that inhibits or reduces the expression of ANGPTL3 target genes and its applications. Background Technology
[0002] Angiopoietin-like protein 3 (ANGPTL3) is a key regulator of serum lipid and lipoprotein metabolism, primarily expressed in the liver. It plays a role in regulating lipid metabolism by inhibiting lipoprotein lipase (LPL) and endothelial lipase (EL). LPL and EL are crucial in the catabolism of triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and very low-density lipoprotein cholesterol (VLDL-C). Mutations inactivating the ANGPTL3 gene can lead to decreased levels of TG, HDL-C, and LDL-C, thereby reducing the risk of atherosclerotic cardiovascular disease (ASCVD). Therefore, inhibiting ANGPTL3 activity or expression can be considered a lipid-lowering strategy.
[0003] Different types of inhibitors targeting ANGPTL3 have been developed. Among them, GalNAc-conjugated siRNA drugs have demonstrated excellent targeting performance on the liver, good tolerability, and long-lasting efficacy. Therefore, there is a need to develop siRNA drugs targeting this site to provide candidate drugs for the treatment of diseases caused by hyperlipidemia. Summary of the Invention
[0004] Based on this, the purpose of this invention is to provide a nucleic acid molecule and its application, wherein the nucleic acid molecule has a good biological activity of inhibiting or reducing the expression of ANGPTL3 target genes.
[0005] A first aspect of the present invention is to provide a nucleic acid molecule that inhibits or reduces the expression of ANGPTL3 target genes, comprising a sense strand and an antisense strand, wherein the siRNA is selected from at least one of the following pairs or modified sequences thereof:
[0006] A3-038: Its justice chain is shown in SEQ ID NO.75, and its antisense chain is shown in SEQ ID NO.76;
[0007] A3-041: Its justice chain is shown in SEQ ID NO.81, and its antisense chain is shown in SEQ ID NO.82.
[0008] In some embodiments, the bases of the positive chain are modified, including 2'-O-methyl modification of the bases at positions 1 to 6, 8, 12, 14, and from the penultimate to the penultimate bases; 2'-fluorination modification of the bases at positions 7, 9, and 11; and substitution of phosphodiester bonds between the penultimate and penultimate nucleotides, and between the penultimate and penultimate nucleotides, with thiophosphate bonds.
[0009] In some embodiments, the bases of the antisense chain are modified, including 2'-O-methyl modification of the bases at positions 1, 3, 5, 7, 11, 13, 15, the 1st to 5th from the end, and the 7th from the end of the antisense chain; 2'-fluorination modification of the bases at positions 2, 6, 8, 14, and the 8th from the end; substitution of phosphodiester bonds between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4 with thiophosphate bonds; and substitution of phosphodiester bonds between positions 1 and 2 from the end and between positions 2 and 3 from the end with thiophosphate bonds.
[0010] In some embodiments, the chain of justice is selected from any of the following:
[0011] mGmCmAmAmAmCfCmAfGmUfGmAfAmAfUmCmAmAmA*mG*mA,
[0012] mGmCmAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA,
[0013] mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA,
[0014] mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA,
[0015] mGmCmAmAmAmCfCmAfGfUfGmAfAmAfUmCmAmAmA*mG*mA,
[0016] UCUUUGAUUUCACUGGUUACUCAAmCmUmCmAmAmA,
[0017] mG*mU*mC*mAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmAmAmA,
[0018] mG*mU*mCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmAmAmA,
[0019] mG*mU*mCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA,
[0020] mG*mU*mC*mAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA,
[0021] mU*mC*mAmAmAmCfCmAfAfUfGmAmAmAmUmCmAmAmA*mG*mA,
[0022] mG*mC*mAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA, where f: 2'-fluorinated modification, m: 2'-O-methyl modification, and *: two adjacent nucleotides located to the left and right of * are linked by thiophosphate subunits.
[0023] In some implementations, the antisense chain is selected from at least one of the following:
[0024] mU*fC*mUmUmUfGmAfUmUfUmCmAmCfUmGfGmUmUmUmGmC*mA*mG,
[0025] mU*fC*mUfUmUfGmAfUfUmUmCmAmCfUmGfGmUfUmUmGmC*mA*mG,
[0026] mU*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG,
[0027] mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU,
[0028] mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU,
[0029] mU*fU*mUmGmAfGmUfUmGfAmGfUmUfCmAfAmGfUmGmAmC*mA*mU,
[0030] mU*fC*mUfUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG,
[0031] UUUGAGUUGAGUUCAAGUUGAAAUmCmAmAmAmGmA,
[0032] VP*fU*mU*fGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmA*mC*mA*mU,
[0033] VP*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU,
[0034] VP*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU,
[0035] VP*dT*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU,
[0036] VP*fU*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU,
[0037] VP*fU*mU*mGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmA*mC*mA*mU,
[0038] VP*fU*mU*mGmAfGmUfUmGfAmGmUmUdC*mAfAmGmUmGmA*mC*mA*mU,
[0039] VP*fU*mU*mGmAfGmUfUmGdA*mGmUmUdC*mAdA*mGmUmGmA*mC*mA*mU,
[0040] VP*fC*mUmUmUfGmAfUmUfUmCfAmUfUmGfGmUfUmUmGmA*mA*mG,
[0041] VP*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG, where f: 2'-fluorinated modification, m: 2'-O-methyl modification, *: two adjacent nucleotides located to the left and right of * are linked by a thiophosphate subunit, and VP: mU modified with VP.
[0042] The VP is a 5'-(E)-vinylphospho-3'-phosphate modified mU.
[0043] In some preferred embodiments, the siRNA is selected from at least one pair of the following modification sequences:
[0044] A3-041-2: Its justice chain is shown as mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA, and its antisense chain is shown as mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU;
[0045] A3-041-4: Its justice chain is shown as mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA, and its antisense chain is shown as mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU.
[0046] A second aspect of the present invention is the use of any of the above-mentioned nucleic acid molecules in the preparation of biological agents or pharmaceutical formulations that inhibit or reduce the expression of ANGPTL3 target genes.
[0047] A third aspect of the present invention is to provide a conjugate that inhibits or reduces the expression of ANGPTL3 target genes, said conjugate comprising any of the above-described nucleic acid molecules and a targeted delivery ligand linked to said nucleic acid molecule.
[0048] The targeted delivery ligand or other type of delivery vector described in this invention can be selected as a known N-acetylgalactosamine derivative (Galnac vector). Other types of delivery vectors, such as liposomes specifically delivered to liver cells, can be used in this invention as long as they can achieve siRNA delivery.
[0049] In some embodiments, the ligand is linked to the positive strand of a nucleic acid molecule, and the structure of the ligand is as follows:
[0050] R1 is the portion that binds to the asialoglycoprotein receptor (ASGPR).
[0051] R2 is -CH2-, C 6-14 Aromatic group, C 2-6 alkenyl or C 2-6 alkynyl group;
[0052] R3 is -O-、C 6-14 Aromatic or 3 to 10-membered heterocyclic groups;
[0053] R4 is -CH2-, C 6-14 Aryl or 3 to 10-membered heterocyclic groups;
[0054] R5 is -OH, -COOH,
[0055] PG is a carboxyl protecting group;
[0056] PG2 is a hydroxyl protecting group;
[0057] a, b, c, and d are each an independent integer from 1 to 10; n is any integer from 1 to 3.
[0058] In some embodiments, the terminal portion of R1 is galactose or N-acetylgalactosamine;
[0059] The R1 portion is selected from any of the following structures:
[0060]
[0061]
[0062] Where q and q' are each an independent integer from 1 to 10.
[0063] In some embodiments, the carboxyl protecting group is selected from succinate, pentafluorophenol ester, etc. Where h is any integer from 1 to 5.
[0064] In some embodiments, the hydroxyl protecting group is selected from silyl, monomethoxytriphenylmethyl (MMTr), 4,4'-dimethoxytriphenylmethyl (DMTr), and triphenylmethyl; optionally, the silyl group is selected from tert-butyldimethylsilyl ether (TBMDS), tert-butyldiphenylsilyl (TBDPS), and triisopropylsilyl ether (TIPS).
[0065] In some of these embodiments, the compound has the following structure:
[0066]
[0067]
[0068]
[0069]
[0070] In some embodiments, the conjugate formed by the connection of the positive chain and the ligand compound is:
[0071]
[0072] in,
[0073] R1 is the part that combines with ASGPR;
[0074] R2 is -CH2-, C 6-14 Aromatic group, C 2-6 alkenyl or C 2-6 alkynyl group;
[0075] R3 is -O-、C 6-14 Aromatic or 3 to 10-membered heterocyclic groups;
[0076] R4 is -CH2-, C 6-14 Aryl or 3 to 10-membered heterocyclic groups;
[0077] R is either O or S;
[0078] Rx is the siRNA;
[0079] a, b, c, and d are each an independent integer from 1 to 10;
[0080] n is any integer from 1 to 3.
[0081] A fourth aspect of the present invention is to provide the use of any of the above-described conjugates in the preparation of products for the prevention, relief or treatment of diseases caused by the expression of ANGPTL3 target genes.
[0082] In some embodiments, the product is a biological agent or a pharmaceutical preparation.
[0083] A fifth aspect of the present invention is to provide a pharmaceutical composition, wherein the active ingredient of the pharmaceutical composition comprises any of the above-described conjugates that inhibit or reduce the expression of the ANGPTL3 target gene, and pharmaceutically acceptable excipients.
[0084] A sixth aspect of the present invention is to provide a method for inhibiting or reducing the expression of ANGPTL3 target genes, the method comprising administering to a subject an appropriate dose of any of the above-mentioned nucleic acid molecules, the above-mentioned conjugates, and / or the above-mentioned pharmaceutical compositions.
[0085] A seventh aspect of the present invention is to provide a method for inhibiting or reducing the expression of ANGPTL3 target genes in cells, characterized by comprising the following steps:
[0086] (1) Obtain cells to be transfected and any of the above-mentioned nucleic acid molecules, any of the above-mentioned conjugates, or the above-mentioned drug composition;
[0087] (2) Mix the nucleic acid molecule or the conjugate or the pharmaceutical composition with the cells to be transfected and transfect the cells;
[0088] (3) Cell culture, obtained.
[0089] In some embodiments, the cells are in the subject's body, or the cells are in vitro cells of the subject.
[0090] In some implementations, the subject is a mammal, preferably a human.
[0091] In some implementations, the expression of ANGPTL3 target genes is suppressed by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.
[0092] The nucleic acid molecules or conjugates are used to prepare products for the prevention or treatment of diseases mediated by ANGPTL3 target genes. These diseases include, but are not limited to, dyslipidemia, cerebrovascular diseases, and cardiometabolic diseases. The nucleic acid molecules or conjugates, or biological or pharmaceutical preparations containing these substances, are used to reduce the levels of LDL-C, VLDL-C, HDL-C, and triglycerides (TG) in the body or cells of a subject.
[0093] The dyslipidemia includes hyperlipidemia and hypertriglyceridemia or high low-density lipoprotein (LDL).
[0094] Examples include prevention or treatment of or preventative treatment of cardiometabolic diseases associated with dyslipidemia, such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, thrombosis, coronary artery disease, heart attack, stroke, or aortic stenosis, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related conditions and diseases.
[0095] This invention, through extensive research and experimentation on nucleic acid molecules (siRNA sequences), screened multiple siRNAs capable of inhibiting the expression of the ANGPTL3 target gene. Based on this, appropriate modifications were made to enhance the silencing ability of the target and reduce non-target activity. Simultaneously, a self-developed delivery system was used to deliver the siRNAs directly to the liver for targeted action. These nucleic acid molecules and conjugates hold promise for clinical applications in the prevention and treatment of diseases related to the ANGPTL3 target gene, such as dyslipidemia, cerebrovascular diseases, and cardiometabolic diseases. Attached Figure Description
[0096] Figure 1 This is a schematic diagram showing the effect of A3-041-2 siRNA on the inhibition of ANGPTL3 gene expression.
[0097] Figure 2 This is a schematic diagram showing the effect of A3-041-4 siRNA on the inhibition of ANGPTL3 gene expression.
[0098] Figure 3 This is a schematic diagram showing the effect of A3-038-6 siRNA on the inhibition of ANGPTL3 gene expression.
[0099] Figure 4 This is a schematic diagram showing the effect of A3-038-6-1 siRNA on the inhibition of ANGPTL3 gene expression.
[0100] Figure 5 This is a schematic diagram showing the effect of A3-038-6-2 siRNA on the inhibition of ANGPTL3 gene expression.
[0101] Figure 6 This is the change in serum TG after drug administration in Experiment 1 of Example 4.
[0102] Figure 7 This refers to the changes in liver ANGPTL3 mRNA after drug administration in Experiment 1 of Example 4.
[0103] Figure 8 This refers to the change in serum TG after drug administration in Experiment 2 of Example 4.
[0104] Figure 9 This refers to the changes in liver ANGPTL3 mRNA after drug administration in Experiment 2 of Example 4.
[0105] Figure 10 Example 5: Changes in serum TG after drug administration.
[0106] Figure 11 Example 5: Changes in liver ANGPTL3 mRNA after drug administration.
[0107] Figure 12 This refers to the change in serum TG after drug administration in Experiment 3 of Example 4.
[0108] Figure 13 This refers to the change in serum TC after drug administration in Experiment 3 of Example 4.
[0109] Figure 14 This refers to the changes in liver ANGPTL3 mRNA after drug administration in Experiment 3 of Example 4.
[0110] Figure 15 This is the change in serum ANGPTL3 protein 18 days after drug administration in Experiment 3 of Example 4. Detailed Implementation
[0111] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0112] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in the fourth edition of *Molecular Cloning: A Laboratory Manual*, edited by Green and Sambrook, published in 2013, or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples are commercially available products.
[0113] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0114] In this invention, the terms "inducing," "inhibiting," "enhancing," "increasing," "reducing," and "lowering" generally indicate a quantitative difference between two states. For example, "the amount of ANGPTL3 activity or expression effectively inhibited" means that the level of ANGPTL3 activity or expression in the treated sample will be lower than the level of ANGPTL3 activity or expression in the untreated sample. These terms apply, for example, to expression levels and activity levels. The terms "reducing" and "lowering" are used interchangeably and generally indicate any change less than the original. "Reducing" and "lowering" are relative terms and need to be compared between before and after measurement. "Reducing" and "lowering" include complete depletion.
[0115] In some embodiments, the term "reduction" refers to an overall reduction, detectable by standard methods known in the art (such as those described herein), of the expression level / amount of a gene, gene product (e.g., protein), or biomarker in a first sample compared to the expression level / amount of the corresponding gene, gene product (e.g., protein), or biomarker in a second sample, by approximately 5% to 95% or 100%. In some embodiments, the term "reduction" refers to a reduction in the expression level / amount of a gene or biomarker in a test sample, wherein such reduction is at least approximately 0.9 to 0.01 times the expression level / amount of the corresponding gene or biomarker.
[0116] In this invention, the term "expression" generally refers to the process by which a gene ultimately produces a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.
[0117] In this invention, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. This also includes sterile water or physiological saline. Such preparations typically contain salts, excipients, buffers, preservatives, compatibility carriers, and optionally other therapeutic agents. When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these should not be excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium, potassium, or calcium salts.
[0118] In this invention, the term "prevention and / or treatment" includes not only the prevention and / or treatment of disease, but also generally includes preventing the onset of disease, slowing or reversing the progression of disease, preventing or slowing the onset of one or more symptoms associated with the disease, reducing and / or alleviating one or more symptoms associated with the disease, reducing the severity and / or duration of the disease and / or any symptoms associated with it and / or preventing a further increase in the severity of the disease and / or any symptoms associated with it, preventing, reducing or reversing any physiological damage caused by the disease, and any pharmacological effects that are generally beneficial to the patient being treated. The RNAi agents or pharmaceutical compositions of this application do not need to achieve a complete cure or eradication of any symptoms or manifestations of the disease to be considered a useful therapeutic agent. As recognized in the relevant art, a drug used as a therapeutic agent may reduce the severity of a given disease state, but does not need to eliminate every manifestation of the disease to be considered a useful therapeutic agent. Similarly, a treatment administered prophylactically constitutes a viable preventive agent without completely and effectively preventing the onset of the condition. It is sufficient to simply reduce the effects of the disease in the subject (e.g., by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by producing another beneficial effect), or reduce the likelihood of the disease occurring or worsening.
[0119] In this application, the term "administration" generally refers to the introduction of the pharmaceutical preparation of this application into the body of a subject by any route of introduction or delivery. Any method known to those skilled in the art for contacting cells, organs, or tissues with the drug may be employed. Administration may include, but is not limited to, intravenous, intra-arterial, intranasal, intraperitoneal, intramuscular, subcutaneous, or oral administration. A daily dose may be divided into one, two, or more doses in suitable forms to be administered at one, two, or more times during a certain time period.
[0120] In this invention, the term "contact" generally refers to two or more substances of different types coming into contact with each other in any order, in any manner, and for any duration. Contact can occur in vivo, ex vivo, or in vitro. In some embodiments, it may refer to direct contact of the RNAi agent or composition of this application with cells or tissues. In other embodiments, the term refers to indirect contact of the RNAi agent or composition of this application with cells or tissues. For example, the method of this application includes a method in which a subject is exposed to the RNAi agent or composition of this application, and then the RNAi agent or composition contacts cells or tissues by diffusion or any other active or passive transport process known in the art (through which the compound circulates in vivo).
[0121] In this invention, the terms "effective amount" or "effective dose" generally refer to an amount sufficient to achieve or at least partially achieve the desired effect. A "therapeutic effective amount" or "therapeutic effective dose" of a drug or therapeutic agent generally refers to any amount of drug that promotes disease remission (proven by a reduction in the severity of disease symptoms, an increase in the frequency and duration of asymptomatic periods of the disease, or prevention of damage or disability due to the disease) when used alone or in combination with another therapeutic agent. A "preventive effective amount" or "preventive effective dose" of a drug generally refers to an amount of drug that inhibits the development or recurrence of disease when administered alone or in combination with another therapeutic agent to a subject at risk of disease development or recurrence. In some embodiments, "effective amount" refers to the amount of RNAi agent that produces the expected pharmacological, therapeutic, or preventive outcome.
[0122] In this invention, the term "subject" generally refers to a human or non-human animal (including mammals) requiring diagnosis, prognosis, improvement, prevention, and / or treatment of a disease, such as humans, non-human primates (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), livestock (dogs and cats), farm animals (horses, cattle, goats, sheep, pigs), and laboratory animals (mice, rats, rabbits, guinea pigs). Human subjects include fetuses, newborns, infants, adolescents, and adult subjects. Subjects include animal disease models.
[0123] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail through the following embodiments and in conjunction with the accompanying drawings.
[0124] Example 1 – In vitro screening of unmodified ANGPTL3 siRNA
[0125] Experimental materials
[0126] HuH7 cells (Cell Bank of the Chinese Academy of Sciences, SCSP-526), Lipofectamine TM Transfection reagent 3000 (Thermo Fisher, L3000015), serum-reduced medium Optim-MEM (Gibco, 31985-070), DMEM (Gibco, C11995500BT), FBS (Gibco, 10270-106), negative control siRNA NC (Ribobio, siM211215011852) and NC002 (Ribobio, RD20221011171701), siRNA samples (sequences shown in Table 1), MagZol Reagent (Magen, R4801), Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2), 24-well plate (Corning, 3524), CO2 incubator (Memmert, ICO150), real-time PCR instrument (BioRad, CFX DUET), etc.
[0127] Table 1. Sequences of siRNA samples
[0128]
[0129]
[0130]
[0131] Experimental steps
[0132] HuH7 cells (SCSP-526, Chinese Academy of Sciences Cell Bank) were cultured, with a pre-transfection cell density of approximately 30%-50%, indicating relatively homogeneity. All siRNA samples were prepared into 20 μM stock solutions and used as experimental groups. In addition to the experimental groups, normal cell control (Blank), transfection reagent control (Mock), negative control group 1 (NC, Ribobio, siM211215011852), and negative control group 2 (NC002, Ribobio, RD20221011171701) were established. Reference was made to Lipofectamine.TM Transfect cells using the Thermo Fisher 3000 transfection reagent (L3000015) instruction manual. Both the experimental and control groups were replicated three times.
[0133] Total RNA was extracted according to the MagZol Reagent (Magen, R4801) instructions.
[0134] Reverse transcription was performed according to the instructions of the Bugle-Loop miRNAqRT-PCR Starter kit (RiboBio, C10211-2).
[0135] Human housekeeping gene actin was used as an internal control gene. The upstream primer sequence for the actin gene was 5'-TCAAGATCATTGCTCCTCCTGAG-3' (SEQ ID NO. 85), and the downstream primer sequence was 5'-ACATCTGCTGGAAGGTGGACA-3' (SEQ ID NO. 86). The upstream primer sequence for the human ANGPTL3 gene was 5'-CTTCCAAGCCAAGAGCACCA-3' (SEQ ID NO. 87), and the downstream primer sequence was 5'-CATGAAAAACTTGAGAGTTGCTGG-3' (SEQ ID NO. 88). Real-time quantitative PCR was performed using 2X SYBR Green Mix (RiboBio, C10211-2) and a BioRad (CFX DUET) PCR instrument. After the PCR reaction, the Ct error for 9 replicates (3 transfection replicates × 3 qPCR replicates) of a sample should be within ±0.5. Then, using CFXMaestro software, with β-actin as the internal reference gene and the negative control group NC as the normalization, the relative expression changes of the target gene after siRNA transfection were analyzed.
[0136] Table 2. Relative ANGPTL3 expression in HuH-7 cells 48 hours after transfection with unmodified siRNA
[0137]
[0138]
[0139] Example 2 – In vitro screening of chemically modified ANGPTL3 siRNA
[0140] The A3-038 and A3-041 sequences were chemically modified, and the modified sequences are shown in Table 3.
[0141] Table 3 Modified siRNA sequences
[0142]
[0143]
[0144] N: A general term for unmodified ribonucleotides, including A: adenine ribonucleotide, G: guanine ribonucleotide, C: cytosine ribonucleotide, and U: uracil ribonucleotide.
[0145] dN: A general term for unmodified deoxyribonucleotides, including dA: deoxyadenine ribonucleotide, dG: deoxyguanine ribonucleotide, dC: deoxycytosine ribonucleotide, and dT: deoxythymidine ribonucleotide.
[0146] fN: 2'-fluoromodified ribonucleotide.
[0147] mN: 2'-O-methyl modified ribonucleotide.
[0148] *: The two nucleotides located to the left and right of the * are linked by a phosphate thioester subunit.
[0149] The modified double-stranded siRNA was transfected into HuH-7 cells for in vitro efficacy screening. The experiment was repeated three times, following the experimental method described in Example 1. The experimental results are as follows:
[0150] Table 4. Relative ANGPTL3 expression in HuH-7 cells 48 hours after transfection with chemically modified siRNA
[0151] Sample Name Average percentage of inhibition (%) across 3 replicates Blank 1 Mock -13 NC 0 NC-002 -7 A3-038-1 80 A3-038-2 70 A3-038-3 80 A3-038-4 80 A3-038-5 81 A3-038-6 86 A3-041-1 88 A3-041-2 88 A3-041-3 86 A3-041-4 91 A3-041-5 85 A3-041-6 85 A3-042 54
[0152] Example 3 – IC50 Evaluation of siRNA Activity
[0153] Based on the A3-038-6 sequence, by changing the proportion of fluorinated modification in the positive chain, A3-038-6-1 and A3-038-6-2 were obtained, and the sequences are shown in Table 5.
[0154] Table 5. siRNA sequences after changing the proportion of fluorinated modification in the positive strand.
[0155]
[0156] N: A general term for unmodified ribonucleotides, including A: adenine ribonucleotide, G: guanine ribonucleotide, C: cytosine ribonucleotide, and U: uracil ribonucleotide.
[0157] dN: A general term for unmodified deoxyribonucleotides, including dA: deoxyadenine ribonucleotide, dG: deoxyguanine ribonucleotide, dC: deoxycytosine ribonucleotide, and dT: deoxythymidine ribonucleotide.
[0158] fN: 2'-fluoromodified ribonucleotide.
[0159] mN: 2'-O-methyl modified ribonucleotide.
[0160] *: The two nucleotides located to the left and right of the * are linked by a phosphate thioester subunit.
[0161] The IC50 values of A3-041-2, A3-041-4, A3-038-6, A3-038-6-1, and A3-038-6-2 were determined according to the following steps: HuH-7 cells were digested with 0.25% trypsin and adjusted to an appropriate concentration before being seeded into 24-well cell culture plates. Lipofectamine was used. TM Cell transfection was performed using the Thermo Fisher 3000 transfection reagent (L3000015) following the manufacturer's instructions. siRNA transfection concentrations were 100, 50, 10, 2, 0.4, 0.08, 0.016, 0.0032, and 0.00064 nM. In addition to the siRNA transfection group, a normal cell control group (Blank), a transfection reagent control group (Mock), and a negative control group (NC, Ribobio, siM211215011852) were set up. Three replicates were performed for each siRNA and control group. Forty-eight hours after transfection, the culture medium was removed, and cells were collected for RNA extraction. RNA extraction was performed using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA was synthesized using the Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the manufacturer's instructions. The relative expression of the ANGPTL3 gene was measured using a quantitative real-time PCR instrument (BioRad, CFX DUET) with the Bugle-Loop miRNA qRT-PCR Starter kit. Normalization was performed using the negative control group, and the percentage inhibition of ANGPTL3 gene expression at different concentrations of siRNA compared to the negative control group was calculated. A dose-response curve was plotted using GraphPadPrism software, and the half-maximal inhibitory concentration (IC50) was calculated. See [link to results]. Figures 1-5 .
[0162] Table 6. Percentage of ANGPTL3 gene expression inhibition by different concentrations of siRNA (%)
[0163]
[0164] Example 4 – Verification of lipid-lowering efficacy in rats
[0165] 1. Preparation of ligand compounds: For specific preparation steps, refer to Chinese Invention Patent 202110073911.7. The ligand compounds are selected from GalNac-5 and GalNac-13.
[0166]
[0167]
[0168] 2. Ligand compound modification of siRNA: Based on the above A3-038-6, A3-041-2 and A3-041-4, further modifications were made to obtain the sequences shown in Table 7. The sequences were then modified with GalNac-5, GalNac-13 and L96 to form conjugates.
[0169] Table 7 Ligand Compound Modifications of siRNA
[0170]
[0171]
[0172] N: A general term for unmodified ribonucleotides, including A: adenine ribonucleotide, G: guanine ribonucleotide, C: cytosine ribonucleotide, and U: uracil ribonucleotide.
[0173] dN: A general term for unmodified deoxyribonucleotides, including dA: deoxyadenine ribonucleotide, dG: deoxyguanine ribonucleotide, dC: deoxycytosine ribonucleotide, and dT: deoxythymidine ribonucleotide.
[0174] fN: 2'-fluoromodified ribonucleotide.
[0175] mN: 2'-O-methyl modified ribonucleotide.
[0176] *: The two nucleotides located to the left and right of the * are linked by a phosphate thioester subunit.
[0177] VP: VP-modified mU (the VP is 5'-(E)-vinylphospho-3'-phosphate-modified mU).
[0178] The unmodified sequence in A3-038-6a-L96:
[0179] Justice chain: UCAAACCAAUGAAAUCAAAGA (SEQ ID NO.89), antonym chain such as UCUUUGAUUUCAUUGGUUUGAA (SEQ ID NO.90).
[0180] Microplate reader (Tecan, Infinite 200pro)
[0181] Experimental methods
[0182] (Experiment 1) Verification of A3-041-2a-5 and A3-041-4g-5:
[0183] Male SD rats aged 7-9 weeks (Guangdong Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into 5 groups (A1, B1, C1, D1, and E1) with 15 rats in each group, based on their body weight. After grouping, groups B1 and C1 received a single subcutaneous injection of A3-041-2a-5, while groups D1 and E1 received a single subcutaneous injection of A3-041-4g-5. The dosage for groups B1 and D1 was 10 mg / kg, and the dosage for groups C1 and E1 was 20 mg / kg. The administration volume was 5 mL / kg for all groups. Group A1 received an equal volume of physiological saline subcutaneously.
[0184] Animals were fasted for 4 hours before blood collection, but allowed free access to water. Blood was collected from the jugular vein of each group of animals on days 7, 14, 21, and 28 after drug administration. Serum was separated, and serum TG levels were measured. Simultaneously, serum ANGPTL3 protein was measured in samples from day 14. On days 7, 14, 21, and 28 after drug administration, three animals from each group were dissected, and livers were harvested to detect ANGPTL3 mRNA expression in the liver. Serum TG was measured using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit instructions. Serum ANGPTL3 protein was measured using the ANGPTL3 ELISA Kit (arigo, ARG81898) according to the kit instructions. The expression of ANGPTL3 mRNA in the liver was determined by real-time PCR. Total RNA was extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA was synthesized and PCR was performed using the Bugle-Loop miRNAqRT-PCR Starterkit (RiboBio, C10211-2) according to the manufacturer's instructions. The results were then detected using a real-time PCR instrument (BioRad, CFX DUET).
[0185] (Experiment 2) Verification of A3-041-4a-13, A3-041-4b-13, A3-041-4c-13, A3-041-4d-13, A3-041-4e-13, and A3-041-4f-13:
[0186] Male SD rats aged 7-9 weeks (Guangdong Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into 8 groups (A2, B2, C2, D2, E2, F2, G2, and H2 groups) with 15 rats in each group, based on their body weight. After grouping, groups B2, C2, D2, E2, F2, G2, and H2 received a single subcutaneous injection of A3-041-4a-13, A3-041-4b-13, A3-041-4c-13, A3-041-4d-13, A3-041-4e-13, A3-041-4f-13, and A3-041-4-5, respectively, at a dose of 10 mg / kg and a volume of 5 mL / kg. Group A2 received an equal volume of physiological saline subcutaneously.
[0187] Animals were fasted for 4 hours before blood collection, but allowed free access to water. Blood was collected from the jugular vein of each group of animals on days 14 and 28 post-drug administration. Serum was separated, and serum TG levels were measured. On days 14 and 28 post-drug administration, three animals from each group were dissected to collect liver tissue, and ANGPTL3 mRNA expression in the liver was detected. Serum TG was measured using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit's instructions. Liver ANGPTL3 mRNA expression was measured using quantitative real-time PCR. Total RNA was extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA was synthesized and PCR was performed using the Bugle-Loop miRNA qRT-PCR Starter kit (RiboBio, C10211-2) according to the manufacturer's instructions, and the results were detected using a quantitative real-time PCR instrument (BioRad, CFX DUET).
[0188] (Experiment 3) Verification of A3-038-6a-L96, A3-041-4a-L96, and A3-041-2a-L96:
[0189] Male SD rats aged 7-9 weeks (Guangdong Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into 4 groups (A, B, C, and D) according to their body weight, with 9 rats in each group. After grouping, groups B, C, and D were each injected subcutaneously with A3-038-6a-L96, A3-041-4a-L96, and A3-041-2a-L96, respectively, at a dose of 9 mg / kg and a volume of 5 mL / kg. Group A was injected subcutaneously with an equal volume of physiological saline.
[0190] Animals were fasted for 4 hours before blood collection, but allowed free access to water. Blood was collected from the jugular vein of each group of animals on days 7 and 14 after drug administration. Serum was separated, and the levels of triglycerides (TG) and total cholesterol (TC) in the serum were measured. On days 7 and 14 after drug administration, the livers of three animals from each group were dissected to detect the mRNA expression of ANGPTL3 in the liver. On day 18, serum was collected from the remaining three animals to detect serum ANGPTL3 protein. Serum TG was measured using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1), and TC was measured using a total cholesterol (TCH / T-CHO) assay kit (Nanjing Jiancheng Bioengineering Institute, A111-1-1), according to the kit instructions. Serum ANGPTL3 protein was measured using a Mouse / RatAngiopoietin-Like Protein 3 ELISA (BioVendor, RAG011R) according to the kit instructions. The expression of ANGPTL3 mRNA in the liver was determined by real-time PCR. Total RNA was extracted from liver tissue using MagZol Reagent (Magen, R4801) according to the manufacturer's instructions. cDNA was synthesized and PCR was performed using the Bugle-Loop miRNAqRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions. Detection was performed using a real-time PCR instrument (BioRad, CFX DUET).
[0191] The results of Experiment 1 can be found in [link to Experiment 1]. Figure 6 and Figure 7 And see Table 8. The results of Experiment 2 can be found therein. Figure 8 and Figure 9 The results of Experiment 3 can be found in [link to Experiment 3]. Figures 12-15 The corresponding siRAN in A3-038-6a-L96 is a rat sequence. This sequence has two base mismatches between rats and humans. Experimental results show that this sequence has a good effect on verifying A3-038-6a-L96 in rat models, indicating that the corresponding human sequence (A3-038-6a-L96(human)) can also achieve similar results.
[0192] Table 8. Changes in serum ANGPTL3 protein 28 days after drug administration (mixed serum, n=6)
[0193]
[0194] Example 5 – Positive Comparison
[0195] Male SD rats aged 7-9 weeks were randomly divided into 4 groups (n=15 per group) according to their body weight. After grouping, groups B, C, and D received a single subcutaneous injection of A3-041-2a-5, A3-041-4g-5, and AD-52720-L96 (the sequence in US11525138B2 was used as a positive control: GfuCfaCfuUfgAfAfCfuCfaAfcUfcAfaAf, ligand L96), respectively, at a dose of 10 mg / kg and a volume of 5 mL / kg. Group A received an equal volume of physiological saline subcutaneously. Animals were fasted for 4 hours before blood collection, but water was allowed. Blood was collected from the jugular vein of each group on days 14 and 28 post-treatment. Serum was separated, and the levels of TG and TC in the serum were measured. On days 14 and 28 post-treatment, three animals from each group were dissected, and their livers were harvested to detect the mRNA expression of ANGPTL3 in the liver. Serum triglycerides (TG) were measured using a triglyceride (TG) assay kit (Nanjing Jiancheng Bioengineering Institute, A110-1-1) according to the kit instructions. Liver ANGPTL3 mRNA expression was measured using quantitative real-time PCR. Total RNA was extracted from liver tissue using MagZolReagent (Magen, R4801) according to the manufacturer's instructions. cDNA was synthesized and PCR was performed using the Bugle-Loop miRNAqRT-PCR Starter kit (RiboBio, C10211-2) according to the instructions. Detection was performed using a quantitative real-time PCR instrument (BioRad, CFX DUET).
[0196] Please see the results. Figure 10 and Figure 11 Both A3-041-2a-5 and A3-041-4g-5 significantly inhibited ANGPTL3 expression and reduced serum TG levels after administration, with better effects than the positive control AD-52720-L96.
[0197] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
Claims
1. A nucleic acid molecule that inhibits or reduces the expression of ANGPTL3 target genes, comprising a sense strand and an antisense strand, characterized in that, The siRNA is selected from at least one of the following pairs or their modified sequences: A3-038: Its justice chain is shown in SEQ ID NO.75, and its antisense chain is shown in SEQ ID NO.76; A3-041: Its justice chain is shown in SEQ ID NO.81, and its antisense chain is shown in SEQ ID NO.82; A3-038-6a: Its positive chain is shown in SEQ ID NO.89, and its negative chain is shown in SEQ ID NO.
90.
2. The acid molecule according to claim 1, characterized in that, The bases of the positive chain are modified, including 2'-O-methyl modification of the bases at positions 1 to 6, 8, 12, 14, and from the last to the last 6, the bases at positions 7, 9, and 11 being 2'-fluoro modification, and the phosphodiester bond between the last two nucleotides and between the last two nucleotides being replaced by a thiophosphate bond.
3. The nucleic acid molecule according to claim 1 or 2, characterized in that, The bases of the antisense chain are modified, including the following modifications: the bases at positions 1, 3, 5, 7, 11, 13, 15, the 1st to 5th from the end, and the 7th from the end of the antisense chain are all 2'-O-methyl modified; the bases at positions 2, 6, 8, 14, and the 8th from the end are 2'-fluoro modified; the phosphodiester bonds between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4 are replaced by thiophosphate bonds; and the phosphodiester bonds between positions 1 and 2 from the end, and between positions 2 and 3 from the end are replaced by thiophosphate bonds.
4. The nucleic acid molecule according to claim 3, characterized in that, The chain of justice is selected from any of the following: mGmCmAmAmAmCfCmAfGmUfGmAfAmAfUmCmAmAmA*mG*mA, mGmCmAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA, mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA, mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA, mGmCmAmAmAmCfCmAfGfUfGmAfAmAfUmCmAmAmA*mG*mA, UCUUUGAUUUCACUGGUUACUCAAmCmUmCmAmAmA, mG*mU*mC*mAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmAmAmA, mG*mU*mCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmAmAmA, mG*mU*mCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA, mG*mU*mC*mAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA, mU*mC*mAmAmAmCfCmAfAfUfGmAmAmAmUmCmAmAmA*mG*mA, mG*mC*mAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA, where f: 2'-fluoro modification, m: 2'-O-methyl modification, *: the two adjacent nucleotides on the left and right of * are linked by a phosphorothioate subunit.
5. The nucleic acid molecule according to claim 3 or 4, characterized in that, The antisense strand is selected from at least any one of the following: mU*fC*mUmUmUfGmAfUmUfUmCmAmCfUmGfGmUmUmUmGmC*mA*mG, mU*fC*mUfUmUfGmAfUfUmUmCmAmCfUmGfGmUfUmUmGmC*mA*mG, mU*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG, mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU, mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU, mU*fU*mUmGmAfGmUfUmGfAmGfUmUfCmAfAmGfUmGmAmC*mA*mU, mU*fC*mUfUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG, UUUGAGUUGAGUUCAAGUUGAAAUmCmAmAmAmGmA, VP*fU*mU*fGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmA*mC*mA*mU, VP*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU, VP*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU, VP*dT*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU, VP*fU*mUfGmAfGmUdT*fGmAmGmUmUfCmAfAmGdT*mGmAmC*mA*mU, VP*fU*mU*mGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmA*mC*mA*mU, VP*fU*mU*mGmAfGmUfUmGfAmGmUmUdC*mAfAmGmUmGmA*mC*mA*mU, VP*fU*mU*mGmAfGmUfUmGdA*mGmUmUdC*mAdA*mGmUmGmA*mC*mA*mU, VP*fC*mUmUmUfGmAfUmUfUmCfAmUfUmGfGmUfUmUmGmA*mA*mG, VP*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG, Wherein, f: 2'-fluorinated modification, m: 2'-O-methyl modification, *: two adjacent nucleotides located to the left and right of * are linked by thiophosphate subunits, and VP: mU modified with VP.
6. The nucleic acid molecule according to claim 5, characterized in that, The siRNA is selected from at least one pair of the following modified sequences: A3-041-2a: its sense strand is shown as mG*mU*mC*mAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmAmAmA, and its antisense strand is shown as VP*fU*mU*fGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmA*mC*mA*mU; A3-041-4g: Its justice chain is shown as mG*mU*mCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmAmAmA, and its antisense chain is shown as VP*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU; A3-038-6a (human): Its justice chain is shown as mG*mC*mAmAmAmCfCmAfGfUfGmAmAmAmUmCmAmAmA*mG*mA The antisense chain is shown as VP*fC*mUmUmUfGmAfUmUfUmCfAmCfUmGfGmUfUmUmGmC*mA*mG; A3-038-6a: its justice chain is shown as mU*mC*mAmAmAmCfCmAfAfUfGmAmAmAmUmCmAmAmA*mG*mA, and its antisense chain is shown as VP*fC*mUmUmUfGmAfUmUfUmCfAmUfUmGfGmUfUmUmGmA*mA*mG; A3-041-2: Its justice chain is shown as mGmUmCmAmCmUfUmGfAmAfCmUfCmAfAmCmUmCmA*mA*mA, and its antisense chain is shown as mU*fU*mUfGmAfGmUfUfGmAmGmUmUfCmAfAmGfUmGmAmC*mA*mU; A3-041-4: Its justice chain is shown as mGmUmCmAmCmUfUmGfAfAfCmUmCmAmAmCmUmCmA*mA*mA, and its antisense chain is shown as mU*fU*mUmGmAfGmUfUmGfAmGmUmUfCmAfAmGmUmGmAmC*mA*mU.
7. The use of the nucleic acid molecule according to any one of claims 1-6 in the preparation of biological agents or pharmaceutical formulations for inhibiting or reducing the expression of ANGPTL3 target genes.
8. A conjugate that inhibits or reduces the expression of ANGPTL3 target genes, characterized in that, It includes the nucleic acid molecule as described in any one of claims 1-7, and the targeted delivery ligand attached to said nucleic acid molecule.
9. The conjugate according to claim 8, characterized in that, The ligand is attached to the positive strand of the siRNA, and the structure of the ligand is as follows: R1 is the portion that binds to the asialoglycoprotein receptor (ASGPR); R2 is the -CH2- group. C 6-14 Aromatic group, C 2-6 alkenyl or C 2-6 Alkyne group; R3 is -O-、C 6-14 Aromatic group or 3 to 10-membered heterocyclic group; R4 is -CH2-, C 6-14 Aryl or 3 to 10-membered heterocyclic groups; R5 is -OH, -COOH, PG is a carboxyl protecting group; PG2 is a hydroxyl protecting group; a, b, c, and d are each an independent integer from 1 to 10; n is any integer from 1 to 3.
10. The conjugate according to claim 9, characterized in that, The R1 portion is terminated with galactose or N-acetylgalactosamine; The R1 portion is selected from any of the following structures: Where q and q' are each an independent integer from 1 to 10.
11. The conjugate according to claim 9, characterized in that, The carboxyl protecting group is selected from succinate, pentafluorophenol ester, etc. Where h is any integer from 1 to 5.
12. The conjugate according to claim 9, characterized in that, The hydroxyl protecting group is selected from silyl, monomethoxytriphenylmethyl (MMTr), 4,4'-dimethoxytriphenylmethyl (DMTr), and triphenylmethyl; optionally, the silyl group is selected from tert-butyldimethylsilyl ether (TBMDS), tert-butyldiphenylsilyl (TBDPS), and triisopropylsilyl ether (TIPS).
13. The conjugate according to any one of claims 9-12, characterized in that, The ligand has the following structure:
14. The conjugate according to claim 8, characterized in that, The conjugate formed by the connection of the positive strand of the siRNA and the ligand is: in, R1 is the portion that binds to the sialic acid glycoprotein receptor (ASGPR); R2 is -CH2-, C 6-14 Aromatic group, C 2-6 alkenyl or C 2-6 alkynyl group; R3 is -O-、C 6-14 Aromatic or 3 to 10-membered heterocyclic groups; R4 is -CH2-, C 6-14 Aryl or 3 to 10-membered heterocyclic groups; R is either O or S; Rx is siRNA; a, b, c, and d are each an independent integer from 1 to 10; n is any integer from 1 to 3.
15. The use of the conjugate according to any one of claims 8-14 in the preparation of a product for the prevention, relief or treatment of diseases related to the expression of ANGPTL3 target genes, preferably, the product is a biological agent or a pharmaceutical preparation.
16. The application according to claim 15, characterized in that, The diseases associated with ANGPTL3 target gene expression include dyslipidemia, cerebrovascular diseases, and cardiometabolic diseases; preferably, The dyslipidemia includes hyperlipidemia and hypertriglyceridemia or hyperlow-density lipoproteinemia; The cerebrovascular diseases and cardiometabolic diseases mentioned include hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, thrombosis, coronary heart disease, stroke, cerebral stroke or aortic stenosis, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related conditions and diseases.
17. A pharmaceutical composition, characterized in that, The active ingredient of the pharmaceutical composition includes the conjugate that inhibits or reduces the expression of the ANGPTL3 target gene as described in any one of claims 8-14, and pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Compounds, conjugates and uses thereof
CN114853828A
Angiopoietin-like 3 (ANGPTL3) iRNA compositions and methods of use thereof
US11525138B2