Tumor specific promoter and application thereof

By using a tumor-specific promoter to regulate the expression of the E1 gene of oncolytic viruses, recombinant oncolytic viruses were constructed, which solved the problems of insufficient replication capacity of oncolytic adenoviruses in tumor cells and damage to normal cells, and achieved tumor cell-specific proliferation and enhanced safety.

CN121628894APending Publication Date: 2026-03-10SICHUAN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-30
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing oncolytic adenovirus therapies have limited replication capacity in vivo, are prone to damaging normal cells, and lack tumor specificity.

Method used

A tumor-specific promoter element, with the nucleotide sequence shown in SEQ ID NO.5, was used to regulate the expression of the essential viral replication gene E1. A recombinant oncolytic virus vector was constructed to ensure that the virus specifically replicates in tumor cells and reduces replication in normal cells.

Benefits of technology

It improved the replication ability and specificity of recombinant oncolytic virus in tumor cells, reduced the impact on normal cells, and showed good safety and therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121628894A_ABST
    Figure CN121628894A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of tumor immunotherapy, and particularly relates to a tumor specific promoter and related application thereof. Aiming at the problems that the replication capacity of oncolytic adenovirus is limited, non-specific replication often occurs, and normal cells are easily damaged, the invention provides a core starting element of which the nucleotide sequence is shown as SEQ ID NO.5 or one or more basic groups are inserted, deleted and / or replaced and mutated in the nucleotide sequence shown as SEQ ID NO.5. And the nucleic acid molecule still has a promoter function, such as SEQ ID NO.8. The modified tumor specific promoter has a better tumor specific promoter function, and the oncolytic adenovirus constructed by the promoter has the characteristic of being capable of specifically proliferating in tumor cells but not proliferating in normal cells, and is an excellent immunotherapy drug aiming at various tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tumor immunotherapy technology, specifically relating to a tumor-specific promoter and its related applications. Background Technology

[0002] Surgical treatment, radiotherapy, chemotherapy, and targeted therapy are currently the main approved treatment methods for cancer. In recent years, the field of tumor immunotherapy has developed rapidly and has become a hot research area in clinical cancer treatment. Oncolytic virus therapy is an emerging immunotherapy method. Its principle is to modify live, naturally occurring wild-type viruses that infect human cells through genetic engineering to treat various solid tumors, such as lung cancer, liver cancer, colorectal cancer, skin cancer, and breast cancer. Oncolytic virus therapy has advantages such as high kill rate, good targeting, few side effects, and the ability to replicate and kill tumor cells in infected tumor cells, making it one of the important means of tumor immunotherapy today.

[0003] Oncolytic adenoviruses, as the mainstream oncolytic virus, have attracted much attention due to their excellent characteristics such as ease of production, high efficiency, and clinical safety. However, despite the progress made by oncolytic adenoviruses in tumor treatment, their inherent limitations, such as limited specific replication capacity in tumors, non-specific infection of normal cells, and the inability of oncolytic adenovirus monotherapy to cope with the complex tumor microenvironment, have prevented them from demonstrating a complete anti-tumor effect in most clinical cases. To address the current problems of oncolytic adenovirus therapy, clinical approaches mainly involve gene modification to improve its specificity and high proliferation capacity in tumors, reduce infection of non-tumor cells, express pro-apoptotic proteins to sensitize tumors, and enhance fibrinogen by modifying its targeting and infectivity.

[0004] Tumor-specific replication is a crucial and fundamental aspect of oncolytic adenovirus therapy. There are two main strategies for achieving tumor-specific replication with oncolytic adenoviruses. One is to partially delete or mutate the essential viral replication gene E1, enabling the modified oncolytic adenovirus to selectively kill tumor cells with abnormal Rb or p53 cell signaling pathways. The other is to utilize tumor-specific promoters to drive or regulate the essential viral replication gene E1A, allowing it to replicate efficiently in specific tumor cells while failing to replicate in non-specific cells, thus achieving a safe and effective therapeutic effect.

[0005] Human carcinoembryonic antigen-associated cell adhesion molecule 5 (CEACAM5), or CEA for short, is a tumor-specific antigen. Studies have shown that CEA is highly expressed in colorectal cancer, gastric cancer, and non-small cell lung cancer. For decades after its discovery, CEA has consistently been an excellent biomarker with good specificity in distinguishing colorectal cancer from normal tissues.

[0006] Currently, researchers are using oncolytic virus therapy to treat solid tumors such as digestive system tumors. Therefore, modifying an oncolytic adenovirus with high tumor-specific replication ability could improve its targeting and safety, leading to better therapeutic effects and providing a new and effective option for this research field. Summary of the Invention

[0007] The technical problem to be solved by this invention is that in current oncolytic adenovirus therapy, its replication ability in vivo is limited, and non-specific replication often occurs, which can easily damage normal cells.

[0008] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a tumor-specific promoter element is provided, the nucleotide sequence of which is shown in SEQ ID NO.5; or a nucleic acid molecule that has one or more base insertion, deletion and / or substitution mutations in the nucleotide sequence shown in SEQ ID NO.5, and still has promoter function.

[0009] Nucleotide sequence of SEQ ID NO:5 core promoter element CEA P5

[0010] ACCTTGCCGAAAAGATTTGTCTGAGGAACTGAAAATAGAAGGGAAAAAAGAGGAGGGACAAAAGAGGCAGAAATGAGAGGGGAGGGGACAGAGGACACCTGAATAAAGACCACACCCATGACCCACGTGATGCTGAGA AGTACTCCTGCCCTAGGAAGAGACTCAGGGCAGAGGGAGGAAGGACAGCAGACCAGACAGTCACAGCAGCCTTTGACAAAACGTTCCTGGAACTCAAGCTCTTCTCCACAGAGGAGGACAGAGCAGACAGCAGAGACC.

[0011] More preferably, the nucleotide sequence of the above-mentioned core initiation element is shown in SEQ ID NO.8.

[0012] Nucleotide sequence of the core promoter element CEAP8 in SEQ ID NO.8

[0013] TCCCAGGGGATGGGGGTCCATCCCACGTGAAAAAAGAGGAGGGACAAAAGACAC GTGAGAAATGAGAGGGGAGGGGACAGACACGTGCACACCCATGACCCACGTGATGCTG CACACCCATGACCCACGTGATGCTGCACACCCATGACCCACGTGATGCTG.

[0014] The present invention also provides a promoter comprising the above-described core startup element.

[0015] The present invention also provides the use of the above-mentioned core initiation element and promoter in the preparation of recombinant oncolytic virus.

[0016] Furthermore, the present invention also provides a recombinant carrier containing the aforementioned core initiation element and promoter.

[0017] Furthermore, the recombinant vector is a plasmid vector or a viral vector. The viral vector is an adenovirus vector, adenovirus-associated virus, or a retrovirus. More specifically, the viral vector is an oncolytic virus vector, preferably a human adenovirus type 5 (Ad5) vector.

[0018] Furthermore, the plasmid vector is the pGL3-basic plasmid.

[0019] The present invention also provides an antitumor drug, which is prepared by adding pharmaceutically acceptable auxiliary components to the above-mentioned recombinant carrier.

[0020] Furthermore, the tumor is a CEA-positive solid tumor. Preferably, it is at least one of colorectal cancer, gastric cancer, or non-small cell lung cancer.

[0021] The present invention also provides a method for preparing the above-mentioned recombinant vector, comprising the following steps:

[0022] a) Obtain the promoter with the nucleotide sequence described in SEQ ID NO. 8;

[0023] b) Insert the promoter into a human adenovirus type 5 vector to regulate the expression of the replication-essential gene E1; c) Construct and package an oncolytic virus vector containing a promoter with a nucleotide sequence as shown in SEQ ID NO.8 using genetic engineering techniques.

[0024] The beneficial effects of this invention are as follows:

[0025] This invention specifically targets the essential viral replication gene E1, and through screening and modification, obtains a specific promoter that can specifically initiate E1 expression in tumor cells, thereby improving the replication ability and specificity of recombinant oncolytic viruses in tumor cells. It does not replicate in normal cells, thus improving the specificity of recombinant oncolytic viruses. It also shows good safety in mouse models and is suitable for the development of oncolytic viruses or viral vectors. Attached Figure Description

[0026] Figure 1 qPCR was used to detect the mRNA expression level of CEACAM5 (CEA) in different human cells.

[0027] Figure 2 The initiation activity of each truncated domain of the CEA promoter was detected by a dual-luciferase assay. Statistical analysis was performed using GraphPad Prism 9, and Tukey's multiple comparison test was employed. Differences are indicated by "*", where "*" represents p < 0.05, "**" represents p < 0.01, "***" represents p < 0.001, "****" represents p < 0.0001, and "ns" indicates no significant difference. Error bars represent the mean ± standard deviation (SD).

[0028] Figure 3 qPCR was used to detect the expression level of E1A mRNA in cells after oncolytic adenovirus infection.

[0029] Figure 4 The CCK8 assay was used to detect the in vitro cytotoxic activity of oncolytic adenovirus. Statistical analysis was performed using GraphPad Prism 9, and Tukey's multiple comparison test was employed. Differences are indicated by "*", where "*" represents p < 0.05, "**" represents p < 0.01, "***" represents p < 0.001, "****" represents p < 0.0001, and "ns" indicates no significant difference. Error bars represent the mean ± standard deviation (SD).

[0030] Figure 5 A human colorectal cancer HT29 cell transplantation model was used to evaluate the in vivo efficacy of oncolytic adenovirus. Tumor volume data were analyzed using two-way ANOVA. The significance level for the two-sided test was indicated by the number of asterisks (*) to represent p < 0.05, "**" to represent p < 0.01, "***" to represent p < 0.001, and "ns" to indicate no significant difference. Error bars represent the mean ± standard deviation (SD). Specific implementation methods

[0031] This invention provides a synthetically produced promoter element, the nucleotide sequence of which is shown in SEQ ID NO.8. This sequence contains a truncated promoter element (shown in SEQ ID NO.5) of the promoter region of the CEA molecule, and has tumor-specific promoter activity. It can specifically initiate the expression of the target gene in various CEA-positive tumor cells, while exhibiting low or no promoter activity in normal cells.

[0032] In obtaining the artificially synthesized promoter elements described above, this invention selected promoter elements of different lengths located in the nucleotide sequence of the CEA molecule (as shown in Table 1 below). CEA P1 is 2018 bp in length, and its nucleotide sequence is shown in SEQ ID NO:1; CEA P2 is 1500 bp in length, and its nucleotide sequence is shown in SEQ ID NO:2; CEA P3 is 847 bp in length, and its nucleotide sequence is shown in SEQ ID NO:3; CEA P4 is 421 bp in length, and its nucleotide sequence is shown in SEQ ID NO:4; CEA P5 is 275 bp in length, and its nucleotide sequence is shown in SEQ ID NO:5; CEAP6 is 1597 bp in length, and its nucleotide sequence is shown in SEQ ID NO:6; CEAP7 is 1743 bp in length, and its nucleotide sequence is shown in SEQ ID NO:7.

[0033] Table 1. Nucleotide sequences of different promoters

[0034]

[0035]

[0036]

[0037] The promoter provided by this invention is tumor-specific and can be used to construct other oncolytic virus drugs, including oncolytic adenoviruses (such as adenovirus-associated viruses or retroviruses). The constructed oncolytic adenovirus can specifically proliferate in tumor cells while replicating at a reduced rate in normal cells, effectively killing tumor cells and inhibiting tumor growth, demonstrating efficacy, safety, and specificity.

[0038] The advantage of this invention lies in the successful acquisition of truncated promoters with core components through screening for tumor-specific, highly expressed antigen promoters. These promoters are then used to construct oncolytic adenoviruses with tumor-specific replication capabilities. Their activity is strictly limited, enabling them to proliferate efficiently in specific tumor cells with minimal impact on normal cells, making them a promising anti-tumor immunotherapy viral drug. Experiments have demonstrated that the oncolytic adenovirus with tumor-specific promoters prepared in this invention proliferates only in specific tumor cells, while maintaining high non-proliferative and non-cytotoxic activity against normal and non-specific cells. This provides a strong guarantee for reducing treatment side effects and improving patients' quality of life.

[0039] The specific implementation of the present invention will be further explained and described below through examples, but this does not mean that the scope of protection of the present invention is limited to the scope described in the examples.

[0040] The animal experimental methods and materials used in the embodiments described have been approved by the Medical Ethics Committee of West China Hospital of Sichuan University, and the instruments and materials used in the experiments are all commercially available products.

[0041] Example 1: mRNA expression levels of CEACAM5 (CEA) in different human cells

[0042] The human cell lines used in this embodiment are human normal hepatocytes L02 (Cellosaurus:CVCL-6926), human umbilical vein endothelial cells HUVEC (ATCC:PCS-100-010), human cervical cancer cells HeLa (ATCC:CRM-CCL-2), human colon cancer cells HCT116 (ATCC:CCL-247EMT), human colon adenocarcinoma cell line HT29 (ATCC:HTB-38), human colon adenocarcinoma cell line LS174T (ATCC:CL-188), human poorly differentiated gastric cancer cell line MKN-45 (ATCC:CVCL-0434), human gastric cancer cell line SNU-16 (ATCC:CRL-5974), human metastatic pancreatic adenocarcinoma cell line AsPc-1 (ATCC:CRL-1682), and human orthotopic pancreatic adenocarcinoma cell line BxPc-3 (ATCC:CRL-1687). A certain amount of cells were collected, total RNA was extracted and reverse transcribed into cDNA, and GAPDH was used as an internal control. The expression of human carcinoembryonic antigen-associated cell adhesion molecule 5 (CEA) was detected by qPCR. The results are as follows: Figure 1As shown in the results, CEA expression was very low, almost non-existent, in normal L02 and HUVEC cells. Furthermore, its expression was low in HeLa and HCT116 cells. In contrast, CEA expression was high in HT29, LS174T, MKN-45, SNU-16, AsPc-1, and BxPc-3 cells. This suggests that CEA could serve as a target for diseases such as colorectal cancer, gastric cancer, and pancreatic cancer.

[0043] Example 2: Detection of promoter activity of different sequence promoters

[0044] In this embodiment, the dual-luciferase reporter gene assay was used to detect the promoter activity of each truncated sequence. The pGL3-basic plasmid used in this embodiment (purchased from Addgene) can be used for promoter activity detection, i.e., the multiple cloning site region is located upstream of the firefly luciferase gene. After digesting the pGL3-basic plasmid with restriction endonucleases KpnI and XhoI, the above-mentioned CEAp1, CEAp2, CEAp3, CEAp4, CEAp5, CEAp6, and CEAp7 fragments were ligated to the digested pGL3-basic plasmid, respectively, to construct pGL3-CEAp1, pGL3-CEAp2, pGL3-CEAp3, pGL3-CEAp4, pGL3-CEAp5, pGL3-CEAp6, pGL3-CEAp7, and pGL3-CEAp8. All sequences were correctly sequenced and ready for use.

[0045] The L02, HUVEC, HT29, LS174T, MKN-45, SNU-16, AsPc-1, and BxPc-3 cells were divided into groups of 2 × 10⁻⁶. 4 Cells were seeded into 96-well plates at 37°C overnight. Cells were grouped into control, pGL3-basic, pGL3-CEAp1, pGL3-CEAp2, pGL3-CEAp3, pGL3-CEAp4, pGL3-CEAp5, pGL3-CEAp6, pGL3-CEAp7, and pGL3-CEAp8 groups. Each plasmid in each group was transfected into cells using PEI at a dose of 100 ng / well, with three replicates per group. Medium was changed 12 h after transfection, and firefly luciferase was detected 24 h later. The internal control plasmid pRL-TK was used to detect Renida luciferase.

[0046] Test results as follows Figure 2As shown, the results indicate that firefly luciferase was almost undetectable in normal cells L02 and HUVEC, as well as in tumor cells HeLa and HCT116 with low CEA expression. This suggests that the activation activity of various truncated promoters of CEA is limited in normal cells L02 and HUVEC, and in tumor cells HeLa and HCT116 with low CEA expression. This indicates that the constructed oncolytic virus cannot activate the replication-essential gene E1A, thus preventing it from replicating normally. In tumor cells HT29, LS174T, MKN-45, SNU-16, AsPc-1, and BxPc-3, which highly express CEA, each truncated CEA promoter exhibits certain initiation activity. Statistical analysis revealed that the truncated CEA p1 sequence, SEQ ID NO.1 (2018 bp), possessed the strongest initiation activity. However, comprehensive analysis showed that its excessive length would prevent the viral vector from carrying more genes with anti-tumor activity. Therefore, the truncated CEA p5 sequence, SEQ ID NO.5 (275 bp), which was indistinguishable from the truncated CEA p1 sequence, was selected as the optimal sequence, representing the core initiation region of the CEA promoter. Based on sequence analysis, a shorter promoter, CEAp8 (SEQ ID NO.8, 162 bp), containing the core module binding sequence, was artificially designed and synthesized for subsequent experimental verification.

[0047] Example 3: Detection of replication capacity and cytotoxic activity of the constructed oAd5-CEA p8-E1A oncolytic adenovirus

[0048] In this embodiment, oAd5-CEA p8-E1A and oAd5-CMV-E1A oncolytic adenoviruses were prepared (CMV promoters are common and widely used strong promoters in biology, and are used in multi-gene therapy vectors; therefore, the CMV promoter was used as a control in this experiment), and their replication ability and killing activity in various cells were compared. First, the pDC516 shuttle plasmid vector was double-digested, and the CEA p8 sequence and CMV promoter sequence were ligated into the shuttle vector pDC516, respectively, to construct the pDC516-CEA p8-E1A and pDC516-CMV-E1A vectors. Using the ADMax adenovirus packaging system, the vectors were co-transfected with the pBHGlox(delta)E1,3Cre backbone vector using PEI to prepare seed strains for HEK293A cells. The packaged oncolytic adenoviruses were labeled oAd5-CEA p8-E1A and oAd5-CMV-E1A, respectively.

[0049] The replication capacity of oncolytic adenoviruses is usually assessed by detecting the expression level of the replication-essential protein E1A. First, human normal hepatocytes L02, human colorectal cancer cells HCT116, human colorectal adenocarcinoma cells HT29, and human poorly differentiated gastric cancer cells MKN45 were respectively divided into groups of 5 × 10⁻⁶ cells.5 Cells were seeded into each well of a six-well plate and cultured overnight at 37°C. The following day, cells were infected with oAd5-CEA, p8-E1A, oAd5-CMV-E1A, and Ad-GFP (an adenovirus expressing only GFP and without proliferative capacity) at an MOI of 10. Each well was replicated three times. After 24 hours, cells were collected, total RNA was extracted and reverse transcribed into cDNA, and the expression of adenovirus E1A was detected by qPCR. The results are shown below. Figure 3 As shown, 24 hours after infection with oAd5-CEA p8-E1A, E1A expression was very low in L02 and HCT116 cells where CEA molecules were not expressed or expressed at low levels. However, E1A expression was high after oAd5-CMV-E1A infection, showing no specificity. This indicates that oAd5-CMV-E1A, an oncolytic virus, is non-specific and replicates in both normal and tumor cells. This may lead to certain safety concerns despite its effectiveness. In contrast, oAd5-CEA p8-E1A oncolytic virus replicates efficiently only in tumor cells with high CEA expression, exhibiting stronger amplification capabilities and better oncolytic effects. Its replication ability in normal cells is limited, demonstrating better tumor specificity.

[0050] In HT29 and MKN45 cells with high CEA expression, E1A expression was high after infection with both viruses. The oAd5-CEA p8-E1A group showed significantly higher expression compared to the oAd5-CMV-E1A group. This indicates that the proliferation of oAd5-CEA p8-E1A is limited after infection of cells with low or no CEA expression. In cells with high CEA expression, oAd5-CEA p8-E1A exhibits strong replication ability, proliferates efficiently in specific tumors, and does not affect normal cells.

[0051] For the detection of its in vitro killing ability, the CCK8 assay is usually used. First, human normal hepatocytes L02, human colorectal cancer cells HCT116, human colorectal adenocarcinoma cells HT29, and human poorly differentiated gastric cancer cells MKN45 are respectively subjected to 8×10⁻⁶... 3 Cells were seeded into 96-well plates at 37°C and cultured overnight. The following day, oAd5-CEAp8-E1A, oAd5-CMV-E1A, and Ad-GFP were added at MOIs of 0.1, 1, 10, and 100, respectively, for cell infection. Each well was infected three times. Cell viability was assessed using the CCK8 assay 72 hours after infection. The results are shown below. Figure 4As shown, Ad-GFP, which lacks proliferative capacity, showed no significant cellular killing ability after infection. oAd5-CMV-E1A oncolytic adenovirus exhibited good cellular killing ability, but lacked specific replication capability, posing certain safety risks in its use. In contrast, oAd5-CEAp8-E1A oncolytic adenovirus demonstrated good specific replication capability, allowing it to proliferate efficiently only in cells with high CEA expression. Furthermore, compared to oAd5-CMV-E1A oncolytic virus, oAd5-CEAp8-E1A oncolytic virus showed a stronger killing effect; at MOI=1, cell viability began to decrease significantly, demonstrating a statistically significant difference.

[0052] Example 4: In vivo tumor-killing activity assay of Ad5-CEA p5-E1A oncolytic adenovirus

[0053] In this embodiment, the in vivo tumor-killing activity of Ad5-CEA p5-E1A oncolytic adenovirus was evaluated using the HT29 xenograft model.

[0054] First, select 5-week-old Balb / c nude mice and subcutaneously inoculate them with 5 × 10⁸ mice. 6 HT29 cells were administered intratumorally three times, with one day between each injection, starting on day seven, and tumor volume was measured. Mice were divided into three groups: Ad-GFP, oAd5-CMV-E1A, and oAd5-CEA / p8-E1A, with five mice in each group. Each mouse received 1 × 10⁶ HT29 cells. 8 Administer PFU at the prescribed dose.

[0055] Experimental results are as follows Figure 5 As shown, the results indicated that compared to the Ad-GFP group, both the oAd5-CMV-E1A oncolytic adenovirus and the oAd5-CEA p8-E1A oncolytic adenovirus group effectively inhibited tumor growth, with an inhibition rate of approximately 55%, which was significantly different from the control virus Ad-GFP. However, there was no significant difference in efficacy compared to the positive control virus oAd5-CMV-E1A oncolytic adenovirus. These animal experiments demonstrate that oAd5-CEAp8-E1A can replicate in HT29 tumor cells with high CEA expression, exhibiting good oncolytic properties. Compared to oncolytic adenoviruses carrying the well-known strong promoter CMV, both significantly inhibited tumor growth without significant difference. Therefore, we believe that this result is related to the specific replication of oAd5-CEAp8-E1A oncolytic adenovirus in CEA-high expression cells, resulting in better tumor specificity.

[0056] As can be seen from the above embodiments, the present invention provides a promoter that specifically initiates the E1 molecule, and constructs a recombinant oncolytic adenovirus based on the promoter, which can specifically replicate in tumor cells with high CEA expression, thereby improving the oncolytic activity of the recombinant adenovirus and providing a more effective method to improve the effect of oncolytic viruses, which is a significant advancement.

Claims

1. A core start element, characterized by: a nucleic acid molecule having a nucleotide sequence as set forth in SEQ ID NO. 5 or having one or several base insertions, deletions and / or substitution mutations in the nucleotide sequence as set forth in SEQ ID NO. 5 and still having a promoter function.

2. The core start element of claim 1, wherein: the nucleotide sequence is as set forth in SEQ ID NO.

8.

3. A promoter comprising the core promoter element of claim 1 or 2.

4. Use of the core promoter element of claim 1 or 2, or the promoter of claim 3 for the preparation of an oncolytic adenovirus.

5. A recombinant vector comprising the core promoter element of claim 1 or 2, or the promoter of claim 3.

6. The recombinant vector of claim 5, wherein: The recombinant vector is a plasmid vector or a viral vector, and the viral vector is an adenovirus vector, an adenovirus-associated virus or a retrovirus.

7. The recombinant vector of claim 6, wherein: The plasmid vector is a pGL3-basic plasmid.

8. An antitumor agent, characterized by comprising: the compound or a pharmaceutically acceptable salt of the compound according to claim 1. The recombinant vector of any one of claims 5-7 is prepared by adding a pharmaceutically acceptable auxiliary ingredient.

9. The antitumor drug according to claim 8, characterized by: The tumor is a CEA-positive solid tumor; preferably, at least one of colorectal cancer, gastric cancer or non-small cell lung cancer.

10. A method of producing the recombinant vector according to any one of claims 5 to 7, characterized in that, The method comprises the following steps: a) obtaining the promoter of claim 3; b) inserting the promoter into a human adenovirus type 5 vector to regulate the expression of the replication essential gene El; c) constructing and packaging an oncolytic adenovirus vector containing the promoter of claim 3 by genetic engineering techniques.