Application of Let-7b-5p in preparation of preparation for promoting androgen receptor degradation

By targeting the deubiquitinase USP12 with the Let-7b-5p plasmid, the ubiquitination and degradation of the androgen receptor are promoted, which overcomes the shortcomings of Let-7b-5p in the degradation of AR in the prior art. This results in a significant reduction in androgen receptor expression and has the potential to treat prostate cancer and breast cancer.

CN121648151APending Publication Date: 2026-03-13SOUTHERN MEDICAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610169835.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-06
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Current technologies have not been able to effectively utilize microRNA Let-7b-5p to promote the ubiquitination and degradation of androgen receptors, especially in the treatment of AR-related diseases such as prostate cancer and breast cancer, where there is a lack of effective regulatory means.

Method used

By constructing the Let-7b-5p plasmid, targeting the deubiquitinase USP12, reducing its expression level, and promoting the expression of the E3 ubiquitinase NEDD4, thereby enhancing the ubiquitination and degradation of androgen receptors, corresponding drug formulations such as oral preparations and topical patches can be prepared.

Benefits of technology

Significantly reducing the expression level of androgen receptors provides a new biomedical treatment approach with potential application value in treating diseases such as prostate cancer and breast cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121648151A_ABST
    Figure CN121648151A_ABST
Patent Text Reader

Abstract

The invention discloses an application of Let-7b-5p in preparation of a preparation for promoting degradation of an androgen receptor. According to the invention, it is found for the first time that Let-7b-5p targets ubiquitination enzyme USP12, ubiquitination degradation of AR is promoted, and then the expression level of AR is reduced. Therefore, the method has high application value in biomedicine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and specifically relates to the application of Let-7b-5p in the preparation of agents that promote the degradation of androgen receptors. Background Technology

[0002] The androgen receptor (AR) is a ligand-activated nuclear receptor belonging to the steroid hormone nuclear receptor family of transcription factors. It functions as a transcription factor within cells, regulating gene expression by binding to androgens (such as dihydrotestosterone, DHT) to activate signaling pathways. Androgen binding triggers conformational changes in the AR, affecting its interaction with coactivators and regulating downstream gene transcription programs (Sardar M, et al. Unveiling Ligand-Induced Conformational Changes in Mutant AR-LBD: Molecular Dynamics Insights into the Androgen Receptor-Coactivator Mechanism. Journal of chemical information and modeling, 2025. 65(17): p. 9154-9176). The distribution of AR proteins in cells and tissues is regulated by androgens, primarily involving nuclear-cytoplasmic shuttle, and its nuclear localization is crucial for transcriptional activation.The synthesis of AR proteins is finely regulated by androgens and RNA-binding proteins (Zhou H, et al. Hyperandrogenemia Induces Trophoblast Ferroptosis and Early Pregnancy Loss in Patients With PCOS via CMA-Dependent FTH1 Degradation. Advanced science (Weinheim, Baden-Wurttemberg, Germany), 2025: p. e06091.); the degradation pathway of AR is mainly through the ubiquitin-proteasome system (UPS), regulated by ligands, degrading agents, and ubiquitination (Arai S, et al. A carboxy-terminal ubiquitylation site regulates androgen receptor activity. Communications biology, 2024. 7(1): p. 25; Rodriguez Tirado C, et al. UBE2J1 is the E2 ubiquitin-conjugating enzyme regulating androgen receptor degradation and antiandrogen resistance. Oncogene, 2024. 43(4): p. 265-280.).

[0003] AR plays a central role in multiple diseases: AR is a major driver of prostate cancer development and progression (Hou Z, et al. Androgens in prostate cancer: A tale that never ends. Cancerletters, 2021. 516: p. 1-12.), and AR is expressed in approximately 60-90% of breast cancers, especially in estrogen receptor α-positive (ERα) breast cancers. +In breast cancer (Sridhar N, et al. Paving the path ForwARd: Advances and challenges in androgen receptor targeting in breast cancer. Cancer treatment reviews, 2025. 138: p. 102958.); AR is highly expressed in androgenic alopecia (Liu J, et al. Obacunone improves dihydrotestosterone-induced androgen alopecia by inhibiting androgen receptor dimerization. Phytomedicine : international journal of phytotherapy and phytopharmacology, 2024. 135: p. 156042.). Therefore, AR is currently used as a therapeutic target for diseases such as prostate cancer and breast cancer. At present, the main therapeutic drugs targeting AR include antagonists (such as Enzalutamide, Apalutamide, ARN-509, ODM-201), agonists (for non-cancerous diseases), modulators (such as EPI-001, AZD-3514, TOK-001) and novel domain-specific inhibitors (such as DBD targeted drugs). Among them: (1) The mechanism of AR antagonists is to competitively block the binding of AR to androgens and inhibit the AR signaling pathway. They are mainly used for the treatment of prostate cancer. The representative drug is Enzalutamide, which is a small molecule AR antagonist that works by binding to the ligand-binding domain (LBD) of AR. It is used to treat metastatic castration-resistant prostate cancer (Dalal K, et al. Small molecule-induced degradation of the full length and V7 truncated variant forms of human androgen receptor. European journal of medicinal chemistry, 2018. 157:p. 1164-1173.); Apalutamide belongs to the third generation of AR targeted therapy drugs. It also competitively blocks AR and is suitable for metastatic and non-metastatic prostate cancer (Velho PI, et al.).The development of apalutamide for the treatment of prostate cancer. Expert opinion on drug discovery, 2021.16(3): p. 217-226. ); (2) AR agonists activate the AR signaling pathway and are used to treat non-cancerous diseases such as muscle atrophy and osteoporosis, but not prostate cancer; (3) The mechanisms of action of AR modulators and novel inhibitors include inhibiting other functional domains or binding modes of AR to overcome resistance to traditional treatments. Representative drugs are EPI-001, AZD-3514 and TOK-001; EPI-001 is an AR DNA binding domain (DBD) inhibitor that blocks transcriptional activity by targeting the non-ligand binding domain of AR and is suitable for drug-resistant prostate cancer (Agarwal N, et al. New agents for prostate cancer. Annals of oncology : official journal of the European Society for Medical Oncology, 2014. 25(9): p. AZD-3514, as a selective AR downregulator (SARD), promotes AR degradation or downregulates its expression (Lu C, et al. Androgen receptor variant-driven prostate cancer II: advances in laboratory investigations. Prostate cancer and prostaticdiseases, 2020. 23(3): p. 381-397.); TOK-001 (Galeterone), as a dual inhibitor, simultaneously inhibits androgen synthesis and AR binding, and is used to treat prostate cancer (Agarwal N, et al. New agents for prostate cancer. Annals of oncology : official journal of the European Society for Medical Oncology, 2014. 25(9): p. 1700-1709.). Therefore, targeting AR therapy has become a key focus in the development of new drugs.

[0004] The ubiquitin-proteasome system is a key mechanism for the highly regulated and selective degradation of proteins in eukaryotic cells. It is mainly responsible for clearing misfolded, damaged or no longer needed proteins and participates in the regulation of various important physiological processes such as cell cycle, signal transduction, and immune response. The biological process of ubiquitination degradation by the ubiquitin-proteasome system includes four core steps, which are completed by three classes of enzymes: (1) Activation: The enzyme involved is E1 ubiquitin activator, which activates ubiquitin molecules (a small protein) and carries them on itself when ATP energy is consumed; (2) Binding: The enzyme involved is E2 ubiquitin conjugate, which transfers the activated ubiquitin from the E1 enzyme to the E2 enzyme; (3) Linking: E3 ubiquitin ligase, which is the most critical step and determines the specificity of degradation. E3 enzymes can recognize specific target proteins (such as AR) and catalyze the linking of ubiquitin molecules on E2 enzymes to lysine residues of the target protein; (4) Degradation: Target proteins labeled with polyubiquitin chains are transported to the proteasome, where they are rapidly broken down into small peptides and amino acids for cellular recycling; In contrast to ubiquitination degradation is deubiquitination enzymes, which can remove ubiquitin molecules from the target protein, thereby inhibiting ubiquitination degradation; Therefore, the ubiquitin-protease system and deubiquitination enzymes jointly regulate the activity and stability of AR proteins; The enzymes involved in AR ubiquitination degradation are mainly concentrated on E3 ubiquitin ligases, as they are the key to determining AR specificity.The main E3 ligases include: NEDD4, MDM2, CHIP, and Siah2; while the deubiquitinating enzymes involved in AR ubiquitination degradation are mainly: USP12, USP7, USP14, and USP22 (Lahav-Baratz S, et al. The testis-specific USP26 is a deubiquitinating enzyme of the ubiquitinligase Mdm2. Biochemical and biophysical research communications, 2017. 482(1): p. 106-111; Xia X, et al. Inhibition of USP14 enhances the sensitivity of breast cancer to enzalutamide. Journal of experimental & clinical cancer research : CR, 2019. 38(1): p. 220; Pornour M, et al. USP11 promotes prostate cancer progression by up-regulating AR and c-Myc activity. Proceedings of the National Academy of Sciences of the United States of America, 2024. 121(31):p. e2403331121.). Drugs targeting the degradation pathway of AR can effectively regulate AR expression levels and play an important role in treatment.

[0005] miRNAs are a class of small non-coding RNAs that play a key role in various diseases by regulating gene expression. Although there are currently no FDA-approved miRNA-based therapies (such as in the field of cancer), this is mainly due to limitations in delivery efficiency and in vivo stability (Ju J. Challenges and opportunities in microRNA-based cancertherapeutics. Cell reports. Medicine, 2025. 6(4): p. 102057.). However, a large number of preclinical studies and clinical trials are currently underway. The ongoing clinical trials are mainly focused on cancer, neurodegenerative diseases, and metabolic diseases, aiming to evaluate the efficacy of miRNAs as monotherapy or combination therapy (such as in combination with chemotherapy or radiotherapy). (Martino MTD, et al. MicroRNA in cancer therapy: breakthroughs and challenges in early clinical applications. Journal of experimental & clinical cancer research: CR, 2025. 44(1): p. 126; Sempere LF, AS Azmi and A. Moore, microRNA-based diagnostic and therapeutic applications in cancer medicine. Wiley interdisciplinary reviews. RNA, 2021. 12(6): p. e1662; Kwok GT, et al. Translational applications of microRNAs in cancer, and therapeutic implications. Non-coding RNA research, 2017. 2(3-4): p. 143-150.): Drug name: Obefazimod (ABX464), from Abivax, entered Phase III clinical trials in July 2025. It is an oral small molecule that exerts its anti-inflammatory effect by upregulating the expression of endogenous miR-124. The drug name is MIRX002, from PURMX Therapeutics. It began Phase I clinical trials in February 2025. It is a miR-3140-3p mimic that is directly supplemented and administered intratumorally to cervical lymph nodes in recurrent head and neck cancer. Therefore, miRNAs have a promising future as a treatment option in precision medicine.

[0006] Let-7b-5p is a microRNA belonging to the let-7 family. It plays a key regulatory role in various biological processes, mainly by inhibiting the expression of specific gene mRNAs, thereby affecting cell function, immune response, metabolism, and disease progression. Studies have found that Let-7b-5p acts as a tumor suppressor in various cancers (especially breast cancer), affecting tumor progression by regulating key metabolic enzymes (such as HK2) (Li L, et al. Let-7b-5pinhibits breast cancer cell growth and metastasis via repression of hexokinase 2-mediated aerobic glycolysis. Cell death discovery, 2023. 9(1):p. 114.). Let-7b-5p is also a key regulator of the immune response, mediating cell communication through exosomes and regulating macrophage polarization (M1 / M2) by targeting genes such as SOCS1 (Yu X, et al. Correction: Exosomal let-7b-5p derived from Aspergillus fumigatus-treated human corneal epithelial cells promote M1 macrophage activation via targeting SOCS-1. Frontiers inimmunology, 2025. 16: p. 1643508.). However, the effect of Let-7b-5p on androgen receptor ubiquitination degradation has not yet been observed. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide the application of Let-7b-5p in the preparation of preparations that promote the degradation of androgen receptors.

[0008] The objective of this invention is achieved through the following technical solution: the application of Let-7b-5p in the preparation of agents that promote androgen receptor degradation. This is based on the discovery that Let-7b-5p significantly reduces the expression of androgen receptors, promotes the expression of E3 ubiquitination ligase NEDD4, and simultaneously reduces the expression of deubiquitination enzyme USP12. Furthermore, Targetsan indicated that USP12 has a target site for Let-7b-5p. Based on the predicted target site, a Let-7b-5p plasmid was constructed, and a dual-luciferase reporter assay was performed to verify the relationship between the two. The results showed that Let-7b-5p and USP12 mutually target each other, suggesting that Let-7b-5p may target USP12 to inhibit AR deubiquitination and thus promote AR ubiquitination degradation. Furthermore, human dermal papilla cells were treated with the pcDNA3.1(+)-USP12 overexpression plasmid (oe-USP12), and it was found that even when USP12 expression increased, AR expression still significantly increased after Let-7b-5p treatment. The results suggest that Let-7b-5p targets USP12 to inhibit AR deubiquitination and promote AR ubiquitination and degradation, thereby reducing the intracellular AR expression level.

[0009] The degradation described is ubiquitination degradation.

[0010] The degradation agent is preferably a pharmaceutical preparation.

[0011] The types of degradation agents include oral formulations and topical patches.

[0012] The external application patch is preferably a transdermal patch.

[0013] The present invention has the following advantages and effects compared with the prior art: This invention utilizes Western blotting (WB) experiments to demonstrate that Let-7b-5p significantly reduces the expression of dihydrotestosterone (DHT)-induced androgen receptor (AR) in human dermal papilla cells, promotes the expression of the E3 ubiquitination ligase NEDD4, and simultaneously reduces the expression of the deubiquitination enzyme USP12. This invention is the first to publicly report that Let-7b-5p promotes the ubiquitination and degradation of the androgen receptor; further, through dual-fluorescence reporter assays and USP12 overexpression viruses, it is confirmed that Let-7b-5p targets the deubiquitination enzyme USP12, reducing USP12 expression levels, promoting androgen receptor ubiquitination and degradation, and decreasing AR expression levels. This invention has significant biomedical applications. Attached Figure Description

[0014] Figure 1This is a Western blot (WB) experiment showing that Let-7b-5p significantly reduced the expression of dihydrotestosterone (DHT)-induced androgen receptors in human dermal papilla cells; where A is a photograph of the WB results; B is a statistical result of the relative expression level of AR; C is a statistical result of the relative expression level of NEDD4; D is a statistical result of the relative expression level of USP12; * indicates *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0015] Figure 2 This is a graph showing the detection results of Let-7b-5p targeting the deubiquitinating enzyme USP12; where A is a graph of Let-7b-5p target sites where USP12 is found, retrieved from the Targetsan website; B is the result of a dual-luciferase reporter assay using Let-7b-5p plasmids constructed based on the predicted target sites; ****p<0.0001, NS indicates no difference, p>0.05.

[0016] Figure 3 This is a graph showing the detection results of Let-7b-5p targeting the deubiquitinating enzyme USP12 and reducing the expression level of AR; where A is the result of WB detection of AR expression in human dermal papilla cells; B is the statistical result of the relative expression level of AR; *p<0.05, **p<0.01. Detailed Implementation

[0017] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0018] Example 1: Western blot (WB) assay showed that Let-7b-5p significantly reduced the expression of dihydrotestosterone (DHT)-induced androgen receptors in human dermal papilla cells. Immortalized dermal papilla cells (catalog number IH1006, purchased from Wuxi Xinrun Biotechnology Co., Ltd., hereinafter the same) were distributed at a ratio of 1×10⁶ cells per well. 5Cells were seeded in 6-well plates and starved for 5 hours in serum-free DMEM high-glucose medium. They were then divided into three groups: a normal group, a DHT (dihydrotestosterone) treatment group, and a DHT+Let-7b-5p treatment group. The original culture medium was discarded. The normal group was treated with 1 mL of serum-free DMEM high-glucose medium, the DHT treatment group with 1 mL of DMEM high-glucose medium containing a final concentration of 1 μM DHT, and the DHT+Let-7b-5p treatment group with 1 mL of DMEM high-glucose medium containing a final concentration of 1 μM DHT and a final concentration of 50 nm Let-7b-5p (purchased from Guangzhou Ruibo Biotechnology Co., Ltd., catalog number: miR10000063-1-5). After 24 hours of culture, total cell protein was collected. Prepare cell lysis buffer at a ratio of RIPA:PIA:PIB:PI = 100:1:1:1. Wash the cell surface thoroughly with DPBS, repeat twice, and then discard the DPBS. Add 100 μL of lysis buffer to each well, gently mix, and place on ice for 15 min. Use a disposable cell scraper to scrape cells thoroughly, repeating 2-3 times. Collect cell debris along with the lysis buffer and transfer to a 1.5 mL EP tube. Centrifuge at 12000 rpm for 15 min at 4°C. Transfer the supernatant from the EP tube to a new EP tube and discard the precipitate. Add protein loading buffer to the EP tube according to the ratio, boil for 10 min, place on ice, cool, mix, aliquot, and store at -80°C. Western blot was used to detect the levels of androgen receptor (AR antibody, 1:1000, Abcam; goat anti-rabbit IgG / HRP polymer, 1:2000, Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), deubiquitinase USP12 (USP12 antibody, 1:1000, Proteintech; goat anti-rabbit IgG / HRP polymer, 1:2000, Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.), and E3 ubiquitin ligase NEDD4 (NEDD4 antibody, 1:1000, Proteintech; goat anti-rabbit IgG / HRP polymer, 1:2000, Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) in dermal papilla cells. Each group was repeated three times. ImageJ software was used to identify the gray values ​​of the bands and analyze the relative expression levels. SPSS 25 statistical software was used for data analysis. The results are shown in the figure below. Figure 1 .Depend on Figure 1 It is evident that Let-7b-5p significantly reduced the expression of dihydrotestosterone (DHT)-induced androgen receptors in human dermal papilla cells, promoted the expression of E3 ubiquitination ligase NEDD4, and simultaneously reduced the expression of deubiquitination enzyme USP12.

[0019] Example 2 demonstrates that Let-7b-5p targets the deubiquitinase USP12. Design Report Plasmid: Based on the target site of the deubiquitinase USP12 predicted on TargetScan (https: / / www.targetscan.org / vert_80 / ), the wild-type and mutant gene fragments with the following nucleic acid sequences were designed and synthesized. The entire genome was synthesized by [company name missing] and [other methods missing]. Xho I and Not The I double restriction site was cloned into the psiCHECK2 vector. The wild-type gene fragment and the mutant gene fragment were located downstream of the luciferase-encoding gene (Luc), that is, in the plasmid DNA region after the 3' end of the Luc coding sequence, respectively, to construct the dual luciferase / wild-type reporter plasmid (abbreviated as USP12WT plasmid) and the dual luciferase / mutant reporter plasmid (abbreviated as USP12 MUT plasmid).

[0020] Wild-type gene fragment: GCTAGCGGAGGCTAAAGCGCTCATGTCCTGGCTCTTCAGTGAATTTAACTGTGTGACCTTGGGCAAGTCACTTAACCTCTCTGTGCTTCAGTCTCCCTGTCTTGTAAAATGGGAGTAATAACCTACCTCACAGGGTTGTTGTGGGGATTAATTAGAGATAATGTCTGTAAAGCATTTAAGGTTCTTGAAGAAGGCACTATATAAATACAAAATAATATCTATTAAAGTTGGTTTATTTGTGGTCGAC.

[0021] Mutant gene fragments: GCTAGCGGAGGCTAAAGCGCTCATGTCCTGGCTCTTCAGTGAATTTAACTGTGTGACCTTGGGCAAGTCACTTAACCTCTCTGTGCTTCAGTCTCCCTGTCTTGTAAAATGGGAGTAATACGATGGAGTCAGGGTTGTTGTGGGGATTAATTAGAGATAATGTCTGTAAAGCATTTAAGGTTCTTGAAGAAGGCACTATATAAATACAAAATAATATCTATTAAAGTTGGTTTATTTGTGGTCGAC.

[0022] Transfection: In the luciferase reporter gene assay, using one well of a 48-well plate as an example, 50 ng of USP12 WT plasmid / USP12 MUT plasmid and Let-7b-5p at a final concentration of 50 nM were mixed with 0.5 μL of Lipofectamine 2000 and co-transfected into HEK 293T cells seeded in a 48-well plate with 30 μL of Opti-MEM medium. 24 h after transfection, cell lysates were collected in opaque white 96-well plates. The activities of *Rhizopus spp.* and *Firefly spp.* luciferase were measured using the Dual-Lumi II dual luciferase reporter gene assay kit and a multifunctional cell imaging microplate reader. Relative light units (RLU) were used to measure the numerical values. Data Analysis: Using firefly luciferase activity as an internal control, the activity of *Rhizopus spp.* luciferase was normalized to obtain relative luciferase activity. Lower values ​​indicate stronger interaction between the reporter plasmid and the exogenous substance. Each group was repeated six times. Results are shown below. Figure 2 .Depend on Figure 2 It can be seen that there are target sites between Let-7b-5p and USP12 and they target each other. **** indicates that P < 0.0001.

[0023] Example 3 demonstrates that Let-7b-5p targets the deubiquitinase USP12, reducing the expression level of AR. Overexpression plasmid design: Based on the target site of the deubiquitinase USP12 found on TargetScan (https: / / www.targetscan.org / vert_80 / ), a fragment was designed, and the entire genome was synthesized by a company and approved through a multiple cloning site. Nhe I / Xho I was cloned into the pcDNA3.1(+) vector to obtain the plasmid pcDNA3.1(+)-USP12 (abbreviated as oe-USP12) that overexpresses USP12. The pcDNA3.1(+)-USP12 overexpression plasmid (oe-USP12) fragment is as follows:

[0024] Immortalized hair papilla cells were spaced at 0.5 × 10⁶ cells per well. 5 Cells were seeded in 24-well plates at a seeding density of 1000 cells / well. The cells were starved in serum-free DMEM high-glucose medium for 5 hours and then divided into Normal group, NC+pcDNA3.1(+) control group, Let-7b-5p+pcDNA3.1(+) treatment group and Let-7b-5p+oe-USP12 treatment group. The original culture medium was discarded. The normal group was treated with 800 μL of serum-free DMEM high-glucose medium. The NC+pcDNA3.1(+) treatment group, Let-7b-5p+pcDNA3.1(+) treatment group, and Let-7b-5p+oe-USP12 treatment group were all co-transfected with 3 μL of Lipofectamine 2000 to a final concentration of 50 nM Let-7b-5p (the NC+pcDNA3.1(+) treatment group was replaced with the corresponding volume of serum-free medium) and 0.5 μg of the target DNA plasmid (pcDNA3.1(+) or oe-USP12) in 800 μL of serum-free DMEM high-glucose medium. Cell proteins were collected 24 hours after transfection. The content of androgen receptors in dermal papilla cells was detected by Western blot, with each group repeated three times. ImageJ software was used to identify band gray values ​​and analyze relative expression levels. SPSS 25 statistical software was used for data analysis. Results are shown below. Figure 3 Treatment of human dermal papilla cells with Let-7b-5p alone decreased AR expression. However, treatment with the pcDNA3.1(+)-USP12 overexpression plasmid (oe-USP12) significantly increased USP12 expression in human dermal papilla cells, and consequently, Let-7b-5p treatment significantly increased AR expression. This indicates that overexpression of USP12 weakens or even eliminates the inhibitory effect of Let-7b-5p on AR. Figure 3 It can be seen that the Let-7b-5p+oe-USP12 group can significantly promote the expression of androgen receptors in human dermal papilla cells.

[0025] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Application of Let-7b-5p in the preparation of agents that promote androgen receptor degradation.

2. The application according to claim 1, characterized in that: The Let-7b-5p described herein promotes the ubiquitination and degradation of AR by targeting USP12 to inhibit the deubiquitination of AR.

3. The application according to claim 1 or 2, characterized in that: The degradation agent is a pharmaceutical preparation.

4. The application according to claim 1 or 2, characterized in that: The types of degradation agents mentioned include oral formulations and topical patches.

5. The application according to claim 4, characterized in that: The aforementioned external application patch is a transdermal patch.

Citation Information

Patent Citations

  • Mirna prostate cancer marker

    WO2018049506A1