A method for increasing the yield of amplified DNA in vitro and uses thereof

Abstract

The application provides a method and application for improving DNA yield in vitro amplification, and belongs to the technical field of biology. The application provides a method for improving DNA yield in vitro amplification, which comprises the following steps: (1) reacting a reaction system at 27-38 DEG C for 40-60 min; (2) adding the reaction liquid into a dialysis bag, adding dialysis liquid into an outer tube, and dialyzing at 30-38 DEG C; (3) supplementing tRNA into the reaction liquid for sealing after dialyzing for 1-3 h; the reaction system in step (1) comprises 5x synthesis enzyme mix, 5x synthesis reaction buffer, NTP, dNTP, a template and water; and the concentration of the dNTP is 0.1-0.5 mM. The method can significantly improve the DNA yield in vitro amplification, the concentration of the amplification product is increased by more than about 134 %, and the core problem of insufficient yield in the in vitro DNA amplification is effectively solved.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method and application for increasing the yield of DNA amplification in vitro. Background Technology

[0002] In vitro DNA amplification technology, as a core supporting technology in molecular biology, has greatly promoted progress in many fields such as gene cloning, molecular diagnostics, genetic disease screening, pathogen detection, and gene therapy. PCR-based derivative technologies and isothermal amplification technologies have emerged, further expanding the application scenarios of in vitro DNA amplification. Among them, isothermal amplification technologies (such as loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA)) have demonstrated unique value in rapid on-site detection and resource-constrained scenarios due to their advantages of not requiring complex thermal cycling equipment, mild reaction conditions, and convenient operation. These technologies typically complete amplification through enzymatic reactions at a constant temperature, avoiding the impact of repeated temperature changes on enzyme activity in PCR technology, and shortening the reaction cycle to 20-60 minutes, significantly improving amplification efficiency.

[0003] However, both traditional PCR and novel isothermal amplification techniques still face numerous bottlenecks in applications requiring high-yield DNA production (such as large-scale gene library construction and recombinant protein expression template preparation). Firstly, the yield of the amplification reaction is easily limited by the composition and concentration of the reaction system. Among these, dNTPs (deoxyribonucleoside triphosphates), as the core raw material for DNA synthesis, require particularly precise concentration optimization. Excessive concentration can lead to erroneous polymerase incorporation and mutations, while insufficient concentration will prematurely terminate the extension reaction due to insufficient raw materials, directly restricting product yield.

[0004] Furthermore, non-specific binding is a common problem in in vitro amplification systems—free primers and single-stranded DNA fragments readily adsorb non-specifically onto the reaction vessel walls or enzyme proteins, wasting reaction materials and potentially forming non-specific amplification products, further diverting the synthesis efficiency of the target DNA. The commonly used bovine serum albumin (BSA) blocking method in existing technologies is highly sensitive to temperature and pH, and it is difficult to achieve ideal results under mild isothermal conditions.

[0005] In summary, existing in vitro DNA amplification techniques still have significant shortcomings in terms of yield enhancement under mild reaction conditions, byproduct inhibition and elimination, and non-specific binding regulation. Therefore, developing a method that can efficiently increase DNA amplification yield in a mild environment, and which is simple to operate and cost-effective, is of great practical significance and application value for meeting the actual needs of life science research. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides a method and application for increasing the yield of DNA amplified in vitro.

[0007] Terminology Explanation

[0008] In this invention, pol III It refers to the Escherichia coli DNA polymerase III holoenzyme.

[0009] In this invention, NTP refers to four ribonucleoside triphosphates, including adenosine triphosphate (ATP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and guanosine triphosphate (GTP).

[0010] In this invention, dNTP refers to four deoxyribonucleoside triphosphates, including adenosine triphosphate (dATP), cytidine triphosphate (dCTP), thymidine triphosphate (dTTP), and guanosine triphosphate (GTP).

[0011] In this invention, tRNA refers to transport ribonucleic acid.

[0012] On one hand, the present invention provides a method for increasing the yield of in vitro amplified DNA, the method comprising the following steps:

[0013] (1) React the reaction system at 27-38℃ for 40-60 min;

[0014] (2) Add the reaction solution to the dialysis bag, add the dialysis solution to the outer tube, and perform dialysis at a constant temperature of 30-38℃;

[0015] (3) After dialysis for 1-3 hours, tRNA is added to the reaction solution for blocking;

[0016] The reaction system described in step (1) includes 5× synthase mix, 5× synthesis reaction buffer, NTP, dNTP, template and water; the concentration of dNTP is 0.1-0.5 mM.

[0017] Specifically, the concentration of the NTP is 20-30 mM (final concentration is 0.5-1 mM).

[0018] According to some embodiments of the present invention, the 5× synthase mix comprises a single-strand binding protein, an integrative host factor, a primase, an E. coli DNA polymerase III β subunit, an E. coli DNA polymerase III holoenzyme, an E. coli helicase and loader, DNA replication protein A, ribonuclease H, an E. coli DNA ligase, an E. coli DNA polymerase I, an E. coli DNA helicase, an E. coli topoisomerase IV, an E. coli topoisomerase III, and a RecQ helicase.

[0019] Specifically, the 5× synthase mix includes 1800-2200 nM single-strand binding protein, 180-220 nM integrative host factor, 1800-2200 nM primase, 180-220 nM E. coli DNA polymerase III β subunit, 20-30 nM E. coli DNA polymerase III holoenzyme, 80-120 nM E. coli helicase and loader, 450-550 nM DNA replication protein A, 40-60 nM ribonuclease H, 200-300 nM E. coli DNA ligase, 200-300 nM E. coli DNA polymerase I, 200-300 nM E. coli DNA helicase, 20-30 nM E. coli topoisomerase IV, 200-300 nM E. coli topoisomerase III, and 200-300 nM RecQ helicase.

[0020] Furthermore, the 5× synthase mix comprises 2000 nM single-strand binding protein, 200 nM integrative host factor, 2000 nM primerase, 200 nM E. coli DNA polymerase III β subunit, 25 nM E. coli DNA polymerase III holoenzyme, 100 nM E. coli helicase and loader, 500 nM DNA replication protein A, 50 nM ribonuclease H, 250 nM E. coli DNA ligase, 250 nM E. coli DNA polymerase I, 250 nM E. coli DNA helicase, 25 nM E. coli topoisomerase IV, 250 nM E. coli topoisomerase III, and 250 nM RecQ helicase.

[0021] According to some embodiments of the present invention, the 5× synthesis reaction buffer comprises buffer, dithiothreitol, potassium glutamate, magnesium acetate, creatine phosphate, nicotinamide adenine dinucleotide, ammonium sulfate, transfer RNA, calf serum albumin and creatine kinase.

[0022] Specifically, the 5× synthesis reaction buffer comprises 80-120mM Tris-HCl buffer, 30-50mM dithiothreitol, 700-800mM potassium glutamate, 40-60mM magnesium acetate, 10-30mM creatine phosphate, 0.5-2mM nicotinamide adenine dinucleotide, 40-60mM ammonium sulfate, 100-300 μg / mL transfer RNA, 0.1-2 mg / mL fetal serum albumin, and 80-120 μg / mL creatine kinase.

[0023] Furthermore, the 5× synthesis reaction buffer comprises 100 mM Tris-HCl buffer, 40 mM dithiothreitol, 750 mM potassium glutamate, 50 mM magnesium acetate, 20 mM creatine phosphate, 1 mM nicotinamide adenine dinucleotide, 50 mM ammonium sulfate, 250 μg / mL transfer RNA, 0.5 mg / mL fetal bovine serum albumin, and 100 μg / mL creatine kinase.

[0024] Specifically, the template is selected from the M13ms9 plasmid template, the pMD-oriC template, or the pTNTR-5.6AT template.

[0025] Furthermore, the M13ms9 template construction method includes:

[0026] (1) Extract the genome of Escherichia coli BL21(DE3) strain and use primer pairs:

[0027] ATCCCATGGCCCGGGCCGTGGATTCTAC (SEQ ID NO:1);

[0028] CTTATGCATGAAGATCAACATTCTTGATCACG (SEQ ID NO: 2);

[0029] (2) Amplification of the oriC sequence

[0030] Purchase M13mp18 plasmid (TAKARA, catalog number 3518) and use the following primer pairs:

[0031] ATCCCATGGTTAAGACTCCTTATTACGCAGTATGTTAGC (SEQ ID NO: 3);

[0032] ATCCCATGGCTTATGCAT CGTAATAAGGAGTCTTAATCATGCCAG (SEQ ID NO: 4);

[0033] (3) Amplify the M13 sequence. Digest the two amplification products with Nco I and Nsi I. After recovering the fragments from the gel, ligate them with T4 ligase. Transform the ligation product into Escherichia coli JM109 strain, perform blue-white screening, select blue-white single clones, extract plasmids and perform sequencing identification.

[0034] Specifically, the dialysate in step (2) includes Column buffer, 5× dialysate buffer, dNTP, ATP, CTP / UTP / GTP, ammonium sulfate and water.

[0035] Furthermore, the dialysate in step (2) includes 0.1-0.5 mM dNTP, 1-3 mM ATP, and 0.5-1 mM CTP / UTP / GTP.

[0036] Furthermore, in step (2), the dialysate includes ammonium sulfate with a final concentration of 8-12 mM.

[0037] On the other hand, the present invention provides the application of the above-described scheme in increasing DNA yield in vitro.

[0038] The beneficial effects of this invention are as follows:

[0039] The method of this invention can significantly improve the yield of in vitro DNA amplification. By optimizing key parameters of the reaction system, a substantial increase in DNA amplification yield is achieved. Simultaneously, after optimization of the incubation and dialysis processes, the concentration of amplified products is increased by approximately 134%, and the yield reaches an optimal level at the end of the dialysis reaction, effectively solving the core problem of insufficient yield in in vitro DNA amplification. Furthermore, the method of this invention improves the quality of amplified products, reduces byproducts and degradation, and ensures the integrity and purity of the amplified products. Attached Figure Description

[0040] Figure 1 For the 15 min reaction results, 2 μL of sample was loaded into each lane: 1, dNTP control, final concentration 0.1 mM; 2, 1 mM dNTP final concentration; 3, 0.5 mM dNTP final concentration; 4, 0.25 mM final concentration.

[0041] Figure 2 For the 1-hour reaction results, 2 μL of sample was loaded into each lane: 1, dNTP control, final concentration 0.1 mM; 2, 1 mM dNTP final concentration; 3, 0.5 mM dNTP final concentration; 4, 0.25 mM final concentration.

[0042] Figure 3 The reaction solution was 300 μL for electrophoresis detection, and the sample loading volume was 2 μL.

[0043] Figure 4 The results are for electrophoresis after constant dialysis incubation at 37 degrees Celsius for 2 hours, with a sample loading volume of 1 μL.

[0044] Figure 5 The results are compared between electrophoresis after constant dialysis incubation at 37 degrees Celsius for 2 hours and 6 hours, with a sample loading volume of 1 μL.

[0045] Figure 6 The results are compared between electrophoresis after constant dialysis incubation at 37 degrees Celsius for 6 h and 18 h, with a sample loading volume of 1 μL.

[0046] Figure 7After 18 hours of dialysis incubation, electrophoresis was repeated, with a sample loading volume of 1 μL.

[0047] Figure 8 For the electrophoresis results after dialysis for 2.5 h, the sample loading volume was 1 μL.

[0048] Figure 9 The results are for electrophoresis after constant dialysis incubation at 37 degrees Celsius for 2.5 h and 4 h, with a sample loading volume of 1 μL.

[0049] Figure 10 The results are compared between electrophoresis after constant dialysis incubation at 37 degrees Celsius for 4 hours and 8 hours, with a sample loading volume of 1 μL.

[0050] Figure 11 The results are for electrophoresis comparison between constant dialysis incubation at 37 degrees Celsius for 8 h and 20 h, with a sample loading volume of 1 μL.

[0051] Figures 12-13 The results are from electrophoresis.

[0052] Figure 14 The results of the concentration determination are shown in the figure. 1 is the control concentration, and 2 is the concentration of the dialysis incubation group after being diluted 5 times.

[0053] Figure 15 To assess the amplification effect of ligation products at different temperatures, 1 μL of sample was loaded after overnight incubation.

[0054] Figure 16 To ensure the successive passaging electrophoresis results of the ligation products, lane 1: after purification of the ligation products at 27°C; lanes 2-4: after diluting the endpoint product of the previous reaction to 10 pg / μL, take 1 μL and add it to the 10 μL reaction system and incubate at 27°C. Load 1 μL of sample.

[0055] Figure 17 To verify the amplification results of the ligation product at extreme dilutions, A. Amplification results at 27°C under different template concentrations: 1. 1 pg template was added to 10 μL of the reaction system for amplification; 2-4. 1 fg template was added to 10 μL of the reaction system for amplification; 5-7. 10 fg template was added to 10 μL of the reaction system for amplification; 2 μL of sample was loaded. B. Verification of the amplified product by BamHI restriction enzyme digestion, detecting the presence of bands different from the control lane 1; 1.5 μL of sample was loaded; lanes 1-7 in B correspond to... Figure 17 The electrophoresis results of lanes 1-7 in Figure A after enzyme digestion.

[0056] Figure 18 To be Figure 17 The electrophoresis results of the amplification products in lanes 4 and 7 shown are obtained by continuous passage. After diluting the endpoint product of the previous reaction to 10 pg / μL, 1 μL of the product was added to a 10 μL reaction system and incubated at 27 degrees Celsius. 2 μL of the product was then loaded onto the reaction system.

[0057] Figure 19 The results of electrophoresis were obtained after dialysis at 30 degrees Celsius for 4.5 h, followed by overnight incubation and loading of 1 μL of sample. Detailed Implementation

[0058] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are not intended to limit the present invention, but only to illustrate the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are generally performed under conventional conditions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0059] Example 1

[0060] I. Experimental Materials

[0061] 1. Reagents

[0062] Table 1

[0063]

[0064] mM each refers to millimoles per liter per component.

[0065] Enzyme mix and buffer components:

[0066] Table 2

[0067]

[0068] The working concentration of ammonium sulfate in the reaction system is 10 mM. Since the elution buffer of DnaA protein in the enzyme mix contains a high concentration of ammonium sulfate, the ammonium sulfate content in the buffer needs to be adjusted according to the volume of DnaA protein added to the enzyme mix.

[0069] Table 3

[0070]

[0071] 2. Equipment

[0072] Electrophoresis apparatus, PCR instrument, gel imaging system, shaker.

[0073] II. Experimental Methods

[0074] (1) Experimental design

[0075] 1) The performance of Shanghai Zhaowei dNTPs was determined using synthase mix, and the dNTP gradient was set to detect the reaction rate and the reaction endpoint yield.

[0076] 2) New mixed synthase mix (without polIII) ), set polIII The concentration gradient was used to detect the reaction rate and the endpoint yield.

[0077] (2) Experimental steps

[0078] dNTP testing: The test concentrations were 1 mM, 0.5 mM, and 0.25 mM, with three final concentration gradients.

[0079] polIII Tests were conducted at three concentration gradients: 1 μL / 1000 μL, 2 μL / 1000 μL, and 3 μL / 1000 μL.

[0080] Preparation of the reaction system:

[0081] Table 4

[0082]

[0083] M13ms9 template construction method:

[0084] Genome of Escherichia coli BL21(DE3) strain was extracted and primer pairs were used:

[0085] ATCCCATGGCCCGGGCCGTGGATTCTAC (SEQ ID NO:1);

[0086] CTTATGCATGAAGATCAACATTCTTGATCACG (SEQ ID NO: 2);

[0087] Amplification of oriC sequence

[0088] Purchase M13mp18 plasmid (TAKARA, catalog number 3518) and use the following primer pairs:

[0089] ATCCCATGGTTAAGACTCCTTATTACGCAGTATGTTAGC (SEQ ID NO: 3);

[0090] ATCCCATGGCTTATGCAT CGTAATAAGGAGTCTTAATCATGCCAG (SEQ ID NO: 4).

[0091] The M13 sequence was amplified, and the two amplification products were digested with Nco I and Nsi I. After the fragments were recovered from the gel, they were ligated using T4 ligase. The ligation products were transformed into Escherichia coli JM109 strain, and blue-white screening was performed to select blue-white single clones. The plasmids were extracted and sequenced for identification.

[0092] After preparation, add polIII according to the group. 5× synthase mix or without polIII Mix 20 μL of 5× enzyme and add the corresponding amount of polIII according to the experimental design. .

[0093] After preparation, the mixture was reacted at a constant temperature of 37°C. 2 μL of the mixture was taken for electrophoresis at 15 min and 40 min, and the concentration at the 40 min endpoint was determined using a Qubit analyzer.

[0094] (3) Experimental results

[0095] Concentration determination (Qubit assay, sample diluted 5 times after enzyme digestion):

[0096] Sample 1: 12.9 ng / μL; Sample 3: 19.4 ng / μL; Sample 4: 20.6 ng / μL.

[0097] The results are as follows Figures 1-2 As shown, the experimental results demonstrate the new polIII The activity was normal. In the dNTP test, although the reaction rate decreased when the dNTP concentration increased, the 0.25-0.5 mM final concentration group at the reaction endpoint could obtain a higher yield.

[0098] Concentration (reaction endpoint concentration, determined by Qubit): Lane 1: 64.5 ng / μL; Lane 3: 97.0 ng / μL; Lane 4: 103.0 ng / μL.

[0099] Example 2

[0100] I. Experimental Materials

[0101] 1. Reagents

[0102] Table 5

[0103]

[0104] M13ms9 sequence (SEQ ID NO:11):

[0105]

[0106] 2. Equipment

[0107] Electrophoresis apparatus, PCR instrument, gel imaging system, shaker.

[0108] II. Experimental Methods

[0109] (1) Experimental design

[0110] 1) After preparing a 300 μL reaction system, react it at 37 degrees Celsius for 50 min until near the endpoint. Divide the reaction system into 4 groups. For 3 groups, 90 μL of the reaction solution was aspirated into a MW6000 dialysis bag and dialyzed at 37 degrees Celsius. The external dialysate contained different concentrations of dNTPs. The remaining reaction solution was placed at 37 degrees Celsius for 10 min and then placed at 4 degrees Celsius as a control.

[0111] 2) Every so often, a portion of the solution in the dialysis bag is aspirated and electrophoresed to detect the yield increase. After dialysis for 2 hours, tRNA is added to the reaction system for blocking, and the dialysis solution in the outer tube is replaced once.

[0112] (2) Experimental steps

[0113] Preparation of the reaction system:

[0114] Table 6

[0115]

[0116] After mixing, the mixture was reacted at 37 degrees Celsius for 50 minutes, and the reaction was detected by electrophoresis.

[0117] Preparation of dialysis solution:

[0118] Table 7

[0119]

[0120] Group 1: 0.1 mM dNTP dialysate;

[0121] Group 2: 0.25 mM dNTP dialysate;

[0122] Group 3: 0.5 mM dNTP dialysate.

[0123] Add the reaction solution to the dialysis bag, add 1.8 mL of dialysis solution to the outer tube, and dialyze at a constant temperature of 37 degrees Celsius. After dialysis for 2 hours, add tRNA to the reaction solution for blocking and replace the dialysis solution in the outer tube.

[0124] (3) Experimental results

[0125] The results are as follows Figures 3-7 As shown in the table below, the concentration measurement results are as follows:

[0126] Table 8

[0127]

[0128] Post-digestion assay: Add 2 μL of the reaction product to a 10 μL digestion system and incubate at 37°C for linearization. Then, take the linearized product for Qubit concentration determination. Multiply the measured concentration by 5 to obtain the true concentration.

[0129] During the incubation process, the concentration of Group 1 increased by approximately 134%. The yields of Group 2 and Group 3 were generally similar during dialysis. Group 2 was slightly higher than Group 3 in the early stage, but as the dialysis time increased, the yield of Group 3 was slightly higher than that of Group 2 (inferred from the concentration measurement results of Qubit).

[0130] Example 3

[0131] I. Experimental Materials

[0132] The reagents and equipment are the same as in Example 2.

[0133] II. Experimental Methods

[0134] (1) Experimental design

[0135] 1) After preparing a 400 μL reaction system, react it at 37 degrees Celsius for 50 min until near the endpoint. Divide the reaction system into 4 groups. For 3 groups, 90 μL of the reaction solution was aspirated into a MW6000 dialysis bag and dialyzed at 37 degrees Celsius. The external dialysate contained different concentrations of NTP. The remaining reaction solution was placed at 37 degrees Celsius for 10 min and then placed at 4 degrees Celsius as a control.

[0136] 2) Periodically aspirate a portion of the solution from the dialysis bag for electrophoresis to detect the yield increase. At the start of dialysis and 4 hours after dialysis, add tRNA to the reaction system for blocking. Change the dialysis buffer once every 4 hours of dialysis.

[0137] (2) Experimental steps

[0138] Preparation of the reaction system:

[0139] Table 9

[0140]

[0141] After mixing, the mixture was reacted at 37 degrees Celsius for 50 minutes, and the reaction was detected by electrophoresis.

[0142] Preparation of dialysis solution:

[0143] Table 10

[0144]

[0145] Group 1 0.25mM dNTP, 1 mM NTP;

[0146] Group 2: 0.25 mM dNTP, 2 mM ATP, 0.5 mM CTP / UTP / GTP (final concentration of each of the three nucleoside triphosphates at 0.5 mM).

[0147] Group 3 0.25mM dNTP, 2 mM ATP, 0.8 mM CTP / UTP / GTP;

[0148] Group 4 0.25mM dNTP, 2mM ATP, 1mM CTP / UTP / GTP.

[0149] Add the reaction solution to the dialysis bag, add 1.8 mL of dialysis solution to the outer tube, and dialyze at a constant temperature of 37 degrees Celsius. After dialysis for 2 hours, add tRNA to the reaction solution for blocking and replace the dialysis solution in the outer tube.

[0150] (3) Experimental results

[0151] The results are as follows Figures 8-11 As shown in the table below, the concentration measurements were performed:

[0152] Table 11

[0153]

[0154] Compared with the results of Example 2, the yield of the control dialysis group increased, while the yield of Group 2 was the highest at the end of the dialysis reaction (based on the Qubit concentration measurement results).

[0155] Example 4

[0156] I. Experimental Materials

[0157] 1. Reagents

[0158] Table 12

[0159]

[0160] pMD-oriC plasmid construction method:

[0161] pMD2.G original plasmid and sequence (gifted by Hangzhou Normal University) (SEQ ID NO:12):

[0162]

[0163] oriC (including termination sequence) ter Sequence (Universal Gene Synthesis) (SEQ ID NO:13):

[0164] CTGCTCTGATGCCGCATAGTATGTTGTAACTAAAGATCTACTGTGGATAACTCTGTCAGGAAGCTTGGATCAACCGGTAGTTATCCAAAGAACAACTGTTGTTCAGTTTTTGAGTTGTGTATAACCCCTCATTCTGATCCCAGCTTATACGGTCCAGGATCACCGATC ATTCACAGTTAATGATCCTTTCCAGGTTGTTGATCTTAAAAGCCGGATCCTTGTTATCCACAGGGCAGTGCGATCCTAATAAGAGATCACAATAGAACAGATCTCTAAATAAATAGATCTTCTTTTTAATACTTTAGTTACAACATACTGTTAAGCCAGCCCCGACAC.

[0165] The two sequences above were amplified by PCR using the two pairs of primers below, and then seamlessly cloned using the flexible and versatile ClonExpress Ultra One Step Cloning Kit (Novizan, C115) to obtain the plasmid template.

[0166] oriC sequence primers:

[0167] Forward primer: GGATCCCCTGAGGGGGCCCCCTGCTCTGATGCCGCATAG (SEQ ID NO:14);

[0168] Reverse primer: GCCGGATCCTCTAGCCCATGGTGTCGGGGCTGGCTTAAC (SEQ ID NO:15).

[0169] pMD2.G primers:

[0170] Forward primer: GTTAAGCCAGCCCCGACACCATGGGCTAGAGGATCCGGC (SEQ ID NO:16);

[0171] Reverse primer: CTATGCGGCATCAGAGCAGGGGGCCCCCTCAGGGGATCC (SEQ ID NO:17).

[0172] 2. Equipment

[0173] Electrophoresis apparatus, PCR instrument, gel imaging system, shaker.

[0174] II. Experimental Procedure

[0175] 1) Experimental Design

[0176] Prepare a 100 μL reaction system according to the synthesis formula. Take 85 μL and add it to a dialysis bag for dialysis incubation. Place the remaining 15 μL in a PCR instrument for constant temperature incubation at 37 degrees Celsius. Compare the yields of incubation for 2 hours and overnight incubation.

[0177] 2) Experimental Procedure

[0178] Preparation of the reaction system:

[0179] Table 13

[0180]

[0181] Preparation of dialysis solution:

[0182] Table 14

[0183]

[0184] 85 μL of the synthesis mixture was added to a dialysis bag, which was then placed in dialysis buffer and incubated at 37°C on a shaker. The remaining 15 μL of the reaction mixture was incubated in a PCR instrument at 37°C. After 2 hours, 2.5 μL of each mixture was aspirated for electrophoresis, and the dialysis buffer was replaced once (500 μL was discarded and replaced with 500 μL of fresh dialysis buffer). The dialysis bag was then returned to the dialysis buffer and incubated overnight. Electrophoresis was performed the next day, and the concentration was determined using a Qubit assay. The remaining volume after dialysis incubation was also measured to estimate the yield increase.

[0185] Experimental results are as follows Figures 12-14 As shown, the yield increased by approximately 134%.

[0186] Example 5

[0187] Table 15

[0188]

[0189] Experimental equipment: electrophoresis apparatus, PCR instrument, gel imaging system.

[0190] Experimental procedure:

[0191] 1) Experimental Design

[0192] 1. Construct an optimized oriC template according to the method for constructing a homologous recombination kit, and directly add the recombination product to the amplification system for amplification.

[0193] 2. Dilute and passage the homologous recombination amplification product, and determine the number of passages (until heterogeneous byproducts appear). Compare this number of passages with the number of passages of the single amplification product obtained by limiting the dilution of the homologous recombination amplification product.

[0194] Optimized 5.6AT-oriC sequence (SEQ ID NO:5):

[0195] TGCCGCTATAGTGAGTCGTAGTATGTTGTACCTAAAGGGATCCTGGGTATTAAAAAGAAGATCTATTTATTTATATATATATTATATTATTATTATTAGGATCGCACTGCCCTGTGGATAACAAGGATCCGGCTTTTAAGATCAACAACCTGGAAAGGATCATTAACTGTGAATGATCGGTGATC CTGGACCGTATAAGCTGGGATCAGAATGAGGGGTTATACACAGCTGAGGAACTGAAGAGCAGTTGTTCTTTGGATAACTACCGGTTGATCCAAGCTTCCTGACAGAGTTATCCACAGTAGATCGCACGATCTGTCAGCTCATTTCCTTTAGGTACAACATACTAGAATATTTGCCTACAGCCTCCTTT.

[0196] pTnTR plasmid sequence (SEQ ID NO:6):

[0197]

[0198] Constructing the pTnTR-5.6AT plasmid:

[0199] The pTnTR vector sequence to be recombined was amplified using the following primers:

[0200] pTnTR forward primer: GCGCATAGTTAAGCCAGCC (SEQ ID NO:7);

[0201] pTnTR-reverse primer: ATCAGAGCAGATTGTACTGA (SEQ ID NO:8).

[0202] The 5.6AT-oriC sequence to be recombined was amplified using the following primers:

[0203] 5.6AT-pTnTR-forward primer:

[0204] ACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATgtcattttcacactataatg (SEQ IDNO:9);

[0205] 5.6AT-pTnTR-reverse primer:

[0206] CGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCAAAGGAGGCTGTAGGCAAAT (SEQ ID NO: 10).

[0207] After the amplification product was excised and recovered from the gel, its concentration was determined. It was then mixed at a molar ratio of 1:1 and plasmid recombination was performed using a homologous recombination kit. The reaction was carried out at 50°C for 10 minutes. 5 μL of the product was added to 100 μL of the total amplification system, mixed well, and divided into two equal portions. The portions were incubated at 33°C and 27°C, respectively. The amplification effect was detected by electrophoresis after 5 h.

[0208] Preparation of the reaction system:

[0209] Table 16 Reaction System

[0210]

[0211] If the amplified product bands show normal values, purify the product and perform continuous passage. Electrophoresis is used to detect the number of passages that can be performed normally. Compare this to the number of passages of the amplified single product after the homologous recombination amplified product has been extremely diluted.

[0212] The results are as follows Figures 15-18As shown, after doubling tRNA, the ligation product incubated at high temperature overnight showed degradation of the synthetic product. Nuclease residues remained in the purchased tRNA powder. The presence of nuclease leads to the loss of supercoil, and replication initiation also requires a plasmid with a supercoiled conformation. This will reduce the proportion of supercoiled products and may also decrease the synthesis rate. The presence of nuclease may cause erroneous ligation during the ligase repair process, leading to the generation of short fragment byproducts (the size of byproducts generated under extreme gradient dilutions varies, and the byproducts generated by direct passaging of the ligation product are also different from all byproducts under extreme dilutions; byproducts generated during passaging may be products generated during passaging rather than products containing erroneous ligation in the initial template). The possibility of this erroneous ligation is reduced at low temperatures.

[0213] Example 6

[0214] Table 17 Experimental Reagents

[0215]

[0216] Experimental equipment: electrophoresis apparatus, PCR instrument, gel imaging system.

[0217] Experimental procedure:

[0218] 1) Experimental Design

[0219] The template was added to the amplification system and incubated at 30 degrees Celsius until the endpoint. 80 μL was then dialyzed, and the remainder was stored at 4 degrees Celsius. After dialysis, electrophoresis was performed to compare the concentration difference between the undialyzed and dialyzed samples.

[0220] 2) Experimental Procedure

[0221] Table 18 Reaction System

[0222]

[0223] Table 19 Dialysis fluid

[0224]

[0225] Experimental results:

[0226] Figure 19 The results of electrophoresis after dialysis at 30 degrees Celsius for 4.5 hours are shown in Table 20 below.

[0227] Table 20 Concentration Measurement Results

[0228]

[0229] The incubation rate at 30 degrees Celsius was similar to that at 37 degrees Celsius for the unoptimized oriC sequence.

[0230] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for increasing the yield of in vitro amplified DNA, characterized in that, The method includes the following steps: (1) React the reaction system at 27-38℃ for 40-60 min; (2) Add the reaction solution to the dialysis bag, add the dialysis solution to the outer tube, and perform dialysis at a constant temperature of 30-38℃; (3) After dialysis for 1-3 hours, tRNA is added to the reaction solution for blocking; The reaction system described in step (1) includes 5× synthase mix, 5× synthesis reaction buffer, NTP, dNTP, template and water; the concentration of the NTP is 20-30 mM; the concentration of the dNTP is 0.1-0.5 mM. The 5× synthase mix includes single-strand binding protein, integrative host factor, primase, E. coli DNA polymerase III β subunit, E. coli DNA polymerase III holoenzyme, E. coli helicase and loader, DNA replication protein A, ribonuclease H, E. coli DNA ligase, E. coli DNA polymerase I, E. coli DNA helicase, E. coli topoisomerase IV, E. coli topoisomerase III, and RecQ helicase; The 5× synthesis reaction buffer comprises buffer, dithiothreitol, potassium glutamate, magnesium acetate, creatine phosphate, nicotinamide adenine dinucleotide, ammonium sulfate, transfer RNA, calf serum albumin, and creatine kinase; The template is the M13ms9 plasmid template, and the sequence of the M13ms9 plasmid template is shown in SEQ ID NO:11; The dialysate in step (2) includes Column buffer, 5× dialysate buffer, dNTP, ATP, CTP / UTP / GTP, ammonium sulfate and water.

2. The method according to claim 1, characterized in that, The 5× synthase mix comprises 1800-2200 nM single-strand binding protein, 180-220 nM integrative host factor, 1800-2200 nM primase, 180-220 nM E. coli DNA polymerase III β subunit, 20-30 nM E. coli DNA polymerase III holoenzyme, 80-120 nM E. coli helicase and loader, 450-550 nM DNA replication protein A, 40-60 nM ribonuclease H, 200-300 nM E. coli DNA ligase, 200-300 nM E. coli DNA polymerase I, 200-300 nM E. coli DNA helicase, 20-300 nM E. coli topoisomerase IV, 200-300 nM E. coli topoisomerase III, and 200-300 nM RecQ helicase. The 5× synthesis reaction buffer comprises 80-120 mM Tris-HCl buffer, 30-50 mM dithiothreitol, 700-800 mM potassium glutamate, 40-60 mM magnesium acetate, 10-30 mM creatine phosphate, 0.5-2 mM nicotinamide adenine dinucleotide, 40-60 mM ammonium sulfate, 100-300 μg / mL transfer RNA, 0.1-2 mg / mL fetal bovine serum albumin, and 80-120 μg / mL creatine kinase.

3. The method according to claim 1, characterized in that, The dialysate in step (2) includes 0.1-0.5 mM dNTP, 1-3 mM ATP, and 0.5-1 mM CTP / UTP / GTP.

4. The method according to claim 3, characterized in that, The dialysate in step (2) includes 0.25 mM dNTP, 2 mM ATP, and 0.5 mM CTP / UTP / GTP.

5. The method according to claim 1, characterized in that, In step (2), the dialysate includes ammonium sulfate with a final concentration of 8-12 mM.

6. The use of the method according to any one of claims 1-5 in increasing the yield of DNA amplification in vitro.

Images