Application of gene CBX5 inhibitor in preparation of preparation for treating nasopharynx cancer

By regulating the lactation pathway through the gene CBX5 inhibitor shCBX5, the lack of specific intervention methods in existing technologies has been solved, enabling precise treatment and prognostic assessment of nasopharyngeal carcinoma and revealing the regulatory mechanism of CBX5 in nasopharyngeal carcinoma.

CN121759453APending Publication Date: 2026-03-31THE PEOPLES HOSPITAL OF GUANGXI ZHUANG AUTONOMOUS REGION
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-20
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Current strategies for treating nasopharyngeal carcinoma lack specific interventions targeting lactation modification. They are highly non-specific, have significant systemic toxicity, cannot achieve precise regulation of specific lactation events, and fail to effectively integrate metabolic intervention, epigenetic regulation, and immune activation, making it difficult to overcome drug resistance and immunosuppression.

Method used

Using the gene CBX5 inhibitor shCBX5, we silenced the CBX5 gene to regulate the lactation pathway, constructed a nasopharyngeal carcinoma model, verified the function of CBX5 in nasopharyngeal carcinoma, and revealed its role in lactation regulation.

Benefits of technology

This study provides a new target that influences tumor malignant progression by regulating lactation levels, offering a novel strategy for nasopharyngeal carcinoma treatment. It also systematically elucidates the mechanism of action of CBX5 in nasopharyngeal carcinoma, enabling precise prognostic assessment and individualized treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759453A_ABST
    Figure CN121759453A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicines, and particularly discloses application of a gene CBX5 inhibitor in preparation of a preparation for treating nasopharynx cancer. A plurality of machine learning algorithms are integrated to screen out a key gene CBX5 related to lactylation, and the key gene CBX5 is proved to be remarkably and highly expressed in nasopharynx cancer tissues and is related to poor prognosis. In-vitro experiments show that the proliferation, migration and invasion ability of nasopharyngeal carcinoma cells can be remarkably inhibited by silencing the CBX5. Mechanism research finds that CBX5 affects malignant progression of tumors by regulating and controlling the lactylation modification level, specifically, CBX5 silencing causes reduction of the whole-cell lactylation level, but self-combined lactylation signals are enhanced. RNA-seq analysis further reveals that CBX5 plays a role in promoting cancer by influencing a metabolic pathway, ribosome functions, PI3K-Akt and other key carcinogenic signal pathways. The invention provides a novel prognosis biomarker and a potential treatment target for nasopharyngeal carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of gene CBX5 inhibitors in the preparation of agents for the treatment of nasopharyngeal carcinoma. Background Technology

[0002] Nasopharyngeal carcinoma is an epithelial malignant tumor with a distinct geographical distribution, prevalent in southern China and Southeast Asia. This disease is highly aggressive and prone to early metastasis. Currently, the main clinical treatment strategy is radiotherapy combined with TPF regimens (including paclitaxel, cisplatin, and 5-fluorouracil) chemotherapy. However, treatment resistance and the immunosuppressive microenvironment remain key bottlenecks limiting the improvement of treatment efficacy.

[0003] Recent studies have revealed that lactation modification, as a novel post-translational modification of proteins, plays a crucial role in metabolic reprogramming, immune escape, and drug resistance formation in nasopharyngeal carcinoma. For example, patent CN120623305A discloses the application of mutants targeting histone lactation modification sites in tumor intervention, while CN120267661A reveals the role of the natural product icariin in inhibiting the malignant behavior of liver cancer stem cells by regulating lactation levels. However, existing technologies have significant limitations: First, there is a lack of specific intervention methods targeting lactation modification. Existing strategies mainly indirectly affect lactate production by inhibiting the activity of enzymes such as LDHA, which suffers from high target nonspecificity and significant systemic toxicity, failing to achieve precise regulation of specific lactation events. Second, the functional mechanism of the key regulatory factor CBX5 in nasopharyngeal carcinoma remains unclear. Although CBX5 has been shown to reverse drug resistance in tumors such as lung adenocarcinoma by regulating the ferroptosis pathway, its expression characteristics, prognostic value, and association with lactation modification in nasopharyngeal carcinoma remain unknown. Furthermore, current treatment strategies fail to effectively integrate metabolic intervention, epigenetic regulation, and immune activation, making it difficult to synergistically overcome drug resistance and immunosuppression. Simultaneously, the lack of functionally validated nasopharyngeal carcinoma-specific lactation target genes results in a lack of a reliable molecular basis for targeted therapy development.

[0004] Based on the deficiencies of the existing technology, this application aims to provide a new strategy for the treatment of nasopharyngeal carcinoma based on CBX5 regulation and lactation pathway intervention. Summary of the Invention

[0005] This invention provides a CBX5 gene inhibitor, wherein the CBX5 inhibitor is shCBX5; the shCBX5 is used to silence the CBX5 gene.

[0006] Furthermore, the CBX5 gene is the most promising lactation regulator identified by cross-validating candidate genes in the prognostic model, combining the frequency of occurrence of each gene in the nasopharyngeal carcinoma cohort, survival correlation (Kaplan-Meier analysis), and expression differences between tumor tissue and adjacent normal tissue (from GEO / TNMplot).

[0007] Furthermore, the coding sequence of shCBX5 is selected from one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0008] Furthermore, the specific sequence of SEQ ID NO: 1 (sh1) is GGATCCTGGATTGCCCTGAGCTAATTTCTCGAGAAATTAGCTCAGGGCAATCCATTTTTTGAATTC; The specific sequence of SEQ ID NO: 2 (sh2) is GGATCCCAGATTCCTGTGGTGATTTAACTCGAGTTAAATCACCACAGGAATCTGTTTTTTGAATTC; The specific sequence of SEQ ID NO: 3 (sh3) is GGATCCGTTAAGGGACAAGTGGAATATCTCGAGATATTCCACTTGTCCCTTAACTTTTTTGAATTC.

[0009] Furthermore, the CBX5 gene inhibitor is obtained by cloning one of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 into the pLVX-mCherry-Puro lentiviral vector.

[0010] Furthermore, this includes the following steps: The nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 was cloned into the lentiviral expression vector pLVX-mCherry-Puro.

[0011] A method for preparing a nasopharyngeal carcinoma model with CBX5 gene silencing, characterized by the following steps: introducing a recombinant lentiviral vector into nasopharyngeal carcinoma cells and screening to obtain a cell line with a stable CBX5 gene silence.

[0012] Furthermore, silencing the CBX5 gene leads to a downregulation of cellular lactation levels.

[0013] Furthermore, the expression level of the CBX5 gene is negatively correlated with overall survival.

[0014] Furthermore, the CCK8 assay confirmed that silencing CBX5 inhibited the proliferation of nasopharyngeal carcinoma cells; the scratch healing assay showed that CBX5 silencing weakened cell migration; and the Transwell invasion assay confirmed that silencing CBX5 reduced the invasive ability of cancer cells.

[0015] Furthermore, CBX5 promotes the invasion and metastasis of nasopharyngeal carcinoma cells through its own lactation and its regulation of global lactation.

[0016] Furthermore, RNA-seq analysis showed that CBX5 indirectly regulates lactation levels by inhibiting the expression of pro-lactation genes.

[0017] Furthermore, this application also constructs a prognostic assessment model for nasopharyngeal carcinoma related to lactation genes with excellent predictive performance.

[0018] Compared with existing technologies, the advantages and effects of this application are as follows: 1. Through multi-algorithm screening and experimental verification, this application found that CBX5, as a key lactation regulator, can not only serve as a prognostic biomarker for nasopharyngeal carcinoma, but also influence the malignant progression of tumors by regulating the global lactation level, thus providing a new target for the treatment of nasopharyngeal carcinoma.

[0019] 2. This application systematically elucidates the network of action of CBX5 through RNA-seq and bioinformatics analysis, which regulates the expression of lactation-related genes, affects ribosome function, and multiple metabolic pathways, providing a new perspective for understanding the mechanism of lactation in tumor progression.

[0020] The above description is only an overview of the technical solution of this application. In order to better understand the technical means of this application and implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of this application more obvious and understandable, the preferred embodiments of this application are described in detail below with reference to the accompanying drawings.

[0021] The above and other objects, advantages and features of this application will become more apparent to those skilled in the art from the following detailed description of specific embodiments in conjunction with the accompanying drawings. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0023] in: Figure 1 This is a flowchart of the overall experimental process for this application; Figure 2 To identify lactation-related genes, A is a forest plot showing lactation-related genes associated with tumor prognosis in the training set; B is a box plot showing the expression differences of each gene in tumor tissues and control tissues; C is a heatmap of the correlation matrix of gene expression values; and D is a gene interaction graph. Figure 3 A C-index comparison of the best model performance and the performance of published models; Figure 4 For the AUC comparison between the best model performance and the published model performance, A represents the ROC curve analysis of 1-year overall survival (OS); B represents the ROC curve analysis of 3-year overall survival (OS). Figure 5 Kaplan-Meier survival analyses were performed on the risk groups of the training and validation set data models. Specifically, A represents the overall survival analysis of high-risk and low-risk patients in the TCGA cohort; B represents the overall survival analysis of high-risk and low-risk patients in the GSE102349 (NPC) cohort; and C represents the overall survival analysis of high-risk and low-risk patients in the GSE41613 cohort. Figure 6 Comparison of HR risk ratios between the best model performance and published model performance; Figure 7 Survival differences grouped by hazard score; Figure 8 Differential genes among hazard groups on the volcano map; Figure 9 GO enrichment analysis for differentially expressed genes; Figure 10 KEGG enrichment analysis for differentially expressed genes; Figure 11 For gene interaction analysis; Figure 12 A Pareto chart of semantic analysis of regulatory factors; Figure 13For analysis of immune infiltration and efficacy of immunotherapy, A is a box plot showing the differential distribution of immune cell components; B is the AUC of the best immune response prediction; C is a comparison of the AUC of the lactation-driven svmRadialWeights model with the traditional model. Figure 14 Drug sensitivity analysis for low-risk and high-risk groups; Figure 15 To screen key genes for lactation in nasopharyngeal carcinoma, A shows the frequency ranking of the top 25 selected genes (top) and the difference in expression between the high-risk and low-risk groups (bottom); B shows the difference in expression of the CBX5 gene between nasopharyngeal carcinoma and control tissues (top) and the difference in expression between metastatic and non-metastatic nasopharyngeal carcinoma tissues (bottom); C shows the survival time analysis of the high and low expression groups of CBX5; D shows the survival probability analysis of the high and low expression groups of CBX5. Figure 16 The effects of CBX5 on the proliferation, invasion, and migration of nasopharyngeal carcinoma cells were investigated. A represents the effect of CBX5 on the proliferation of nasopharyngeal carcinoma cells; B represents the effect of CBX5 on the invasion of nasopharyngeal carcinoma cells, where NC is the control group and shCBX5 is the CBX5-silenced group; C shows that the number of invading cells / field of view in the CBX5-silenced group was significantly lower than that in the control group; D represents the effect of CBX5 on the migration of nasopharyngeal carcinoma cells; and E shows the migration area of ​​cells in the CBX5-silenced group (sh-CBX5) and the control group (NC) at 48 h and 96 h. Figure 17 To detect the expression of CBX5 in the silent group (sh-CBX5) and the control group (NC) by Western blotting, A is the protein immunoblot map; B is the quantitative statistical analysis graph of the corresponding bands. Figure 18 To illustrate the effect of CBX5 expression level on lactation level in nasopharyngeal carcinoma cells, A shows the association between CBX5 and lactation modification using co-immunoprecipitation (Co-IP) analysis; B shows the statistical analysis of CBX5 binding to lactation signal intensity. Figure 19 Transcriptome sequencing was used to reveal the genes and signaling pathways involved in CBX5 regulation of lactation in nasopharyngeal carcinoma. A shows the distribution of differentially expressed genes after CBX5 silencing; B shows the correlation between CBX5 expression levels and the expression levels of common lactation regulators; C shows the enrichment analysis of KEGG metabolic pathways for differentially expressed genes; D shows the correlation between KEGG-GSEA analysis of differentially expressed genes and ribosome activity; E shows the correlation between CBX5 expression levels and the expression levels of ribosomes and translation regulators; F shows the enrichment analysis of KEGG signaling pathways for differentially expressed genes; and G shows the CBX5 gene interaction analysis. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. In the following description, specific details such as specific configurations and components are provided merely to help fully understand the embodiments of this application. Therefore, those skilled in the art should understand that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of this application. In addition, for clarity and brevity, descriptions of known functions and structures are omitted in the embodiments.

[0025] It should be understood that the phrase "an embodiment" or "this embodiment" throughout the specification means that a specific feature, structure, or characteristic related to the embodiment is included in at least one embodiment of this application. Therefore, "an embodiment" or "this embodiment" appearing throughout the specification does not necessarily refer to the same embodiment. Furthermore, these specific features, structures, or characteristics can be combined in any suitable manner in one or more embodiments.

[0026] Furthermore, reference numerals and / or letters may be repeated in different examples within this application. Such repetition is for the purpose of simplification and clarity and does not in itself indicate a relationship between the various embodiments and / or settings discussed.

[0027] In this article, the term "and / or" is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, B exists alone, and A and B exist simultaneously. The term " / and" describes another type of relationship between related objects, indicating that two relationships can exist. For example, A / and B can mean: A exists alone, and A and B exist alone. In addition, the character " / " in this article generally indicates that the related objects before and after it have an "or" relationship.

[0028] In this article, the term "at least one" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, "at least one of A and B" can mean: A exists alone, A and B exist simultaneously, or B exists alone.

[0029] It should also be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion.

[0030] This application illustrates a complete research system from clinical prediction models and target discovery to mechanism analysis through the following embodiments. For the overall process of this application, please refer to [link to relevant documentation]. Figure 1 Example 1 introduces the construction and validation of a multi-algorithm integrated prognostic model based on lactation-related genes, while Examples 2-4 introduce the discovery, validation, and application of CBX5, a key gene for lactation in nasopharyngeal carcinoma. The following provides a detailed description of each example.

[0031] Example 1 This embodiment describes the construction and validation of a multi-algorithm integrated prognostic model based on lactation-related genes. Please refer to the appendix. Figure 2-14 .

[0032] The prognostic model construction and validation includes the following steps: Step S1: Data Acquisition and Preprocessing: Gene expression profiles and clinical follow-up data of 451 HNSCC patients were obtained from the TCGA database as the training set, and data from 88 NPC patients (GSE102349) and 97 OSCC patients (GSE41613) were obtained from the GEO database as the external validation set. All expression data were standardized and batch-corrected. 327 lactation-related genes were extracted from PubMed literature. In the HNSCC training set, univariate Cox regression analysis was used to screen 45 genes that were significantly associated with overall survival (such as PSMC1 and PCMT1 associated with increased risk, and LSP1 and CALML5 associated with decreased risk) for subsequent modeling.

[0033] Step S2, Multi-Algorithm Ensemble Model Construction: 117 prognostic models were constructed using 12 machine learning algorithms (including RSF, Enet, StepCox variants, CoxBoost, etc.). Performance was evaluated using C-index and 1-year / 3-year AUC, and the forward stepwise Cox regression combined with Ridge regression (StepCox[forward] + Ridge) was ultimately determined as the optimal model. This model had a C-index of 0.68 on the training set (TCGA), 0.68 on the NPC validation set (GSE102349), and 0.62 on the OSCC validation set (GSE41613). Time-dependent ROC analysis showed that the 1-year AUC was 0.706, 0.769, and 0.675 on TCGA, NPC, and OSCC, respectively, and the 3-year AUC was 0.759, 0.642, and 0.641, respectively, all outperforming published models.

[0034] Step S3, Risk Grouping and Survival Validation: Patients were divided into high-risk and low-risk groups based on the median risk score of the model. Kaplan-Meier analysis showed that in the TCGA (P<0.001) and OSCC (P = 0.011) cohorts, the high-risk group had significantly shorter overall survival; in the NPC cohort, the high-risk group also showed a trend of survival disadvantage, but this was not statistically significant.

[0035] Step S4, Correlation between Immune Microenvironment and Treatment Response: Analysis using various immune infiltration algorithms (such as quanTIseq, CIBERSORT, etc.) revealed that the low-risk group was enriched with activated myeloid dendritic cells and CD4+. + Central memory T cells and CD8 + T cells were abundant in the high-risk group, while regulatory T cells and cancer-associated fibroblasts were enriched. Among the immunotherapy response prediction models constructed based on lactation genes, the svmRadialWeights algorithm performed best on the validation set, with an AUC superior to traditional models, suggesting that this model can effectively predict immune checkpoint inhibitor responses.

[0036] Step S5: Drug sensitivity analysis: The IC50 values ​​of 198 drugs were predicted using OncoPredict software. Wilcoxon test was used to identify drugs with significant differences in sensitivity between the high-risk and low-risk groups (P<0.01). The low-risk group was more sensitive to most drugs (e.g., PF-07088071), while the high-risk group generally had lower sensitivity. Figure 5 This provides a reference for individualized treatment of high-risk patients.

[0037] Based on 45 lactation-related genes identified through univariate Cox regression analysis in the training cohort, this study constructed 117 prognostic prediction models using single or combined machine learning algorithms. After systematic evaluation, the forward stepwise Cox regression combined with Ridge regression (StepCox[forward] + Ridge) was determined to be the optimal model.

[0038] The technical effects achieved in this embodiment are as follows: This embodiment successfully constructed a prognostic prediction model based on lactation-related genes. Through a multi-algorithm ensemble strategy, this model demonstrated excellent predictive performance and cross-cancer generalization ability on both the head and neck squamous cell carcinoma training set and the independent validation sets for nasopharyngeal carcinoma and oral squamous cell carcinoma. The model not only achieved accurate risk stratification but also revealed significant differences in the immune microenvironment between high- and low-risk groups: the low-risk group was enriched with anti-tumor immune cells, while the high-risk group was dominated by immunosuppressive cells. Furthermore, the immunotherapy response prediction model developed based on this lactation characteristic exhibited excellent discriminative power, providing a novel biomarker for immunotherapy screening. Simultaneously, drug sensitivity analysis revealed differences in sensitivity to different chemotherapy and targeted drugs between groups, providing a comprehensive theoretical basis and potential practical guidance for individualized clinical treatment decisions.

[0039] Example 2 Based on Example 1, this example describes the identification and verification of CBX5, a key gene for lactation in nasopharyngeal carcinoma. Please refer to the appendix. Figure 15 .

[0040] This embodiment provides a method for identifying and validating the nasopharyngeal carcinoma prognostic biomarker CBX5, including the following steps: Step S1: Integrate eight feature selection algorithms (including RSF, Enet, Boruta, XGBoost, SVM-RFE, Lasso, CoxBoost, and StepCox) to cross-validate and comprehensively screen candidate genes in lactation-related prognostic models.

[0041] Step S2: By analyzing the frequency of occurrence, survival correlation, and expression differences of each gene in the nasopharyngeal carcinoma cohort, CBX5 was finally identified as a key regulatory factor.

[0042] Step S3: Use public databases (such as GEO and TNMplot) to verify the expression characteristics of CBX5 in nasopharyngeal carcinoma tissues, confirming that its expression is significantly upregulated in tumor tissues and further increased in metastatic tumors.

[0043] Step S4: Kaplan-Meier survival analysis demonstrated that patients with high CBX5 expression had shorter overall survival (log-rank P = 0.0036), thus confirming its clinical feasibility as a prognostic biomarker for nasopharyngeal carcinoma.

[0044] The results showed that CBX5 was persistently highly expressed in the high-risk group. Subsequent analysis focused on a nasopharyngeal carcinoma (NPC)-specific dataset. In the NPC cohort, the mRNA level of CBX5 in tumor tissues was significantly higher than that in adjacent non-tumor tissues (P<0.01); further stratification by metastatic status revealed that CBX5 expression in metastatic tumors was significantly higher than that in non-metastatic tumors (P<0.05). Patients were divided into high / low CBX5 expression groups based on the median expression value. The high expression group had a higher mortality rate, and Kaplan-Meier survival analysis further confirmed that high CBX5 expression was significantly associated with poorer overall survival (log-rank P = 0.0036).

[0045] The technical effects achieved in this embodiment are as follows: This embodiment uses multi-algorithm integrated screening to screen out CBX5 as a key prognostic-related gene for nasopharyngeal carcinoma, and uses public database data to verify that it is specifically highly expressed in nasopharyngeal carcinoma tissue and is significantly associated with poor prognosis, providing a new and reliable biomarker for prognostic assessment of nasopharyngeal carcinoma, which has important clinical diagnostic value.

[0046] Example 3 Based on Example 1, this example describes the construction of a nasopharyngeal carcinoma model with CBX5 gene silencing and the study of CBX5 function. Please refer to the appendix. Figure 16-18 .

[0047] Specifically, it includes the following: (1) Lentiviral vector construction and viral packaging: The basal expression level of the CBX5 gene in three nasopharyngeal carcinoma cell lines (5-F8, HK-1, and C666-1) was detected by qPCR, and the 5-F8 cell line with the highest expression level was selected for subsequent research. Based on the CBX5 mRNA sequence, we designed three treaty-specific shRNAs and one non-targeted control sequence, and cloned them into the pLVX-mCherry-Puro lentiviral vector. This vector carries both the mCherry fluorescent reporter gene (for monitoring viral infection efficiency) and the puromycin resistance gene (for screening positive cells). Subsequently, the packaging plasmid was co-transfected into 293T cells, and the viral supernatant was collected 48 hours after transfection. High-titer lentiviral particles were obtained by ultracentrifugation purification.

[0048] (2) Establishment of stable silencing cell lines: Lentiviral particles were introduced into target nasopharyngeal carcinoma cells using a polybrene-assisted infection method. After 72 hours of infection, mCherry fluorescence signals were observed using a fluorescence microscope to confirm the infection efficiency. Subsequently, resistance selection was performed for 6 consecutive days using puromycin-containing medium to obtain a stable transduced cell population. The knockdown efficiency of the three shRNAs on the CBX5 gene was verified at the mRNA and protein levels using real-time quantitative PCR (qPCR) and Western blotting (WB), respectively. Finally, the shRNA clone with the best silencing effect was selected for subsequent functional experiments. The target region for detection is GAGAAGTCAGAAAGTAACAAGAGGAAATCCAATTTCTCAAACAGTGCCGATGACATCAAATCTAAAAAAAAGAGAGAGCAGAGCAATGATATCGCTCGGGGCTTTGAGAGAGGACTGGAAC; the upstream primer used for real-time quantitative PCR is GAGAAGTCAGAAAGTAACAAGAGG; and the downstream primer used for real-time quantitative PCR is GTTCCAGTCCTCTCTCAAAGCC.

[0049] (3) Investigating the effect of CBX5 gene silencing on the proliferation, migration, and invasion of nasopharyngeal carcinoma cells: Using non-targeted shRNA (NC) as a control, the effect of CBX5 on the proliferation ability of nasopharyngeal carcinoma cells was detected by the CCK-8 assay. Transfected cells were seeded at a density of 3 × 10³ cells per well in 96-well plates and cultured for 72 hours. The medium was then replaced with complete medium containing 10% CCK-8 reagent. After incubation for another 30 minutes, the absorbance of each well was measured at 450 nm using a microplate reader to assess the differences in cell proliferation ability. Using non-targeted shRNA (NC) as a control, the effect of CBX5 on the migration ability of nasopharyngeal carcinoma cells was evaluated using a scratch healing assay. Cells were spaced at 5 × 10⁶ cells per well. 5 Cells were seeded at a density of approximately 90% and cultured until they reached about 90% confluence. Scratches were then created using a sterile pipette tip, and the medium was replaced with serum-free culture. The scratched areas were photographed and recorded at 48 and 96 hours post-scratching, and changes in cell void area were calculated to assess differences in cell migration ability. Using non-targeted shRNA (NC) as a control, the effect of CBX5 on the invasive ability of nasopharyngeal carcinoma cells was evaluated using a Transwell invasion assay. Matrigel was first coated onto the upper chamber of a 24-well Transwell chamber (8.0 μm pore size) and incubated at 37°C to solidify. 5 × 10⁵ cells were then injected. 4Cells were resuspended in serum-free medium and seeded into the upper chamber of a matrix gel, while serum-containing complete medium was added to the lower chamber. After culturing for 48 hours, the cells that had penetrated the membrane were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and the membrane bottom was imaged under a microscope. Invading cells were then counted to analyze the differences in cell invasion ability.

[0050] (4) Effect of CBX5 gene on lactation level of nasopharyngeal carcinoma cells: The effect of CBX5 on lactation level of nasopharyngeal carcinoma cells was detected by co-immunoprecipitation (Co-IP) combined with Western blotting (WB). The specific steps are as follows: Nasopharyngeal carcinoma cells were lysed on ice using IP lysis buffer, and the supernatant was collected after high-speed centrifugation. 500 μg of total protein sample was taken, and 5 μl of anti-CBX5 antibody was added and incubated overnight at 4°C. Subsequently, 40 μl of Protein A / G magnetic beads were added to adsorb the antigen-antibody complex, and after elution, the protein was denatured by heating in a boiling water bath. Finally, the lactation modification level (using pan-Kla antibody) and the expression level of CBX5 protein were detected by WB experiment, and the differences in their content were analyzed.

[0051] Experimental results showed that silencing the CBX5 gene led to a downregulation of cellular lactation levels; the CCK8 assay confirmed that silencing CBX5 inhibited the proliferation of nasopharyngeal carcinoma cells; the scratch healing assay showed that CBX5 silencing weakened cell migration ability; and the Transwell invasion assay confirmed that silencing CBX5 reduced the invasive ability of cancer cells.

[0052] Immunoprecipitation experiments showed that knockdown of CBX5 significantly reduced the overall lactation signal (P<0.05). Anti-CBX5 antibody effectively enriched CBX5 protein and co-precipitated pan-Kla signals, indicating an interaction between CBX5 protein and lactation modification. Notably, although CBX5 gene silencing led to a decrease in whole-cell lactation levels, the lactation modification signal specifically binding to CBX5 protein was significantly enhanced (P<0.05). This phenomenon suggests that CBX5 protein itself may act as a substrate for lactation modification, and changes in its expression level may indirectly affect the overall cellular lactation modification level by regulating the activity of lactylases or delactylases. In conclusion, CBX5, through its own lactation modification and its regulatory role in global lactation levels, jointly promotes the invasion and metastasis of nasopharyngeal carcinoma cells.

[0053] The technical effects achieved in this embodiment are as follows: By constructing a CBX5 gene silencing model, this embodiment systematically elucidates that CBX5 promotes the proliferation, migration, and invasion of nasopharyngeal carcinoma cells, and reveals the interaction between CBX5 and lactation modification. This provides a new theoretical basis for understanding the progression mechanism of nasopharyngeal carcinoma, and lays an experimental foundation for the development of targeted therapy strategies for nasopharyngeal carcinoma targeting CBX5 and its related lactation pathways.

[0054] Example 4 Based on Example 1, this example utilizes transcriptome sequencing to reveal the CBX5-regulated lactation genes and signaling pathways in nasopharyngeal carcinoma. Please refer to the appendix. Figure 19 .

[0055] To elucidate the molecular mechanism by which CBX5 regulates lactation, this study performed RNA-seq analysis on nasopharyngeal carcinoma cells in the CBX5-silenced (sh-CBX5) group and the negative control (NC) group.

[0056] Differential expression analysis showed that after CBX5 knockdown, the five most significantly upregulated genes were VIL1, LCP1, KRT13, TNS1, and ALPG; while the most significantly downregulated genes included DNAH2, PDE4B, CBX5, MEIOSIN, and SNRPN. Notably, the expression of five previously reported positive lactation regulators (EP300, G6PD, S100A4, STMN1, and TKT) was significantly increased after CBX5 silencing, suggesting that CBX5 may indirectly regulate lactation levels by inhibiting the expression of these pro-lactic acidification genes.

[0057] KEGG metabolic pathway enrichment analysis revealed that CBX5 deficiency significantly affected multiple key metabolic pathways, including choline metabolism, carbon metabolism, purine metabolism, glycerophospholipid metabolism, fatty acid metabolism, and glycolysis / gluconeogenesis. GSEA-KEGG analysis further showed that high CBX5 expression was positively correlated with ribosome pathways; and CBX5 silencing significantly altered ribosome-related signaling pathways. Consistent with these results, multiple ribosome and translation regulation-related factors (such as RPL14, RPL22, EIF4G1, and PABPN1) were upregulated after CBX5 knockdown, suggesting that CBX5 may indirectly limit the synthesis of lactation-related proteins by inhibiting ribosome activity, thereby regulating overall lactation levels.

[0058] Further KEGG pathway analysis revealed that CBX5 deficiency extensively perturbs key oncogenic signaling pathways such as PI3K-Akt, Rap1, Hippo, mTOR, and Wnt. Protein-protein interaction (PPI) network analysis positioned CBX5 as a highly interconnected regulatory hub: FGFR2 acts as a bridge connecting CBX5 and WNT11, which transmits signals downstream through TNS1 and MEOX1, ultimately affecting effector molecules such as TNNC1. This systematically reveals the core network role of CBX5 in regulating lactation and tumor progression.

[0059] The technical effects achieved in this embodiment are as follows: Through RNA-seq technology and bioinformatics analysis, the molecular network mechanism of CBX5 regulating lactation modification was systematically revealed. It was found that CBX5 constructs a multi-level regulatory network with CBX5 as the core node by inhibiting the expression of multiple positive lactation regulators, affecting ribosome function and protein synthesis, and regulating multiple metabolic pathways and oncogenic signaling pathways. This provides comprehensive molecular evidence for a deeper understanding of the role of CBX5 in the progression of nasopharyngeal carcinoma and lays a theoretical foundation for the development of therapeutic strategies targeting CBX5 and its related pathways.

[0060] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any equivalent substitutions, structural improvements, adjustments to the functional implementation methods, as well as reasonable adjustments to parameters, module integrations, or step sequences based on the concept of the present invention, made within the spirit and principles set forth in the present invention, should be included within the scope of protection of the present invention.

Claims

1. An inhibitor of the gene CBX5, characterized in that, The gene CBX5 inhibitor is shCBX5, and the shCBX5 is a short hairpin RNA targeting the gene CBX5.

2. The genetic ICAM1 inhibitor according to claim 1, characterized in that, The coding sequence of the shCBX5 is one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

3. The genetic ICAM1 inhibitor according to claim 1, wherein The preparation method of the gene ICAM1 inhibitor is: The nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 is connected to the lentiviral expression vector pLVX-mCherry-Puro.

4. The gene CBX5 inhibitor according to claims 1-3 is used in the preparation of a preparation for treating nasopharyngeal carcinoma.

Citation Information

Patent Citations

  • Application of Wushan icaritin in preparation of medicine for treating liver cancer diseases

    CN120267661A

  • Mutant targeting histone lactylation modification site and application of mutant in inhibition of nickel compound exposure induced lung cancer and gastric cancer

    CN120623305A

  • SE102349C1