Soluble urokinase receptor recombinant protein, monoclonal antibody and preparation method and application thereof

Abstract

The invention relates to a soluble urokinase receptor recombinant protein, a monoclonal antibody and a preparation method and application of the soluble urokinase receptor recombinant protein and the monoclonal antibody. The amino acid sequence of the recombinant protein is as shown in SEQ ID No.1, and the nucleotide sequence for coding the soluble urokinase receptor recombinant protein is as shown in SEQ ID No.2. The invention provides a soluble urokinase receptor recombinant protein, a targeted monoclonal antibody is further obtained by using the recombinant protein as an immunogen, and then a double-antibody sandwich immune ELISA detection method or kit applied to the soluble urokinase receptor recombinant protein is established by using the monoclonal antibody. The method has the advantages of high detection sensitivity (the detection limit is as low as 0.2 ng / mL), strong specificity (only obvious specificity to human sample values) and high recovery rate (the average recovery rate is between 80% and 120%), meets the market requirements, and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, and specifically relates to a soluble recombinant urokinase receptor protein, a monoclonal antibody, its preparation method, and its application. Background Technology

[0002] Urokinase-type plasminogen activator receptor (uPAR, CD87) is a 60 kDa, three-domain (DI, DII, DIII) receptor protein without a transmembrane domain. These three domains are linked by a linker region and anchored to the cell membrane via glycosylphosphatidylinositol (GPI). The uPAR protein is encoded by the PLAUR gene, located in the q1 region of chromosome 19, which consists of nine exons. Urokinase-type plasminogen activator receptor (uPAR) is expressed on the membranes of various cells, including immune cells (neutrophils, monocytes, activated T cells), endothelial cells, vascular smooth muscle cells, and podocytes. Soluble urokinase-type plasminogen activator receptor (suPAR) is produced through enzymatic cleavage of the glycosylphosphatidylinositol (GPI) anchor by proteases and phospholipases. suPAR exists in three isoforms depending on the cleavage site: full-length suPAR, DI, and DII-DIII. Full-length suPAR can bind to uPA and act as a clearance receptor for uPA, while other isoforms cannot. suPAR can also bind to the target of uPAR and regulate intracellular signaling.

[0003] Current problems with soluble urokinase receptor kits in clinical use include: insufficient sensitivity: existing antibodies have low affinity for the target antigen and cannot detect low concentration samples; poor specificity: antibodies cross-bind with homologous substances, leading to false positives; and stability issues: antibodies are easily affected by temperature and pH, resulting in short shelf life of the kit or large fluctuations in test results. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a soluble recombinant urokinase receptor protein, a monoclonal antibody, a method for preparing the same, and its application, so as to improve the detection sensitivity and specificity of the target antigen, reduce the cross-reactivity rate, and extend the stability of the kit.

[0005] A first aspect of the present invention provides a soluble recombinant urokinase receptor protein, the amino acid sequence of which is shown in SEQ ID No. 1. A nucleotide sequence encoding the soluble urokinase receptor recombinant protein is shown in SEQ ID No. 2.

[0006] A second aspect of this invention provides a method for preparing a soluble recombinant urokinase receptor protein, comprising the following steps: First, the gene encoding the recombinant protein is ligated into an expression vector to construct a recombinant plasmid; then, the recombinant plasmid is transformed into competent cells, induced to express, and purified to obtain the soluble urokinase receptor recombinant protein.

[0007] A third aspect of the present invention provides a monoclonal antibody that specifically reacts with the soluble urokinase receptor recombinant protein, the monoclonal antibody comprising uP23 and uP34; wherein the amino acid sequence of the heavy chain variable region of monoclonal antibody uP23 is shown in SEQ ID No. 3, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 5; the amino acid sequence of the heavy chain variable region of monoclonal antibody uP34 is shown in SEQ ID No. 7, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 9.

[0008] The nucleotide sequence of the heavy chain variable region of the monoclonal antibody uP23 is shown in SEQ ID No. 4, and the nucleotide sequence of the light chain variable region is shown in SEQ ID No. 6; the nucleotide sequence of the heavy chain variable region of the monoclonal antibody uP34 is shown in SEQ ID No. 8, and the nucleotide sequence of the light chain variable region is shown in SEQ ID No. 10.

[0009] The fourth aspect of this invention provides an ELISA detection method based on the monoclonal antibodies uP23 and uP34 described above.

[0010] A fifth aspect of the present invention provides a kit for detecting soluble urokinase receptors, the kit comprising the monoclonal antibodies uP23 and uP34.

[0011] Furthermore, the kit also includes detection buffer, washing buffer, substrate reaction solution, reaction termination solution, and sealing membrane.

[0012] The detection buffer, washing buffer, substrate reaction solution, and reaction termination solution are all conventional reagents in the art and are not further limited herein.

[0013] Beneficial effects This invention provides a soluble recombinant urokinase receptor protein, and further uses this recombinant protein as an immunogen to obtain a targeted monoclonal antibody. Then, using the monoclonal antibody, a double-antibody sandwich immunoassay ELISA method or kit for detecting the soluble recombinant urokinase receptor protein is established. This method exhibits high detection sensitivity (detection limit as low as 0.2 ng / mL), high specificity (significant specificity only for human samples), and high recovery rate (average recovery rate between 80% and 120%), meeting market demands and showing promising application prospects. Attached Figure Description

[0014] Figure 1This is a gel electrophoresis image of the soluble urokinase receptor gene PCR product from Example 1.

[0015] Figure 2 This is an electrophoresis image of the target protein sample obtained from the purification of the soluble urokinase receptor recombinant protein in Example 2.

[0016] Figure 3 This is a graph showing the binding curve of the monoclonal antibody corresponding to the recombinant soluble urokinase receptor protein in Example 4.

[0017] Figure 4 This is a standard curve of the ELISA detection kit for the soluble urokinase receptor recombinant protein in Example 5.

[0018] Figure 5 This is a sample analysis diagram of the ELISA detection kit using the soluble urokinase receptor recombinant protein in Example 10. Detailed Implementation

[0019] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0020] Example 1 This embodiment provides the construction of a eukaryotic expression plasmid for the human soluble urokinase receptor, as detailed below: Based on the nucleotide sequence of the human soluble urokinase receptor in the NCBI database and with the aid of biological software analysis, primers were designed flanking the gene sequence encoding the human soluble urokinase receptor at amino acid 23303, and the gene was amplified by PCR. The recombinant amino acid sequence is shown in SEQ ID No. 1, and the nucleotide sequence encoding the recombinant protein is shown in SEQ ID No. 2.

[0021] The primers are as follows: Forward primer; GCTGGCGTCCTCTAGAGCCCTGCGGTGCATGCAGTGTAAG; Reverse primer: GGTCGAGGTCGGGGGATCCTTAGCGGTACTGGACATCCAG.

[0022] The PCR reaction solution uses Platinum™ SuperFi II DNA polymerase, and the preparation method is as follows: The PCR conditions were: 95℃ pre-denaturation for 5 min, 95℃ for 10 s, 60℃ for 10 s, 72℃ for 30 s, 35 cycles, and 72℃ extension for 5 min.

[0023] After PCR, centrifuge briefly, then perform PCR product electrophoresis on a 1.5% agarose gel. The results are as follows. Figure 1 The PCR product and the vector (pTT5) digested with XbaI and BamHI were purified by gel extraction. Homologous recombination of the purified uPAR gene with the vector fragment was performed, and the recombinant product was transformed into competent cells (DH5α). The transformed product was plated on LB agar plates containing ampicillin and incubated at 37°C for 10 h. Single colonies were picked, amplified, and plasmids were extracted. The extracted plasmids were identified by PCR and sequencing to confirm their correctness.

[0024] Example 2 This embodiment provides the expression and purification of recombinant human soluble urokinase receptor protein, and the specific operations are as follows: (1) Transform 1 μL of the correct plasmid returned after sequencing into 10-20 μL of competent cells, add 5 mL of LB liquid medium containing the corresponding antibiotic, and incubate overnight at 220 rpm for 16 h. Extract plasmid from the cultured bacterial solution to obtain pure endotoxin-free plasmid.

[0025] (2) Transform the plasmid into 293F cells, culture for 6-7 days, and then purify the supernatant.

[0026] (3) The expressed His-Tag protein was purified using a nickel column in an AKTA instrument. The purified target protein sample was then identified by SDS-PAGE. The results are as follows: Figure 2 As shown: M represents the marker, 1 represents recombinant human soluble urokinase receptor protein, and a clear band appears in lane 2 at approximately 50 kDa, indicating that relatively pure recombinant human soluble urokinase receptor protein has been prepared and obtained. The protein was denatured and renatured by dialysis, concentrated, and then quantified using a protein quantification kit to adjust the protein concentration to 1 mg / mL for later use.

[0027] Example 3 This embodiment provides the preparation of a human soluble urokinase receptor monoclonal antibody based on the recombinant protein obtained in Example 2. The specific operation is as follows: The purified recombinant human soluble urokinase receptor protein expressed in Example 2 was mixed with an adjuvant in equal volume and emulsified. Two 8-week-old female Balb / c mice (100 μg / mouse) were immunized via footpad injection. Freund's complete adjuvant was used for the initial immunization, and Freund's incomplete adjuvant was used for subsequent booster immunizations. Each immunization was administered 2 weeks apart, for a total of 4 immunizations. Blood was collected from the tail of the mice on day 21 after the fourth immunization for potency testing.

[0028] Mice with the highest titer were selected and boosted with an intraperitoneal injection of 100 μg / mouse of unadjuvanted antigen. Three days later, the spleens of these mice were aseptically harvested for cell fusion. The cell fusion method was as follows: mice were euthanized, the spleens were removed, and a cell suspension was prepared by grinding. The spleen cell suspension from the immunized mice (1 × 10⁻⁶) was then used for cell fusion. 8 cells) and Sp2 / 0 myeloma cell suspension (2×10) 7 Mix the cells thoroughly and centrifuge at 400g / min for 10min. Discard the supernatant and gently shake the centrifuge tube to loosen the cells. In a 37℃ water bath, add 1mL of preheated fusion promoter PEG while stirring. Add preheated DMEM high glucose / HAT / 20% FBS culture medium, mix the cells with feeder cells (mouse thymocytes), and seed 200μL into each well of a 96-well plate. Incubate at 37℃ in a 5% CO2 cell culture incubator.

[0029] On day 7 of culture, the hybridoma cell supernatant was examined. Hybridoma cells with positive results were transferred to 24-well cell plates for further culture for 4 days. Strongly positive wells were retested and limited dilutions were performed three times. Finally, monoclonal hybridoma cells in good condition were selected, expanded cultured, and centrifuged to collect the cells for cDNA synthesis, which was used to obtain antibody sequences.

[0030] Example 4 This embodiment provides a screening method based on the monoclonal antibody prepared in Example 3. The specific operation is as follows: The purified monoclonal antibody was diluted to a concentration of 2 μg / mL with PBS (pH=7.2) and added to each well at 100 μL. Coating was performed overnight at 4°C. The next day, the coating solution was discarded, and the plate was washed once with washing buffer (PBST, PBS containing 0.05% Tween 20), patted dry, and blocked with 1% BSA at 120 μL / well. The plate was incubated at 37°C for 1 hour, the blocking solution was discarded, and the plate was patted dry. Recombinant human uPAR protein antigen was injected at concentrations of 20.000 ng / mL, 6.666 ng / mL, 2.222 ng / mL, 0.741 ng / mL, 0.247 ng / mL, 0.082 ng / mL, and 0.027 ng / mL at 100 µL per well. A blank well was also included. The plate was incubated for 1 hour, and the liquid was removed and the plate was patted dry on filter paper.

[0031] According to the manufacturer's instructions (ThermoFisher, catalog number: 21338), 50 μg of the antibody used for screening was biotin-labeled. The labeled antibody was cross-added to wells coated with different monoclonal antibodies, and incubated at a concentration of 20 ng / mL for 1 hour. After drying, the plate was washed three times with 200 μL of washing buffer (PBST, PBS containing 0.05% Tween 20). Goat anti-human secondary antibody (1:10000 concentration, Jackson, catalog number 200-032-211) was added and incubated for 30 minutes. After drying, the plate was washed four times with 200 μL of washing buffer (PBST, PBS containing 0.05% Tween 20). 50 μL of TMB chromogenic buffer was added per well, and the plate was incubated at room temperature for 5-10 minutes. Finally, 50 μL of 0.5 M sulfuric acid was added per well to terminate the reaction. The OD450 nm value was measured using a microplate reader.

[0032] Optimal reaction conditions were selected by adjusting the coating concentration and the ratio of the detection antibody. Monoclonal antibody pairs with the best protein binding, lowest well-to-sample density (0 wells), and relatively high sample values ​​were screened. Finally, monoclonal antibodies uP23 and uP34 were selected, and the results are as follows: Figure 3 As shown.

[0033] The amino acid sequence of the heavy chain variable region of the monoclonal antibody uP23 is shown in SEQ ID No. 3, and the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No. 4; the amino acid sequence of the light chain variable region is shown in SEQ ID No. 5, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID No. 6.

[0034] The amino acid sequence of the heavy chain variable region of the monoclonal antibody uP34 is shown in SEQ ID No. 7, the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID No. 8, the amino acid sequence of the light chain variable region is shown in SEQ ID No. 9, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID No. 10.

[0035] Example 5 This embodiment provides the preparation of an ELISA detection kit for recombinant human soluble urokinase receptor protein based on the monoclonal antibody screened in Example 4, as detailed below: Based on the screening results of Example 4, uP23 was used as the coating antibody. A concentration of 2 μg / mL was added to the microplate at 80 μL / well, and the plate was coated overnight at 4°C. The plate was washed twice with 250 μL / well of washing buffer (PBST, PBS containing 0.05% Tween-20), patted dry, and blocked with 1% casein at 250 μL / well. The plate was incubated at room temperature for 2 hours, the blocking solution was discarded, the plate was sealed, and stored at -20°C for later use.

[0036] Biotin-labeled uP34 antibody: After bringing all reagents and the antibody to room temperature (approximately 20-26°C), weigh biotin, dissolve and dilute it with ultrapure water to a final concentration of 10 mM. Mix the calculated corresponding mass of biotin with the antibody and incubate at room temperature for 30 minutes. After the reaction, dialyze with 1×PBS solution to obtain optimal performance and stability. Collect and aliquot the solution, and store at -20°C protected from light.

[0037] Recombinant human uPAR protein antigen was used as a calibrator at concentrations of 20.000 ng / mL, 6.666 ng / mL, 2.222 ng / mL, 0.741 ng / mL, 0.247 ng / mL, 0.082 ng / mL, 0.027 ng / mL, and 0.000 ng / mL. 50 μL of standard protein at each concentration was used for detection, with two parallel experiments performed for each concentration. Then, 50 μL of detection antibody was added to each well, and the mixture was incubated for 30 minutes. The liquid was discarded, and the wells were washed three times with 300 μL / well washing buffer. 100 μL of streptavidin (HRP) was added to each well, and the mixture was incubated for 15 minutes. The liquid was discarded, and the wells were washed three times with 300 μL / well washing buffer. Add 100 μL of chromogenic substrate TMB to each well and incubate at room temperature for 5–30 minutes. Add 100 μL of stop solution to each well. Within 30 minutes, measure the OD value of the microplate at a wavelength of 450 nm. The calibration wavelength is set to 570 nm or 630 nm. The results are shown in Table 1.

[0038] Table 1. Results of Parallel Testing of Standard Curves Create a standard curve, such as... Figure 4 As shown, the linearity is calculated to be 0.99 based on the four-parameter fitting results.

[0039] Example 6 This embodiment provides the ELISA kit system and conditions prepared in Example 5 for sample detection, as detailed below: To verify the repeatability of the kit's test results and determine intra-assay precision (including intra-assay and inter-assay precision), 22 replicates of each of the three known concentrations were prepared for intra-assay testing and 6 replicates for inter-assay testing. The actual concentrations were measured, and the mean (Mean) and standard deviation (SD) were calculated. Intra-assay CV% = (SD / Mean) × 100%. Results showed that the intra-assay CV% for all three concentrations was ≤10%. Specific test results are shown in Table 2.

[0040] Table 2 Intra-batch precision test results Example 7 This embodiment provides a dilution and recovery test of serum samples from healthy individuals based on the ELISA kit system and conditions prepared in Example 5, as detailed below: Three spiked samples were prepared using a 1:9 ratio of "healthy human serum + spiked stock solution" (to avoid excessively large spiking volumes affecting the matrix ratio), with an unspecified control of "unspecified healthy human serum". The results show that the recoveries of the kit at low, medium, and high concentrations were all within the range of 80%-120%, which is well within the market demand. Specific detection results are shown in Table 3.

[0041] Table 3 Recovery rate test results Example 8 This embodiment provides the specific binding ability test based on the ELISA kit system and conditions prepared in Example 5, as detailed below: Each cross-reactive antigen was diluted to 10 ng / mL with a negative matrix (consistent with the concentration of the suPAR positive reference standard), and two replicates were set for each sample. The results showed that the OD450 nm values ​​of the cross-reactive samples were all < 0.1, the OD450 nm value of the suPAR positive standard was > 0.5, and the negative control was < 0.1, indicating that the cross-reactivity was acceptable. Detailed test results are shown in Table 4.

[0042] Table 4 Specific detection results Example 9 This embodiment provides a stability test of the ELISA kit system and conditions prepared in Example 5, as detailed below: Serum samples were tested using expired products (based on their real-time performance throughout their entire lifecycle, including storage, transportation, and opening). Results showed performance indicators >80%, and real-time stability was satisfactory. Specific test results are shown in Table 5.

[0043] Table 5 Stability test results Example 10 This embodiment provides the ELISA kit system and conditions prepared in Example 5 for testing patient samples, as detailed below: The sample included serum samples from 10 healthy controls, 10 patients with kidney disease, and 10 patients with pancreatic cancer. GraphPadPrism 10 software was used for data statistics and analysis, as well as the creation of bar charts and ROC curves. Simple one-way ANOVA was used for multiple comparison statistical analysis. Statistical significance was set at p < 0.05. The results showed that, compared with healthy controls, serum suPAR was significantly elevated in patients with kidney disease and pancreatic cancer. Specific test results are shown in Table 6.

[0044] Table 6 Patient Sample Test Results Serum suPAR levels were significantly elevated in pancreatic cancer patients compared to those in kidney disease patients, and this difference was statistically significant (P<0.05). Analysis of the above test results shows that... Figure 5 As shown, the ROC area for serum suPAR in detecting kidney disease was 0.885, and the ROC area for detecting pancreatic cancer was 0.96, with cutoff values ​​of 3.175 ng / ml and 2.7 ng / ml, respectively. Due to the small sample size, the analysis results have certain limitations, and a larger sample size is needed to study the association between suPAR and disease.

Claims

1. A soluble recombinant urokinase receptor protein, characterized in that, The amino acid sequence of the recombinant protein is shown in SEQ ID No.

1.

2. The nucleotide sequence encoding the soluble urokinase receptor recombinant protein as described in claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID No.

2.

3. A method for preparing the soluble urokinase receptor recombinant protein as described in claim 1, characterized in that, Includes the following steps: First, the gene encoding the recombinant protein is ligated into an expression vector to construct a recombinant plasmid; then, the recombinant plasmid is transformed into competent cells, induced to express, and purified to obtain the soluble urokinase receptor recombinant protein.

4. A monoclonal antibody that specifically reacts with the soluble urokinase receptor recombinant protein of claim 1, characterized in that, The monoclonal antibodies include uP23 and uP34; wherein, the amino acid sequence of the heavy chain variable region of monoclonal antibody uP23 is shown in SEQ ID No. 3, and the amino acid sequence of the light chain variable region is shown in SEQ ID No. 5; the amino acid sequence of the heavy chain variable region of monoclonal antibody uP34 is shown in SEQ ID No. 7, and the amino acid sequence of the light chain variable region is shown in SEQ ID No.

9.

5. The monoclonal antibody according to claim 4, characterized in that, The nucleotide sequence of the heavy chain variable region of the monoclonal antibody uP23 is shown in SEQ ID No. 4, and the nucleotide sequence of the light chain variable region is shown in SEQ ID No.

6. The nucleotide sequence of the heavy chain variable region of the monoclonal antibody uP34 is shown in SEQ ID No. 8, and the nucleotide sequence of the light chain variable region is shown in SEQ ID No.

10.

6. An ELISA detection method based on the monoclonal antibodies uP23 and uP34 as described in claim 4.

7. A kit for detecting soluble urokinase receptors, characterized in that, The kit contains the monoclonal antibodies uP23 and uP34 as described in claim 4.

8. The reagent kit according to claim 7, characterized in that, The kit also includes detection buffer, washing buffer, substrate reaction solution, reaction termination solution, and sealing film.

Images