RIP3-mediated osteoarthritis animal model and construction method and application thereof

Abstract

The invention discloses an RIP3-mediated osteoarthritis animal model as well as a construction method and application thereof. The construction method comprises the following steps: delivering an effective dose of a genetic tool (such as an adenovirus vector) capable of expressing RIP3 protein into a knee joint subchondral bone area of an experimental animal, and realizing continuous overexpression of RIP3 through regular operation, so as to induce pathological characteristics highly similar to human osteoarthritis. The model stably shows typical OA phenotypes such as limb pain sensitization, subchondral bone loss and bone microstructure degeneration, osteoclast number increase and overlying cartilage degeneration. The invention reveals that the natural process of occurrence and development of the osteoarthritis can be directly simulated through specific overexpression of the RIP3 in the subchondral bone for the first time, and a brand-new and valuable tool is provided for researching the pathogenesis of the osteoarthritis and screening and evaluating medicines and therapies for treating the osteoarthritis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biomedical technology, and particularly relates to a gene engineering animal model construction technology. More particularly, the present application relates to a method for constructing an animal model with typical osteoarthritis (OA) pathogenesis characteristics by subchondral bone-specific overexpression of RIP3 gene, the animal model constructed thereby, and the application of the animal model in medical research. BACKGROUND

[0002] Osteoarthritis (OA) is the most common chronic and degenerative joint disease, and its main pathological feature is the progressive destruction of articular cartilage. The clinical manifestations include joint pain, dysfunction and even deformity, which seriously damage the patient's ability to work and self-care. In the pathological process of OA, the articular cartilage and the subchondral bone below it together form a dynamic functional unit. Recent studies have shown that the subchondral bone lesions occur earlier than the articular cartilage in the development of OA. The subchondral bone lesions then trigger cartilage degeneration through mechanical and biological interactions with the cartilage. The significant increase in the number and activity of osteoclasts is a key link in triggering abnormal remodeling of subchondral bone, increased angiogenesis and abnormal growth of sensory nerves, and thus leading to the degeneration of the overlying cartilage.

[0003] Receptor-interacting protein kinase 3 (RIP3) is a key regulator of programmed necrosis, and has been confirmed to be closely related to tissue damage and inflammatory response. Studies have shown that RIP3 not only participates in the development of OA by disrupting the metabolic homeostasis of chondrocytes, but also significantly up-regulates its expression in the subchondral bone of OA. On the contrary, knocking out the Rip3 gene can effectively delay cartilage degeneration in a trauma model and improve the structural damage of subchondral bone and pain symptoms, which suggests that RIP3 plays a core role in the mechanism of OA subchondral bone lesions.

[0004] In the basic research and drug development of OA, a reliable animal model is crucial. However, the existing models all have obvious limitations. Chemical induction models (such as intra-articular injection of sodium monoiodoacetate) are simple to operate, but the pathological process is quite different from the natural and chronic progression of human OA, and lacks the typical subchondral bone remodeling characteristics. Surgical induction models (such as anterior cruciate ligament transection) better simulate post-traumatic OA, but require high technical requirements and are highly invasive, making it difficult to simulate the spontaneous progression of non-traumatic OA. Spontaneous models (such as using old animals) are closer to the natural course of human OA, but they have the problems of long cycle, large individual differences, and high cost. Gene-modified models are suitable for exploring specific pathways, but they have high construction costs, high technical threshold, and questionable universality. There are also some methods for constructing OA models by injecting specific viruses into the joint cavity to induce cartilage degeneration, but these methods do not conform to the characteristics of early subchondral bone lesions in the real disease progression, and the phenotype and mechanism also differ.

[0005] It can be seen that there is still a lack of an animal model construction strategy in the prior art which can accurately target the key pathogenesis link of OA (such as abnormal remodeling of subchondral bone), is relatively simple to operate, has a moderate cycle, and can simulate the natural progression of OA. Therefore, there is an urgent need in the art to develop a new animal model to make up for the deficiencies of the prior art and to provide a better tool for the study of the pathogenesis of OA and the screening of therapeutic drugs. SUMMARY

[0006] The present application relates to a method for preparing an animal model with the characteristics of osteoarthritis. The core of the method is to introduce or overexpress RIP3 in bone marrow macrophages in the subchondral bone region of the knee joint of the experimental animal by injecting a reagent containing an effective dose of a RIP3 recombinant vector into the subchondral bone region of the knee joint of the experimental animal, thereby driving the metabolic reprogramming and osteoclast differentiation of bone marrow macrophages, leading to abnormal remodeling and structural damage of the subchondral bone, and thus inducing typical OA pathological characteristics including limb pain, abnormal remodeling of the subchondral bone, and degeneration of the overlying cartilage. The effective dose refers to the minimum dose that can successfully induce the OA phenotype described above. In a specific embodiment, the method further comprises an optional step of periodically repeating the injection operation, which aims to maintain a high level of expression of RIP3 in the subchondral bone region, thereby more reliably simulating the chronic progression of OA.

[0007] The present application also relates to specific tools used in the preparation method. The recombinant vector is preferably a viral vector, including but not limited to an adeno-associated viral vector, an adenoviral vector, or a lentiviral vector, which have been proven to be able to efficiently infect cells related to the skeletal system and achieve long-term stable expression of exogenous genes. In a more specific embodiment, the RIP3 overexpression adenoviral vector is constructed by cloning the gene encoding RIP3 into a viral vector, which contains CMV promoter, multiple cloning site, 3FLAG tag, SV40 polyA signal, and EGFP reporter gene elements. Preferably, the viral vector is GV314 vector.

[0008] The present application also relates to key operating parameters in the preparation method. In order to ensure the effectiveness of the model while considering the safety and controllability of the operation, the viral titer of the injection is optimized to be between 1×10 7 PFU and 1×10 8 PFU, the injection volume is 5-15 μL, preferably 8-12 μL, for example, 8 μL, 9 μL, 10 μL, 11 μL, or 12 μL; and the injection frequency is set to once a week. The combination of these parameters has been proven to be able to efficiently induce a stable and consistent OA phenotype.

[0009] The present application further relates to the animal model per se prepared by any of the above methods. The essential feature of this model is that it successfully mimics the core pathophysiological changes of human OA by specifically manipulating the expression level of RIP3 in the subchondral bone local marrow macrophages, providing a new tool for OA research that is more targeted and more mimetic than existing models. Preferably, the animal model is a mouse.

[0010] The present application also relates to a specific use of the RIP3 overexpression recombinant vector, namely in the preparation of a preparation for establishing an osteoarthritis animal model. The feature is that by injecting the preparation prepared from the vector into the knee joint subchondral bone of an experimental animal, an animal model exhibiting at least one OA characteristic can be established, which characteristics explicitly include: limb pain, subchondral bone bone loss, trabecular bone structure degradation, increased number of osteoclasts, and degeneration of overlying cartilage.

[0011] Finally, the present application relates to a method for verifying the animal model. The method confirms the OA phenotype of the model animal by a series of standardized tests, including but not limited to: quantitatively evaluating its behavioral pain response by hot plate test; analyzing its subchondral bone microstructure parameters such as bone volume fraction and trabecular pattern factor by Micro-CT scanning; and detecting the degree of cartilage degeneration and the number of osteoclasts by histopathological staining techniques.

[0012] Advantages The animal model construction method provided by the present application successfully induces a series of typical pathological phenotypes such as limb pain, subchondral bone abnormal remodeling, and overlying cartilage degeneration, which are highly similar to the natural progression of human osteoarthritis, through the innovative strategy of subchondral bone local overexpression of RIP3. Compared with traditional OA model construction methods such as chemical induction, surgical injury, aging model, and intra-articular injection of viruses to induce cartilage cell lesions, this method not only more accurately simulates the natural onset process of OA subchondral bone early abnormal remodeling and secondary cartilage lesions, but also has the significant advantages of small trauma, simple operation, short modeling period, and low cost, providing an extremely efficient and reliable platform for in-depth study of the pathogenesis of OA, especially the core role of subchondral bone abnormal remodeling in driving the progression of OA, and screening and evaluating potential therapeutic drugs. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 RIP3 immunofluorescence staining results of subchondral bone of OA mice modeled by DMM Figure 2 Local injection of mouse knee joint subchondral bone Figure 3 Hot plate test results of group 1-4 mice Figure 4Micro-CT results of mice in groups 1-4 Figure 5 Immunofluorescence staining of mice in groups 1-4 Figure 6 Histopathological staining results of knee joint tissues in groups 1-4 mice Figure 7 Carrier map Detailed Implementation Example 1: Detection of RIP3 expression changes in subchondral bone of osteoarthritis (OA) 1.1 Establishment of a mouse OA model Mice were anesthetized with sodium pentobarbital and disinfected with povidone-iodine. The knee joint of the hind limb was exposed, and the skin, subcutaneous tissue, and joint capsule were incised. The medial meniscus ligament was then severed, and the joint capsule and skin were sutured. Mice that underwent sham surgery (only the skin, subcutaneous tissue, and joint capsule were incised and sutured) during the same period served as controls.

[0014] 1.2 Histopathological evaluation Joint tissue samples were harvested at 1, 2, 3, and 4 weeks post-surgery. After fixation, decalcification, paraffin embedding, and sectioning, RIP3 and F4 / 80 immunofluorescence staining were performed to clarify the expression of RIP3 in mouse subchondral bone bone medullaris (BMMs) at different stages of osteoarthritis (OA). Results showed that RIP3 expression in mouse knee BMMs significantly increased with OA progression. Figure 1 ).

[0015] Example 2 Construction of the adenovirus vector Ad-RIP3 overexpression 2.1 Target gene and vector information In this embodiment, the target gene is the mouse-derived Ripk3 gene (gene name: Ripk3, species: Mouse), as shown in SEQ ID NO: 10. The viral vector used is GV314, with the element sequence CMV-MCS-3FLAG-SV40-EGFP, and cloning sites BamHI and AgeI; wherein CMV is SEQ ID NO: 6, the 3FLAG sequence is SEQ ID NO: 7, the SV40 sequence is SEQ ID NO: 8, the EGFP sequence is SEQ ID NO: 9, and MCS is the foreign gene insertion site. The PCR product used for cloning (i.e., the insert fragment) is shown in SEQ ID NO: 5, which contains BamHI and AgeI restriction sites and the complete Ripk3 coding sequence.

[0016] 2.2 Obtaining the target gene fragment The target gene fragment was obtained by PCR amplification. The PCR amplification primer sequences are as follows: Primer Ripk3(94155-1)-p1: AGGTCGACTCTAGAGGATCCCGCCACCATGTCTTCTGTCAAGTTATG (SEQ ID NO: 1) Primer Ripk3(94155-1)-p2: TCCTTGTAGTCCATACCCTTGTGGAAGGGCTGCCAGCCCCTAC (SEQ ID NO: 2) The PCR product size is 1502 bp.

[0017] 2.3 Construction of recombinant plasmids The PCR products were then transposed into the linearized expression vector GV314 to construct the recombinant plasmid. The construction diagram is shown below. Figure 7 Positive transformants were identified by PCR using the following primer sequences: Primer KL94155-p3: CCTTCAGAGGCACAACACCT (SEQ ID NO: 3); Primer KL94155-p4: CCTTATAGTCCTTATCATCGTC (SEQ ID NO: 4). The PCR product size of the positive transformant was 342 bp. Sequencing of the positive clones (SEQ ID NO: 5) confirmed that the sequence was consistent with the expected sequence, demonstrating the successful construction of the recombinant plasmid with the RIP3 gene sequence inserted via MCS.

[0018] 2.4 Cell transfection and expression detection Healthy 293T cells were cultured and cultured in 24-well plates one day before plasmid transfection. On the day of transfection, the recombinant plasmid was added for cell transfection. Twenty-four hours after transfection, GFP expression was observed under a fluorescence microscope. Forty-eight hours after transfection, once the cells had reached confluence with the culture plate, cells were collected and proteins were extracted. Ripk3 gene expression was detected by Western blotting. The viral titer was determined using the endpoint dilution method. This example provides a tool for subsequent animal model preparation.

[0019] Example 3: Ad-RIP3 injection procedure in the subchondral bone of the tibial plateau of the mouse knee joint. Male C57BL / 6 mice were randomly divided into 4 groups of 8 mice each. The specific grouping and treatment were as follows: Group 1 (low-dose blank control group): 1×10⁻⁶ mice were injected into the subchondral bone of the tibial plateau of the knee joint. 7 PFU control virus (dissolved in 10µL physiological saline); Group 2 (high-dose blank control group): injection of 1×10 8 PFU control virus (dissolved in 10µL physiological saline); Group 3 (low-dose overexpression group): injection of 1×10 7PFU Ad-Rip3 virus (dissolved in 10µL physiological saline); Group 4 (high-dose overexpression group): injection of 1×10 8 PFU Ad-Rip3 virus (dissolved in 10µL physiological saline). The control virus is an empty vector virus (virus without the RIP3 gene but identical to other elements).

[0020] Mice were anesthetized and fixed on the operating table, with the right knee joint fully exposed. Under aseptic conditions, the skin and joint capsule were longitudinally incised medially to the patellar ligament, and gently dissected to expose the tibial plateau. A small incision was made in the medial plateau area using a 1 mL syringe, and under a microscope, a microsyringe was used to inject the virus into the subchondral bone of the central region of the tibial plateau. The injection volume was 10 μL, the needle angle was approximately 45°, and the needle tip penetrated approximately 0.5 mm into the cortical bone. The needle tip was left in place for 1 minute after injection to prevent backflow. The joint cavity was then carefully irrigated, and the joint capsule and skin were sutured. Injections were administered weekly. Figure 2 Behavioral tests were conducted and samples were taken 28 days later, followed by pathological examinations. This successfully constructed an animal model simulating key pathological features of human osteoarthritis (OA).

[0021] Example 4 Pathological Examination This embodiment systematically validated the phenotypic characteristics of the animal model, fully reproducing the typical pathogenesis features of OA.

[0022] 4.1 Behavioral Testing The degree of hindlimb pain in mice was assessed using a hot plate test. The results showed that overexpression of RIP3 in subchondral bone dose-dependently exacerbated limb pain in mice. Figure 3 ).

[0023] 4.2 Micro-CT Detection Hind limbs of mice from each group were harvested and fixed. Micro-CT scans were performed to examine the subchondral bone microstructure, and the scan results were quantitatively analyzed. Morphological indices such as bone volume fraction (BV / TV) and trabecular bone pattern factor (Tb.Pf) were compared among the groups. Three-dimensional reconstruction of the scan results was performed using Mimics Research 21.0 software. The results showed that, compared to the control group, RIP3 overexpression led to subchondral bone loss, and BV / TV and Tb.Pf also showed the same trend. Figure 4 ).

[0024] 4.3 Histopathological examination Four weeks post-surgery, knee joint tissue was harvested, fixed, decalcified, paraffin-embedded, and sectioned. Safranin O / Fixed Green staining and COLII immunohistochemical staining were used to detect proteoglycan content and matrix degeneration in the cartilage tissue, and the degree of cartilage degeneration was scored according to the OARSI scoring system. TRAP staining was used to detect the number of osteoclasts generated in the subchondral bone. The remaining tissue was prepared into frozen sections and subjected to multiplex immunofluorescence staining with RIP3 and F4 / 80 to determine the overexpression effect of injected Ad-Rip3 in subchondral bone marrow macrophages. Figure 5 TRAP staining results showed that RIP3 overexpression increased the number of osteoclasts in the subchondral bone of mice. Safranin O / Fix Green staining and type II collagen immunohistochemistry results showed that local RIP3 overexpression in the subchondral bone also caused significant degeneration of the overlying cartilage, and this effect also showed a dose-dependent trend. Figure 6 ).

Claims

1. A method for preparing an animal model exhibiting the pathogenesis characteristics of osteoarthritis, characterized in that, The method includes the following steps: a) Provide laboratory animals; b) Inject an effective dose of the RIP3 recombinant vector reagent into the subchondral bone region of the knee joint of the experimental animal; Optionally, c) the injection procedure in step b) is repeated periodically to continuously overexpress the RIP3 gene in the subchondral bone, thereby inducing the pathological features of OA.

2. The preparation method according to claim 1, wherein the recombinant vector is a viral vector, preferably an adeno-associated virus vector (AAV), an adenovirus vector, or a lentivirus vector.

3. According to the preparation method of claim 2, the RIP3 overexpressing adenovirus vector is constructed by cloning the gene encoding RIP3 into a viral vector; preferably, the viral vector is a GV314 vector.

4. The preparation method according to any one of claims 1-3, characterized in that, The injected viral titer was 1×10⁻⁶. 7 PFU up to 1×10 8 PFU, with an injection volume of 5-15 μL, and the term "regular repetition" refers to injection once a week; preferably, the injection volume is 10 μL.

5. An animal model prepared by the method according to any one of claims 1-4; the animal model is preferably a mouse.

6. The application of a RIP3 overexpression recombinant vector in the preparation of a formulation for establishing an animal model of osteoarthritis (OA), characterized in that, The animal model was established by injecting the recombinant vector into the subchondral bone of the knee joint of experimental animals and exhibited at least one of the following OA characteristics: limb pain, subchondral bone loss, trabecular bone degeneration, increased osteoclast count, and degenerative changes in the overlying cartilage.

7. A method for verifying the animal model of claim 5, characterized in that, The method includes performing at least one of the following tests on the model animal: a) Detect their behavioral pain response using the hot plate test; b) Analyze the subchondral bone microstructure parameters using Micro-CT scanning; c) The degree of cartilage degeneration and the number of osteoclasts were detected by histopathological staining.

Images