Application of p65 phosphorylation inhibitor in preparation of medicine for treating or preventing inflammation

Abstract

The invention relates to the field of natural products, in particular to application of a p65 phosphorylation inhibitor in preparation of a medicine for treating or preventing inflammation. The p65 phosphorylation inhibitor is any one of sesquiterpene compounds I, II and III or a medicinal derivative thereof, and the structural formulas of the sesquiterpene compounds I, II and II are respectively shown as the formulas I, II and III. The invention has the following technical effects: the three sesquiterpenoids provided by the invention can be used as p65 phosphorylation inhibitors for inhibiting phosphorylation of P65 protein. The compound has a remarkable inhibition effect on synthesis and release of inflammatory factors TNF-alpha, IL-1alpha, IL-1beta and IL-6 in immune cells, and can be used as an anti-inflammatory drug for treating inflammatory diseases.

Description

Technical Field

[0001] This invention relates to the field of natural products, and more specifically to the use of a p65 phosphorylation inhibitor in the preparation of drugs for treating or preventing inflammation. Background Technology

[0002] Inflammation is the body's defensive response to injury (such as infection or trauma), typically manifested as redness, swelling, heat, pain, and functional impairment. In the acute phase, it is characterized by vasodilation, neutrophil infiltration, and the release of inflammatory mediators (such as histamine and prostaglandins), promoting pathogen clearance. Chronic inflammation is accompanied by lymphocyte and macrophage infiltration, which can lead to fibrosis (such as cirrhosis) or participate in tumor progression. Overreactions (such as cytokine storms) or long-term chronic inflammation can trigger organ damage and even systemic diseases (such as rheumatoid arthritis and atherosclerosis). Modern medicine regulates this process through anti-inflammatory drugs (NSAIDs, glucocorticoids) and targeted therapies (such as anti-TNF-α), developing anti-inflammatory drugs to inhibit inflammatory factors. Among these, TNF-α, IL-1α, IL-1β, IL-6, and IL-18 are important inflammatory targets.

[0003] *Cissampelopsis volubilis*, belonging to the genus *Cissampelopsis* and the family Compositae, is rich in flavonoids (such as luteolin), terpenes, and phenolic acids. It exhibits anti-inflammatory and antioxidant activities (mitigating oxidative damage by scavenging free radicals and inhibiting the NF-κB pathway), neuroprotective effects (regulating cholinesterase activity to improve cognitive function, with potential applications in Alzheimer's disease), and antibacterial and antiviral activities (showing inhibitory activity against Staphylococcus aureus and influenza virus). Its mechanism of action is related to regulating the RAS / ERK signaling pathway and enhancing immune responses, but further research is needed on its toxicological properties and clinical translational potential. Current development directions include standardized extraction processes and synergistic effects through nano-formulations to overcome bioavailability limitations.

[0004] Phosphorylation of the p65 protein (RelA) is a key "switch" for initiating and amplifying inflammatory responses. It controls a core step in the NF-κB pathway, one of the most important pro-inflammatory signaling pathways in the human body. Without p65 phosphorylation, many inflammatory genes cannot be effectively activated. The search for small molecule compounds that can specifically inhibit p65 phosphorylation aims to more precisely control excessive inflammatory responses while avoiding the side effects of widespread immunosuppression. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of a p65 phosphorylation inhibitor in the preparation of drugs for treating or preventing inflammation.

[0006] The technical solution of the present invention is as follows: This invention provides the use of a p65 phosphorylation inhibitor in the preparation of drugs for treating or preventing inflammation. The p65 phosphorylation inhibitor is any one of sesquiterpene compounds I, II, and III, or a pharmaceutical derivative thereof. The structural formulas of sesquiterpene compounds I, II, and III are shown in Formulas I, II, and III, respectively. .

[0007] Furthermore, the drug can inhibit the phosphorylation level of P65 protein and suppress the expression of inflammatory factors TNF-α, IL-1α, IL-1β and IL-6.

[0008] Furthermore, the pharmaceutical derivative may be a pharmaceutically acceptable salt, ester, or stereoisomer of the compound represented by Formula I, II, or III.

[0009] Furthermore, the medicament is made from a therapeutically effective amount of an active ingredient and pharmaceutically acceptable excipients, wherein the active ingredient is any one of the sesquiterpene compounds I, II, and III as described in claim 1, or a pharmaceutical derivative thereof.

[0010] Furthermore, in the aforementioned drug, the content of the active ingredient can be from 0.1% to 99.9% of the total drug mass.

[0011] Furthermore, the pharmaceutically acceptable excipients may include one or more of the following: diluents, lubricants, binders, disintegrants, solvents, solubilizers, preservatives, pH adjusters, isotonic agents, and stabilizers.

[0012] Furthermore, the formulation of the drug may be selected from tablets, capsules, granules, powders, oral liquids, injections, powder injections, lyophilized powder injections, emulsions, suspensions, ointments, creams, patches, suppositories, aerosols, powder inhalers, nanoparticles, liposomes, microspheres, or microcapsules.

[0013] The present invention has the following technical effects: The inventors have discovered for the first time that the three sesquiterpenoid compounds I, II, and III in this invention can all act as p65 phosphorylation inhibitors, used to inhibit the phosphorylation of P65 protein. As shown in Example 3, compound I at a concentration of 10 µM significantly inhibited the levels of P65 and P-P65; compound II at a concentration of 10 µM significantly inhibited the level of P-P65 without affecting the protein level of P65; and compound III at a concentration of 20 µM significantly inhibited the level of P-P65 without affecting the protein level of P65. Therefore, compounds I, II, and III all significantly inhibit the phosphorylation level of P65 protein.

[0014] The three sesquiterpenoid compounds provided by this invention significantly inhibit the synthesis and release of inflammatory cytokines TNF-α, IL-1α, IL-1β, and IL-6 in immune cells, and can be used as anti-inflammatory drugs for the treatment of inflammatory diseases. As shown in Example 4, compound I significantly inhibited LPS-induced inflammatory cytokine expression at concentrations of 10 µM and 20 µM, and reduced the levels of IL-6 and IL-1β secreted into the culture medium by LPS-induced THP-1 cells in a concentration gradient-dependent manner. This demonstrates that compound I possesses anti-inflammatory activity. Compound II significantly inhibited LPS-induced inflammatory cytokine expression at concentrations of 10 µM and 16 µM, and reduced the levels of IL-6 and IL-1β secreted into the culture medium by LPS-induced THP-1 cells in a concentration gradient-dependent manner. This demonstrates that compound II possesses anti-inflammatory activity. Compound III significantly inhibited LPS-induced inflammatory cytokine IL-6 expression at concentrations of 10 µM and 40 µM, and significantly inhibited LPS-induced inflammatory cytokine IL-1β expression at a concentration of 40 µM. This demonstrates that compound III possesses anti-inflammatory activity. Attached Figure Description

[0015] Figure 1 For compound I in CDCl3 1 H NMR spectrum (600 MHz).

[0016] Figure 2 For compound I in CDCl3 13 C10 NMR spectrum (150 MHz).

[0017] Figure 3 The HSQC spectrum (600 MHz) of compound I in CDCl3.

[0018] Figure 4 The HMBC spectrum (600 MHz) of compound I in CDCl3.

[0019] Figure 5 For compound I in CDCl3 1 H- 1 H COSY spectrum (600 MHz).

[0020] Figure 6 The ROESY spectrum of compound I in CDCl3 (600 MHz) is shown.

[0021] Figure 7 High-resolution electrospray ionization mass spectrometry (HRESIMS) for compound I.

[0022] Figure 8 This is the infrared spectrum of compound I.

[0023] Figure 9 This is the ultraviolet spectrum of compound I.

[0024] Figure 10 This is a circular dichroism chromatogram of compound I.

[0025] Figure 11 For compound II in CDCl3 1 H NMR spectrum (600 MHz).

[0026] Figure 12 For compound II in CDCl3 13 C10 NMR spectrum (150 MHz).

[0027] Figure 13 The HSQC spectrum (600 MHz) of compound II in CDCl3.

[0028] Figure 14 The HMBC spectrum (600 MHz) of compound II in CDCl3.

[0029] Figure 15 For compound II in CDCl3 1 H- 1 H COSY spectrum (600 MHz).

[0030] Figure 16 The ROESY spectrum of compound II in CDCl3 (600 MHz).

[0031] Figure 17 High-resolution electrospray ionization mass spectrometry (HRESIMS) for compound II.

[0032] Figure 18 This is the infrared spectrum of compound II.

[0033] Figure 19 This is the ultraviolet spectrum of compound II.

[0034] Figure 20 This is the circular dichroism chromatogram of compound II.

[0035] Figure 21 For compound III in CDCl3 1 H NMR spectrum (600 MHz).

[0036] Figure 22 For compound III in CDCl3 13 C10 NMR spectrum (150 MHz).

[0037] Figure 23The HSQC spectrum (600 MHz) of compound III in CDCl3.

[0038] Figure 24 The HMBC spectrum (600 MHz) of compound III in CDCl3.

[0039] Figure 25 For compound III in CDCl3 1 H- 1 H COSY spectrum (600 MHz).

[0040] Figure 26 The ROESY spectrum of compound III in CDCl3 (600 MHz).

[0041] Figure 27 High-resolution electrospray ionization mass spectrometry (HRESIMS) for compound III.

[0042] Figure 28 This is the infrared spectrum of compound III.

[0043] Figure 29 This is the ultraviolet spectrum of compound III.

[0044] Figure 30 This is a circular dichroism chromatogram of compound III.

[0045] Figure 31 To investigate the effects of sesquiterpenoid compounds I, II, and III on the phosphorylation (P-P65) levels of P65 and P65 protein, Western blotting was used to detect the changes in P65 and P65 protein phosphorylation (P-P65) levels after cell treatment with compounds I (10 µM), II (10 µM), and III (20 µM), with Vinculin protein used as an internal control.

[0046] Figure 32 The effects of compounds I (Figure A), II (Figure B), and III (Figure C) on THP-1 cell viability are shown. ns indicates no significant difference. The leftmost bar in the figure represents the control group without compounds I, II, and III.

[0047] Figure 33The figures show the effects of sesquiterpene compound I on the protein content of inflammatory factors secreted by immune cells THP-1. A represents the effect of compound I on the protein content of human interleukin-6 (IL-6) secreted by immune cells THP-1; B represents the effect of compound I on the protein content of human interleukin-1β (IL-1β) secreted by immune cells THP-1. (The vertical axis represents the protein content of inflammatory factors secreted by immune cells, and the horizontal axis represents the treatment conditions. ** represents p < 0.01, *** represents p < 0.001, and **** represents p < 0.0001). The leftmost bar in the figure represents the control group without compound I and LPS.

[0048] Figure 34 The figures show the effects of sesquiterpene compound II on the protein content of inflammatory factors secreted by immune cells THP-1. A shows the effect of compound II on the protein content of human interleukin-6 (IL-6) secreted by immune cells THP-1; B shows the effect of compound II on the protein content of human interleukin-1β (IL-1β) secreted by immune cells THP-1. (The vertical axis represents the protein content of inflammatory factors secreted by immune cells, and the horizontal axis represents the treatment conditions; *** represents p<0.001, **** represents p<0.0001). The leftmost bar in the figure represents the control group without compound II and LPS.

[0049] Figure 35 The figures show the effects of sesquiterpene compound III on the protein content of inflammatory factors secreted by immune cells THP-1. A represents the effect of compound III on the protein content of human interleukin-6 (IL-6) secreted by immune cells THP-1; B represents the effect of compound III on the protein content of human interleukin-1β (IL-1β) secreted by immune cells THP-1. (The vertical axis represents the protein content of inflammatory factors secreted by immune cells, the horizontal axis represents the treatment conditions, ns indicates no significant difference, ** represents p<0.01, *** represents p<0.001, **** represents p<0.0001). The leftmost bar in the figure represents the control group without compound III and LPS.

[0050] Figure 36 The effect of compound I of the present invention on the RNA content of inflammatory factors in immune cells and its half-maximal inhibitory concentration (IC50) 50Results calculation. A represents the effect of compound I on the RNA content of IL-6 in immune cells THP-1; B represents the effect of compound I on the RNA content of IL-1β in immune cells THP-1; C represents the effect of compound I on the RNA content of IL-1α in immune cells THP-1; D represents the effect of compound I on the RNA content of TNF-α in immune cells THP-1. (The vertical axis in the figure represents the RNA content of inflammatory factors in immune cells, the horizontal axis represents the treatment conditions, ns represents no significant difference, ** represents p<0.01, *** represents p<0.001, **** represents p<0.0001). The leftmost bar in the figure represents the control group without compound I and LPS.

[0051] Figure 37 The effect of compound II of this invention on the RNA content of inflammatory factors in immune cells and its half-maximal inhibitory concentration (IC50) 50 Results calculation. A represents the effect of compound II on the RNA content of IL-6 in immune cells THP-1; B represents the effect of compound II on the RNA content of IL-1β in immune cells THP-1; C represents the effect of compound II on the RNA content of IL-1α in immune cells THP-1. (The vertical axis in the figure represents the RNA content of inflammatory factors in immune cells, the horizontal axis represents the treatment conditions, ns represents no significant difference, ** represents p<0.01, *** represents p<0.001, **** represents p<0.0001). The leftmost bar in the figure represents the control group without compound II and LPS.

[0052] Figure 38 The effect of compound III of this invention on the RNA content of inflammatory factors in immune cells and its half-maximal inhibitory concentration (IC50) 50 Results calculation. A represents the effect of compound III on the RNA content of IL-6 in immune cells THP-1; B represents the effect of compound III on the RNA content of IL-1β in immune cells THP-1. (The vertical axis in the figure represents the RNA content of inflammatory factors in immune cells, the horizontal axis represents the treatment conditions, ns represents no significant difference, * represents p<0.05, ** represents p<0.01, *** represents p<0.001, **** represents p<0.0001). The leftmost bar in the figure represents the control group without compound III and LPS. Detailed Implementation

[0053] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.

[0054] The human immune cells described in the following experiments are human immune cells THP-1, which were obtained from Kunming Medical University.

[0055] Unless otherwise specified, all reagents used in the embodiments of this invention are commercially available. RPMI 1640 medium, LPS (lipopolysaccharide), and fetal bovine serum were purchased from Gibco. The ELISA kits used to detect immune factors in the cell culture medium were purchased from Shanghai Duma Biotechnology Co., Ltd., catalog numbers DM4670 (human interleukin-6 ELISA kit) and DM4708 (human interleukin-1β ELISA kit). The primers used in this experiment were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0056] The cell lines were cultured in RPMI 1640 medium containing 10% fetal bovine serum at 37°C, 5% CO2 and 90% humidity.

[0057] The antibodies used in this invention are listed in the table below: .

[0058] Example 1 This invention provides sesquiterpenoid compounds I, II, and III isolated and purified from *Chrysanthemum indicum*, the structural formulas of which are shown in Formulas I, II, and III, respectively: .

[0059] Compounds I-III were all extracted from *Chrysanthemum indicum*. The specific extraction processes for compounds I-II are as follows: The extraction and separation steps for compound I (formula I) are as follows: Step (1): Take chrysanthemum wisteria ( C. volubilis 30 kg of the aerial parts were pulverized and extracted three times by continuous reflux with methanol as the solvent, each time using 50 L of methanol for 4 h, 3 h, and 3 h respectively. The methanol extracts were combined and concentrated under reduced pressure to obtain 5.03 kg of extract. The extract was dispersed in water and extracted stepwise with ethyl acetate to obtain 1.41 kg of ethyl acetate extract. The ethyl acetate extract was subjected to silica gel column chromatography, with gradient elution using petroleum ether-ethyl acetate (100:0, 98:2, 95:5, 90:10, 80:20, 70:30, 50:50, v / v) as solvent, followed by gradient elution using dichloromethane-methanol (5:1, 7.8:2.2, 7.2:2.8, 6.7:3.3, 6.1:4.0, 5.6:4.4, 1:1, v / v) as solvent, to obtain 7 fractions (Fr. 1~Fr. 7).

[0060] Step (2): The Fr.3 fraction was separated by MCI gel column chromatography and eluted with a methanol-water gradient (methanol-water volume ratio successively 5:5→6:4→7.5:2.5→9:1→10:0) to obtain five subfractions, named Fr.3A–Fr.3E. The Fr.3D fraction was separated by C18 silica gel column chromatography and eluted with a methanol-water gradient (methanol-water volume ratio successively 6:4→7:3→7.5:2.5→8:2→9:1) to obtain five eluent fractions, named Fr.3D1–Fr.3D5.

[0061] Step (3) The Fr.3D3 fraction was subjected to silica gel column chromatography, eluted with petroleum ether-ethyl acetate, and then eluted with Sephadex LH-20 methanol gel column chromatography to obtain compound I. The volume ratio of petroleum ether-ethyl acetate was 10:1.

[0062] Extraction and separation of compound II: The Fr.3D4 fraction was subjected to silica gel column chromatography, eluted with petroleum ether-ethyl acetate, and then eluted with Sephadex LH-20 methanol gel column chromatography to obtain compound II. The volume ratio of petroleum ether-ethyl acetate was 10:1.

[0063] Extraction and separation of compound III: Fraction Fr. 3E was subjected to silica gel column chromatography with a gradient elution of petroleum ether-ethyl acetate (volume ratio 15:1 to 3:1) to obtain three fractions (Fr. 3E1 to Fr. 3E3). Fraction Fr. 3E1 was separated by methanol-eluting dextran gel chromatography (LH-20) to obtain compound III.

[0064] Table 1. Compounds I-II 1 H (600 MHz) nuclear magnetic resonance spectroscopy data ( δ , J Unit: Hz.

[0065]

[0066]

[0067]

[0068] Table 2. Compound III 1 H (600 MHz) nuclear magnetic resonance spectroscopy data ( δ , J Unit: Hz.

[0069]

[0070]

[0071] Table 3. Compounds I-III in CDCl3 13 C (150 MHz) nuclear magnetic resonance spectroscopy data ( δ Unit: ppm).

[0072]

[0073]

[0074]

[0075] Through Table 1-3 and Figure 1-30 The structural data of compounds I, II and III are as follows.

[0076] Compound I is a colorless gel-like substance;

[0077] UV (MeOH) λ max (log ε 216 (3.76) nm; ECD (MeOH) λ max (△ ε ) 195 (-12.5),240 (2.6) nm; IR (KBr) ν max 3424, 2957, 2931, 1721, 1648, 1456, 1382, 1232,1039, 846 cm -1 ; 1 H and 13 C NMR data are shown in Tables 1 and 2; HRESIMS m / z 571.3274 [M+Na] + C 31 H 48 The calculated value of O8Na is 571.3247.

[0078] Compound II is a colorless oily substance;

[0079] UV (MeOH) λ max (log ε ) 220 (2.92); CD (MeOH) λ max (△ ε ) 242 (-3.3), 278(0.9)nm; IR (KBr) ν max 3433, 2958, 2920, 1720, 1662, 1456, 1383, 1232, 1050,1042, 847 cm -1 ; 1 H and 13 C NMR data are shown in Tables 1 and 2; HRESIMS m / z 585.3043 [M+Na] + C 31 H 46 The calculated value of O9Na is 585.3040.

[0080] Compound I was determined to have the molecular formula C by hydrogen mass spectrometry (HRESIMS). 31 H 48 O8, mass spectrum shows [M + Na] + The peak at m / z 571.3274 (calculated value 571.3247) indicates that the compound has eight degrees of unsaturation. The infrared spectrum shows the hydroxyl group (3424 cm⁻¹). - ¹) and carbonyl (1721 cm) - The characteristic absorption peaks of ¹) are shown. ¹H and ¹³C NMR spectra reveal characteristic signals for eight methyl groups (δH 0.80, 0.87, 1.22, 1.64, 1.89×2, 1.99×2), five methylene groups (δH 1.23 / 1.52, 1.35 / 1.72, 1.55, 1.98, 4.16 / 4.32), twelve methyl subunits, and six quaternary carbons. The resonance peaks at δC 125.1 (C-5) and δC 133.3 (C-4) indicate that this compound is a trisubstituted alkene. The conclusion of the presence of a dimethyl substituent at C-11 is verified by a unique HMBC correlation: both methyl resonance peaks (δH 0.80 and 0.87, both singlets) cross peaks with the δC 26.7 (C-11) methyl subunit carbon peak at C-11. Additional cross-correlation between CH3-12 (δH 0.80, δC 15.3) and CH3-13 (δH 0.87, δC 21.5) further confirms this substitution pattern. COSY spectral analysis revealed multiple contiguous spin networks: H-3 / H-2 / H-1 / H-6 / H-5, H-6 / H-7 / H-11 / Me-12 / Me-13, and H-7 / H-8 / H-9. Cross-correlation between H-1 (δH 1.74) and H-6 (δH 2.28) indicates a direct bond between C-1 (δC 42.4) and C-6 (δC 34.1).

[0081] Compound I, after deacylation, hydrolyzes under acidic conditions to yield the d-glucose configuration. NMR signals show a methyl doublet (CH3-6′) and four oxymethylene carbons, confirming the presence of a glucose group. Two carboxyl groups (δC 167.5 × 2), one trisubstituted double bond (δC 127.0, 127.4, 138.9, 140.1), and four methyl groups (δH 1.89 × 2, 1.99 × 2) indicate the presence of two angeloyloxy groups. HMBC analysis shows cross-correlation between glucose H-1′ and C-10, confirming the presence of a glycosidic bond; additional correlations between glucose H-4′ and H-6′ and the carbonyl carbon indicate the presence of substituents at the C-4′ and C-6′ sites. In the NMR spectrum, the anterior proton at 4.55 (¹H, d, J = 7.8 Hz) correlates with δC 96.2 in the ¹H NMR spectrum (HSQC), indicating that the glucose units are linked by glycosidic bonds (β). Cross-peaks in the ¹H NMR spectra (H-7 / H-9α), (H-7 / Me-13), and (Me-14 / H-9α) support the α configuration of H-7 and Me-14, while the interaction between the ¹H NMR spectra (H-1 / H-6) and (H-6 / Me-12) defines the β configuration of H-1 and H-6. These findings establish the planar structure and stereochemical configuration of compound I.

[0082] Compound II was identified as C based on its structural data. 31 H 46 O9. Spectral comparison with compound I shows a similar carbon skeleton, but with an additional ketone carbonyl group. HMBC correlations from H-15 and H2-2 to C-3 (δC 199.1) confirm the ketone carbonyl group is located at C-3. In the NOESY spectrum, correlations between H-1 / H-6 and H-6 / Me-12 indicate a β orientation for H-1 and H-6, while the cross-peaks of H-7 / H-9α and H-7 / Me-14 define the α orientation of H-7 and Me-14. Good agreement between calculated and experimental ECD spectra confirms the absolute configuration of compound II as (1S, 6R, 7S, 10S).

[0083] The structural data of compound III are as follows: colorless oily substance. HR-ESI-MS analysis showed that [M+Na]+ (calc. for C) was performed at m / z 573.3312. 31 H 50 O8Na, 573.3403), combined 13 C1-NMR data confirmed that the molecular formula is C10. 31 H 50 O8 has an unsaturation degree of 7. 1 H-NMR and 13 [δ] in C-NMR H4.95(1H,t,J=9.2Hz, H-4′), 4.68 (1H,d,J=7.8Hz,H-1′), 4.36(1H,dd,J=12.0, 2.2Hz, H-6′a), 4.16 (1H,dd,J=12.0,6.8Hz, H-6′b), 3.76 (1H,m,H-3′), 3.78 (2H,m,H-5′), 3.46 (1H,d,J=8.8Hz,H-2′)] and [δ C [99.3, 74.9, 74.4, 72.1, 71.1, 63.0] confirms the existence of a pyranose unit, [δ H 6.16(1H,qd,J=7.2,1.6Hz,H-3″), 6.11 (1H,qd,J=7.2,1.6Hz,H-3″′), 2.00 (3H,td,J=7.2,1.8Hz,,H-4″), 1.99 (3H,td,J=7.2,1.8Hz,,H-4″′), 1.91 (3H,t,J=1.6Hz,H-5″), 1.89 (3H,t,J=1.6Hz,H-5″′)] and [δ C 167.4, 140.1,127.3,20.5,15.9; δ C [167.4,139.2,127.0,20.6,16.0] confirms the presence of two angelic acyl groups, [δ H 1.61 (1H,m,H-10), 0.95 (3H,d,J=6.8Hz,H-12), 0.91 (3H,d,J=6.8Hz,H-11)] and [δ C [33.6, 20.3, 19.6] confirms the existence of an isopropyl unit. 13 Thirty-one carbon signals were observed in C-NMR and HSQC, consisting of nine methyl groups, five methylene groups, eleven methine groups, and six quaternary carbons. Furthermore, five of the seven unsaturated groups—one pyranose ring and two oxyangelicyl groups—are present, indicating that this compound is a sesquiterpene III compound with the structure shown in Formula III. The planar structure of this compound was finally confirmed by two-dimensional NMR techniques (HSQC, HMBC, and 1H-1HCOSY). Its stereostructure was preliminarily identified by ROESY, confirming its absolute configuration.

[0084] Example 2: Effects of sesquiterpenoid compounds I, II, and III on P65 and P-P65 levels To evaluate the effects of compounds I, II, and III isolated in Example 1 on the phosphorylation (P-P65) levels of P65 and P65 protein, Western blotting was used to detect the effects of compounds I, II, and III on the levels of P65 and P-P65.

[0085] The Western blotting protocol was as follows: Cells were treated with compounds I, II, and III for 24 hours, with DMSO as the control. After cell culture under the experimental conditions, cells were collected after washing with cold phosphate-buffered saline (PBS). The cell pellet was dissolved in 2× protein sample buffer (1M Tris-HCl pH=6.8, 50% glycerol, 10% SDS, 2-mercaptoethanol, and 1% bromophenol blue) and boiled at 100°C for 10 min. The prepared protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to a PVDF (Millipore) membrane. The membrane was blocked in 5% skim milk solution for specific coupling between proteins and antibodies on the PVDF membrane. The skim milk solution was then discarded, and the membrane was washed with PBST (PBS with 0.5% Tween 20 added). The coupling reaction between proteins and antibodies on the membrane was incubated overnight at 4°C, followed by washing with PBST again. Finally, the horseradish peroxidase (HRP) conjugated secondary antibody (Cellsignaling Technology) was diluted in PBST and reacted at room temperature for 2 hours. The protein content on the membrane was then measured using Luminata Forte HRP substrate (Millipore).

[0086] Test results: such as Figure 31 As shown, compound I at a concentration of 10 µM significantly inhibited the levels of P65 and P-P65; compound II at a concentration of 10 µM significantly inhibited the level of P-P65 without affecting the protein level of P65; and compound III at a concentration of 20 µM significantly inhibited the level of P-P65 without affecting the protein level of P65. This indicates that compounds I, II, and III all significantly inhibited the phosphorylation level of P65 protein.

[0087] Example 3: Detection of cell proliferation of immune cells by sesquiterpenoid compounds I, II, and III To determine whether compounds I, II, and III isolated in Example 1 would cause cell damage and death, a CCK-8 assay kit was used to detect cell viability. The CCK-8 method was also used to assess cell growth inhibition. The CCK-8 assay, short for Cell Counting Kit-8, is a commonly used method for detecting cell proliferation and cytotoxicity. The principle of the CCK-8 assay is based on the fact that compound WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid phenyl)-2H-tetrazole monosodium salt), in the presence of the electron carrier 1-Methoxy PMS (menaquinone phosphate), can be reduced by intracellular mitochondrial dehydrogenases to generate a highly water-soluble orange-yellow formazan product. The amount of formazan generated is directly proportional to the number of viable cells, and the color intensity reflects cellular metabolic activity. The number of viable cells can be indirectly reflected by measuring the absorbance at 450 nm using a microplate reader. Therefore, CCK-8 can be used to assess cell proliferation, cytotoxicity, or the cellular effects of drugs.

[0088] The specific steps for CCK-8 testing are as follows: When performing CCK-8 testing, use 3×10 5 THP-1 cells were seeded in 90 µL of culture medium into five replicate wells of a 96-well plate. After 24 hours of culture, the cells were treated with different concentrations of compounds I, II, III, and LPS. After 48 hours of treatment, 10 µL of CCK-8 reagent was added to each well, and the 96-well plate was incubated at 37 °C for 1 hour. The absorbance was measured at 450 nm using a microplate reader. The average OD value of each well was calculated, and changes in cell proliferation or viability were analyzed by comparing it with the control group (without compounds I, II, III, and LPS). The percentage of the absorbance value of the experimental group relative to the absorbance value of the control group represents the cell viability or cell proliferation level; the control group was assumed to be 100%.

[0089] Test results: such as Figure 32 As shown, compounds I, II, and III (20 µM, 10 µM, 5 µM, and 2.5 µM) did not inhibit the viability of THP-1 cells. This indicates that compounds I, II, and III are well-tolerated and do not inhibit the growth of immune cells. ns represents no statistically significant difference.

[0090] Example 4: Effects of sesquiterpenoid compounds I, II, and III on extracellular inflammatory factors Compounds I, II, and III isolated in Example 1 were dissolved in DMSO (dimethyl sulfoxide) and then prepared into solutions with a concentration of 10-40 µM using DMSO; these solutions were used as test solutions. To detect the anti-inflammatory activity of compounds I, II, and III, their effects on the levels of IL-6 and IL-1β secreted by THP-1 immune cells were tested using an ELISA kit. The specific experimental procedure was as follows: THP-1 cells were treated with LPS for 24 h, and then treated with compounds I, II, and III for 12 h respectively. The cell suspensions were collected, centrifuged, the precipitate was discarded, and the supernatant was collected. The levels of IL-6 and IL-1β secreted by THP-1 cells were detected according to the ELISA kit instructions.

[0091] The test results are as follows: like Figure 33 As shown, compound I significantly inhibited LPS-induced expression of inflammatory factors at concentrations of 10 µM and 20 µM, and reduced the levels of IL-6 and IL-1β secreted into the culture medium by LPS-induced THP-1 cells in a concentration gradient-dependent manner. This demonstrates that compound I possesses anti-inflammatory activity.

[0092] like Figure 34 As shown, compound II significantly inhibited LPS-induced expression of inflammatory factors at concentrations of 10 µM and 16 µM, and reduced the levels of IL-6 and IL-1β secreted into the culture medium by LPS-induced THP-1 cells in a concentration gradient-dependent manner. This demonstrates that compound II possesses anti-inflammatory activity.

[0093] like Figure 35 As shown, compound III significantly inhibited the expression of LPS-induced inflammatory cytokine IL-6 at concentrations of 10 µM and 40 µM, and significantly inhibited the expression of LPS-induced inflammatory cytokine IL-1β at a concentration of 40 µM. This demonstrates that compound III possesses anti-inflammatory activity.

[0094] Example 5: IC50 of sesquiterpenoid compounds I, II, and III on the inhibition of inflammatory factor expression 50 calculate To further detect the IC50 of the anti-inflammatory activity of compounds I, II, and III isolated in Example 1, 50 The following experiment was conducted: After treating THP-1 immune cells with lipopolysaccharide (LPS) for 24 h, the THP-1 cells were transformed into inflammatory cells that released inflammatory factors. Compound I was added and treated for 12 h. RNA was extracted and then RT-qPCR was performed to detect the levels of 18S, TNF-α, IL-1β, IL-1α, and IL-6. 18S was used as an internal control for statistical analysis.

[0095] The RT-qPCR primer sequences are as follows: TNF-α: Forward: SEQ ID NO.1 5'-CCTCTCTCTAATCAGCCCTCTG-3', Reverse: SEQ ID NO.2 5'-GAGGACCTGGGAGTAGATGAG-3'; IL-1α: Forward: SEQ ID NO.3 5'-AGATGCCTGAGATACCCAAAACC-3', Reverse: SEQ ID NO.4 5'-CCAAGCACACCCAGTAGTCT-3'; IL-6: Forward: SEQ ID NO.5 5'-TAGTCCTTCCTACCCCAATTTCC -3', Reverse: SEQ ID NO.6 5'-TTGGTCCTTAGCCACTCCTTC-3'; IL-1β: Forward: SEQ ID NO.7 5'- TGGACCTTCCAGGATGAGGACA -3', Reverse: SEQ ID NO.8 5'- GTTCATCTCGGAGCCTGTAGTG -3'; 18S: Forward: SEQ ID NO.9 5'- CCTGAGAAACGGCTACCACATC -3', Reverse: SEQ ID NO.10 5'- GCCTCGAAAGAGTCCTGTATTG -3'.

[0096] Experimental results: such as Figure 36 As shown in Figure A, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-6. Compound I significantly reduced the LPS-induced mRNA content of the inflammatory cytokine IL-6 and inhibited the IC50 of IL-6. 50 It is 1.34 µM. For example... Figure 36 As shown in Figure B, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-1β. Compound I significantly reduced the LPS-induced mRNA content of the inflammatory cytokine IL-1β and inhibited the IC50 of IL-1β. 50 It is 5.02 µM. For example... Figure 36As shown in Figure C, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-1α. Compound I significantly reduced the LPS-induced mRNA content of the inflammatory cytokine IL-1α and inhibited the IC50 of IL-1α. 50 It is 3.56 µM. For example... Figure 36 As shown in Figure D, LPS treatment of THP-1 cells induced an increase in the mRNA expression level of the inflammatory cytokine TNF-α. Compound I significantly reduced the LPS-induced mRNA content of the inflammatory cytokine TNF-α, and compound I inhibited the IC50 of TNF-α. 50 It is 6.01 µM.

[0097] Experimental results: such as Figure 37 As shown in Figure A, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-6. Compound II significantly reduced the LPS-induced mRNA level of the inflammatory cytokine IL-6 and inhibited the IC50 of IL-6. 50 It is 7.95µM. For example... Figure 37 As shown in Figure B, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-1β. Compound II significantly reduced the LPS-induced mRNA content of the inflammatory cytokine IL-1β, and compound II inhibited the IC50 of IL-1β. 50 It is 12.49 µM. For example... Figure 37 As shown in Figure C, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-1α. Compound II significantly reduced the LPS-induced mRNA content of the inflammatory cytokine IL-1α and inhibited the IC50 of IL-1α. 50 It is 12.3 µM.

[0098] Experimental results: such as Figure 38 As shown in Figure A, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-6. Compound III significantly reduced the LPS-induced mRNA level of the inflammatory cytokine IL-6 and inhibited the IC50 of IL-6. 50 It is 11.64 µM. For example... Figure 38 As shown in Figure B, treatment of THP-1 cells with lipopolysaccharide (LPS) induced an increase in the mRNA expression level of the inflammatory cytokine IL-1β. Compound III significantly reduced the LPS-induced mRNA content of the inflammatory cytokine IL-1β, and compound III inhibited the IC50 of IL-1β. 50 It is 6.46 µM.

[0099] In summary, compounds I, II, and III isolated in Example 1 significantly reduced the expression levels of LPS-induced inflammatory factors TNF-α, IL-1α, IL-1β, and IL-6 without affecting immune cell survival, demonstrating that compounds I, II, and III can inhibit the expression of inflammatory factors and have strong anti-inflammatory effects.

[0100] In summary, compounds I, II, and III isolated in Example 1 have anti-inflammatory effects and can effectively inhibit the expression and release of inflammatory factors TNF-α, IL-1α, IL-1β, and IL-6.

[0101] It should be noted that the embodiments described above are only for explaining the present invention and do not constitute any limitation on the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to the present invention within the scope of the claims, and revisions can be made to the present invention without departing from the scope and spirit of the present invention. Although the present invention described herein relates to specific methods, materials, and embodiments, it does not mean that the present invention is limited to the specific examples disclosed herein; on the contrary, the present invention extends to all other methods and applications having the same function.

Claims

1. The use of a p65 phosphorylation inhibitor in the preparation of drugs for treating or preventing inflammation, characterized in that, The p65 phosphorylation inhibitor is any one of sesquiterpene compounds I, II, and III or their pharmaceutical derivatives, and the structural formulas of sesquiterpene compounds I, II, and III are shown in Formulas I, II, and III, respectively: 。 2. The application according to claim 1, characterized in that, The drug inhibits the phosphorylation level of P65 protein and suppresses the expression of inflammatory factors TNF-α, IL-1α, IL-1β and IL-6.

3. The application according to claim 1, characterized in that, The pharmaceutical derivative is a pharmaceutically acceptable salt, ester, or stereoisomer of a compound represented by Formula I, II, or III.

4. The application according to claim 1, characterized in that, The drug is made from a therapeutically effective amount of an active ingredient and pharmaceutically acceptable excipients, wherein the active ingredient is any one of sesquiterpene compounds I, II, and III as described in claim 1, or a pharmaceutical derivative thereof.

5. The application according to claim 4, characterized in that, In the aforementioned drug, the content of the active ingredient is from 0.1% to 99.9% of the total drug mass.

6. The application according to claim 4, characterized in that, Pharmaceutically acceptable excipients include one or more of the following: diluents, lubricants, binders, disintegrants, solvents, solubilizers, preservatives, pH adjusters, isotonic agents, and stabilizers.

7. The application according to claim 4, characterized in that, The formulation of the drug is selected from tablets, capsules, granules, powders, oral liquids, injections, powder injections, lyophilized powder injections, emulsions, suspensions, ointments, creams, patches, suppositories, aerosols, powder inhalers, nanoparticles, liposomes, microspheres, or microcapsules.

Images