A pathogenic gene and protein of verticillium dahliae and application thereof

Abstract

This invention discloses a pathogenic gene, protein, and application of *Verticillium dahliae*. This invention relates to the field of biotechnology and provides a method for controlling *Verticillium dahliae* wilt based on RNAi (RNA interference), along with its related components and applications. Specifically, it discloses the method of inhibiting or silencing the pathogenic gene of *Verticillium dahliae*. VdHAT1 The application of the expression method (whose encoded protein is shown in SEQ ID NO:3) for the prevention and control of Verticillium wilt relies on providing a class of dsRNA molecules that can target this gene, with the positive strand preferably selected from SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:7. Based on this molecule, this invention further provides recombinant vectors containing its coding sequence, recombinant microorganisms, transgenic disease-resistant plants, and RNAi pesticide formulations. These methods can be achieved through host-induced gene silencing, microorganism-mediated gene silencing, or formulation treatment, effectively reducing the virulence of the pathogen and providing a new technical approach for the green control of Verticillium wilt.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of the pathogenic gene of Verticillium dahliae in the prevention and control of Verticillium wilt, and particularly to a method for achieving green control of Verticillium wilt by inhibiting or silencing the expression of this pathogenic gene through RNAi (RAN interference) technology. Background Technology

[0002] Verticillium dahliae ( Verticillium dahliae This fungus belongs to the genus *Verticillium* of the subphylum Deuteromycetes. It can grow in the range of 10–30℃, with an optimum temperature of 20–25℃. It has a very wide host range; foreign reports indicate it can damage 660 species of plants from 40 families, including 184 agricultural crops. Its host plants include at least 80 species from 20 families, such as cotton, sunflower, eggplant, pepper, tomato, tobacco, potato, melon, watermelon, cucumber, peanut, kidney bean, mung bean, soybean, sesame, and sugar beet.

[0003] Verticillium wilt, a soil-borne fungal disease caused by Verticillium dahliae, is known as "cotton cancer." This disease is characterized by its wide distribution, severe damage, long pathogen survival time, and difficulty in control with chemical pesticides. It is one of the most devastating diseases affecting cotton growth, seriously threatening cotton production and development.

[0004] However, how to utilize the association between the pathogenic genes of *Verticillium dahliae* and Verticillium wilt in cotton to screen for gene target fragments and develop new control methods remains an urgent problem to be solved. Furthermore, how to improve plant resistance to *Verticillium dahliae* and enhance plant defense capabilities is also a current research focus. Exploring the application of *Verticillium dahliae* pathogenic genes in the control of Verticillium wilt will provide new ideas and methods for cotton production. Summary of the Invention

[0005] To address the shortcomings of existing technologies in controlling cotton Verticillium wilt, including poor efficacy, environmental pollution and drug resistance from chemical methods, lack of biological control methods, and inadequate research on the function of the pathogenic gene of *Verticillium dahliae* and its targeted inhibition technology, this invention proposes a method for inhibiting or silencing the pathogenic gene of *Verticillium dahliae* based on RNAi (RNA interference). VdHAT1 The method of expression was proposed and applied to the control of Verticillium wilt, in order to reduce the virulence of pathogens, reduce the occurrence and disease index, and provide an environmentally friendly biological control strategy.

[0006] One aspect of the present invention provides a pathogenic protein from *Verticillium dahliae*. Based on its amino acid sequence homology analysis, this protein is named VdHAT1 (Histone acetyl transferase HAT1, Genesymbol: VDAG_06353), which originates from *Verticillium dahliae* (…). Verticillium dahliaeThe amino acid sequence of this protein has been associated with Verticillium dahliae strain VdLs.17 (). Verticillium dahliae The genome sequence of *VdLs.17* has been publicly published and has been reported in research literature using comparative genomics to analyze pathogenicity-related genes in *Verticillium* (Klosterman SJ, Subbarao KV, Kang S, et al. Comparative Genomics Yields Insights into Niche Adaptation of Plant Vascular Wilt Pathogens[J]. PlosPathogens, 2011, 7(7):e1002137.). Although this literature focuses on the pathogenicity of *Verticillium*, it does not mention the gene encoding this protein, nor does it discuss its association with the pathogenicity of the pathogen, nor does it develop it as a molecular target for the control of cotton Verticillium wilt. This invention, through experimental verification, confirms that the... VdHAT1 The gene plays a key role in the pathogenesis of cotton Verticillium wilt, and the protein is shown in either 1) or 2) below:

[0007] 1) Proteins with amino acid sequences as shown in SEQ ID NO:3

[0008] 2) Variant proteins that have ≥85% sequence identity with the amino acid sequence of 1) and retain pathogenic function.

[0009] In another aspect, the present invention provides a *Verticillium dahliae* pathogenic gene encoding the aforementioned pathogenic protein. VdHAT1 (Gene), which encodes the aforementioned pathogenic protein and plays a role in causing Verticillium wilt in cotton, and is any one of the genes or nucleic acid molecules described in 1) to 5) below:

[0010] 1) The nucleotide sequence is as shown in SEQ ID NO:1 or SEQ ID NO:2;

[0011] 2) A polynucleotide encoding the amino acid sequence shown in SEQ ID NO:3;

[0012] 3) Variants of the polynucleotide described in 2) that have ≥85% sequence identity and retain pathogenic function;

[0013] 4) Polynucleotides that hybridize with complementary sequences of (2) or (3) under strict hybridization conditions;

[0014] 5) RNA molecules transcribed from (2), (3) or (4).

[0015] The “strict conditions” are conditions sufficient to hybridize the nucleotide sequence with the gene sequence described above. These conditions are well known to those skilled in the art, for example: hybridization at 65°C in 0.1×SSPE or 0.1×SSC solution containing 0.1% SDS, followed by washing the membrane with the solution.

[0016] The core aspect of this invention provides a novel solution for controlling Verticillium wilt: a method that uses RNAi (RNA interference) to inhibit or silence the pathogenic gene of Verticillium dahliae. VdHAT1 The expression method is applied in the prevention and control of Verticillium wilt, wherein the pathogenic gene is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:3, and the RNAi is mediated by a dsRNA (double-stranded RNA) molecule targeting the gene and can reduce the virulence of Verticillium dahliae.

[0017] Preferably, the inhibition or silencing is achieved through host-induced gene silencing, microbial-mediated gene silencing, or RNAi pesticide treatment.

[0018] In another aspect, the present invention provides a dsRNA molecule for the prevention and control of Verticillium wilt, said dsRNA molecule being capable of targeting the pathogenic gene. VdHAT1 The expression of the gene is suppressed or silenced, and the nucleotide sequence of the positive strand of the dsRNA molecule is selected from SEQ ID NO:4 to SEQ ID NO:9; preferably, the nucleotide sequence of the positive strand of the dsRNA molecule is selected from SEQ ID NO:4, SEQ ID NO:6 or SEQ ID NO:7.

[0019] In another aspect, the present invention provides a recombinant vector, characterized in that it comprises a DNA sequence capable of expressing the aforementioned dsRNA molecule. The vector may be a microbial expression vector or a plant expression vector. This recombinant vector can be used through genetic transformation technology to express the targeted... VdHAT1 The DNA sequence of the dsRNA molecule is introduced into microorganisms or plants, enabling them to express the target RNA. VdHAT1 The dsRNA molecules reduce the pathogenicity of Verticillium dahliae.

[0020] In another aspect, the present invention provides a recombinant microorganism, characterized in that it comprises the above-described recombinant vector.

[0021] In another aspect, the present invention provides a recombinant agricultural engineered bacterium, characterized in that the genome of the engineered bacterium contains a DNA sequence capable of expressing the above-mentioned dsRNA molecule, and the engineered bacterium may be *Trichoderma harzianum* (…). Trichoderma harzianum This engineered bacterium can continuously secrete targeted substances during its growth process. VdHAT1The dsRNA molecule of the gene or the siRNA molecule produced by the dsRNA molecule can effectively reduce the pathogenicity of Verticillium dahliae when they co-grow with Verticillium dahliae, thus playing a role in preventing and controlling Verticillium wilt.

[0022] Another aspect of the present invention provides a method for cultivating plants resistant to Verticillium wilt, characterized by comprising introducing the aforementioned recombinant vector into plants or plant cells, thereby causing the plants or plant cells to express the targeted vector. VdHAT1 The dsRNA molecule of the gene. The plant is, for example, cotton, solanaceous crops, or cruciferous crops. When Verticillium dahliae infects, the dsRNA molecules expressed in the plant can specifically inhibit or silence the pathogen's target gene, thereby enhancing the plant's resistance to Verticillium wilt.

[0023] In another aspect, the present invention provides a plant resistant to Verticillium wilt, characterized in that the plant has undergone genetic transformation to contain the target expressed in the plant or plant cells. VdHAT1 The DNA sequence of the dsRNA molecule of the gene; preferably, the plant is cotton.

[0024] In another aspect, the present invention provides an RNAi pesticide formulation, characterized in that it comprises an agriculturally acceptable carrier and the dsRNA molecule for controlling Verticillium wilt, and / or siRNA molecules generated from the dsRNA molecule.

[0025] The beneficial effects of this invention are: it elucidates the pathogenic gene for the first time. VdHAT1 The study investigated the crucial role of the gene and its encoded protein in the infection of cotton by *Verticillium dahliae*, confirming the effectiveness of this gene as a target for Verticillium wilt control at the molecular level. Experiments showed that knocking out... VdHAT1 The gene significantly reduced the pathogenicity of Verticillium dahliae, and the disease index and severity of cotton plants also decreased substantially, providing a theoretical basis for targeted control. Secondly, through systematic design and high-throughput screening, genes targeting [the pathogen] were obtained. VdHAT1 Highly efficient dsRNA molecules for genes (such as dsVdHAT1-1 / 3 / 4). Validated through various technical pathways including host-induced gene silencing (HIGS), microbial-mediated gene silencing (MIGS), and RNAi pesticide formulation treatment, these molecules demonstrated stable control effects against Verticillium wilt in different systems.

[0026] This invention integrates gene target discovery, RNA interference molecular design, and multi-pathway delivery system validation to form a targeted and highly efficient Verticillium wilt control strategy. This approach overcomes the limitations of traditional control methods, providing a novel technological approach for the green control of cotton Verticillium wilt and sustainable agricultural development, and has significant application prospects and ecological implications. Attached Figure Description

[0027] Figure 1 PCR verification of VdΔ hat1 Knockout mutants.

[0028] Figure 2 Wild-type V592 and knockout mutant VdΔ hat1 Pathogenicity testing.

[0029] Figure 3 Targeted VdHAT1 A schematic diagram of dsRNA design for a gene.

[0030] Figure 4 PCR validation of engineered Trichoderma harzianum strains.

[0031] Figure 5 Inhibitory effect of engineered Trichoderma harzianum on V592.

[0032] Figure 6 Disease incidence in cotton co-inoculated with engineered Trichoderma harzianum and V592.

[0033] Figure 7 target genes VdHAT1 Expression levels in V592-infected transgenic hairy roots.

[0034] Figure 8 The control effect of RNAi pesticide formulations on cotton. Detailed Implementation

[0035] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0036] In this application, the words “comprising,” “including,” or variations thereof should be understood to include other elements, numbers, or steps in addition to those described.

[0037] Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino-to-carboxyl orientation. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the terms “encoding” or “encoded” when used in the context of a particular nucleic acid mean that the nucleic acid contains the essential information to guide the translation of the nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of a particular protein. The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue,” “amino acid residue,” or “amino acid” are used interchangeably herein to refer to amino acids incorporated into proteins, polypeptides, or peptides (collectively, “proteins”). Amino acids can be naturally occurring amino acids and, unless otherwise limited, may include known analogs of natural amino acids that can function in a similar manner to naturally occurring amino acids.

[0038] Unless otherwise specified, all figures representing amounts of components, reaction conditions, etc., used in this specification and claims should be understood to be modified by the term "about" in all cases. As used herein, the term "about," when referring to a measurable value such as mass, weight, time, volume, concentration, or percentage, means to cover variations of ±20% from a specified amount in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, because such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, peptides, etc. Therefore, unless indicated to the contrary, the numerical parameters listed in this specification and appended claims are approximate values ​​that may vary depending on the desired characteristics sought to be obtained through the subject matter disclosed in this application.

[0039] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J, Russell D W. *Molecular Cloning: A Laboratory Manual* [M]. 3rd ed. *Cold Spring Harbor* (NY): Cold Spring Harbor Laboratory Press, 2001), or according to the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well known to those skilled in the art.

[0040] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0041] Verticillium dahliae V592 in the following examples (Feng-Gao, Bang-Jun Zhou, Guo-Ying Li, et al. A Glutamic Acid-Rich Protein Identified in Verticillium dahlia (from an Insertional Mutagenesis Affects Microsclerotial Formation and Pathogenicity. PLoS ONE, 2010, 5(12): e15319.) The biological material is available to the public from the Institute of Microbiology, Chinese Academy of Sciences for twenty years from the date of application. It is intended for the purpose of repeating the relevant experiments of this invention and may not be used for any other purpose.

[0042] In the following examples, "wild type" refers to an organism that does not contain heterologous nucleic acid molecules, and is a non-transformed or non-GMO organism. Specific Implementation

[0043] Example 1 Construction of Verticillium dahliae knockout vector

[0044] 1. Knockout vector construction

[0045] (1) The vector backbone PGKO-HPT was digested with PacI enzyme.

[0046] Reaction system (50 μL): 5 μg PGKO-HPT vector, 5 μL 10 x Fast Digest Buffer, 5 μL FastDigest PacI, and ddH2O to a final volume of 50 μL. Incubate at 37°C for 15 min, then inactivate at 65°C for 10 min.

[0047] (2) Amplification of homologous arms

[0048] Using V592 DNA as a template, amplify the homologous arm sequence:

[0049] 5' homologous arm amplification:

[0050] KO-HAT1-5F:ttcgagctcgctgagggtttaattaaatattcgaacctcttcgttg

[0051] KO-HAT1-5R:gatgggcccgctgaggacttaattaagacgaatcgaggaagaaagc

[0052] 3' homologous arm amplification:

[0053] KO-HAT1-3F:ccgactagtgctgaggcattaattaagtgatgtctggcatggc

[0054] KO-HAT1-3R:acgaagcttgctgaggtcttaattaagtgacgctttcggca

[0055] (3) Homologous recombination linkage

[0056] Reaction system (10 μL): 2.5 μL PGKO PacI digest, 20 ng 5' homologous arm, 20 ng 3' homologous arm, 2 μL 5xCE MultiS Buffer, 1 μL Exnase MultiS, and ddH2O to a final volume of 10 μL. Incubate at 37℃ for 30 min.

[0057] (4) Transformation of competent Escherichia coli cells

[0058] Take out one competent cell and add it to the above 10 μL reaction system. Place it on ice for 30 min, heat shock at 42℃ for 90 s, then add LB without antibiotic, activate at 37℃ for 50 min, and then spread it on LB+Kan plate.

[0059] (5) Identification of positive clones

[0060] Select a single clone, identify it as positive by PCR with specific primers, and then send it for sequencing. If the alignment is successful, the vector is named: pPGKO-hat1.

[0061] 2. Genetic transformation of Agrobacterium tumefaciens

[0062] (1) Electroporation transformation of Agrobacterium

[0063] The successfully constructed knockout vector pPGKO-hat1 was transformed into Agrobacterium EHA105 competent cells via electroporation. The cells were cultured at 28°C on solid LB medium supplemented with kanamycin (Kan, 50 μg / mL) and rifampin (Rif, 50 μg / mL). The cells were washed three times with liquid IM medium containing acetylsyringone AS (200 μM) and finally adjusted to an OD600 of approximately 0.25.

[0064] (2) Preparation of Verticillium dahliae spore liquid

[0065] Wild-type V592 spores grown on solid PDA medium were washed with liquid IM medium containing AS to a concentration of approximately 1.0 × 10⁻⁶. 7 cfu / mL.

[0066] (3) Mix well

[0067] Mix the Agrobacterium tumefaciens solution in (1) and the Verticillium dahliae spore solution in (2) in a 1:1 ratio, spread them evenly on solid IM medium containing AS and covered with cellophane, and incubate at 26°C for 2 days.

[0068] (4) Cultivation

[0069] Wash the mycelium growing on the cellophane with ddH2O, spread it on PDA medium containing hygromycin (50 μg / mL) resistance, and incubate for 3-5 days.

[0070] (5) Isolation of single spores

[0071] The newly grown single colony is picked up with a toothpick and scraped onto a hygromycin-resistant PDA plate. This single colony is the transformed strain, denoted as VdΔ. hat1 .

[0072] 3. Verification of transformant molecules

[0073] Use specific primers for PCR to verify whether site-specific knockout has occurred.

[0074] 5' end identification primer:

[0075] KO-HAT1 iden-F: tggaggatcgttggagcc

[0076] HPT seq-R: tgctcaccgcctggac

[0077] Gene identification primers:

[0078] KO-HAT1 gene-F: atggccgaggagggtg

[0079] KO-HAT1 gene-R: ctaggcatcctccacacg

[0080] 3' end identification primer:

[0081] HPT seq-F: gtgctcaacggcctcaac

[0082] KO-HAT1 gene-R: agcagagtgcacctttgct

[0083] Primers were used at the 5' (upstream) end, the upper end of the gene sequence, and the 3' (downstream) end of the gene sequence to target V592 and the knockout mutant VdΔ, respectively. hat1 Perform PCR testing.

[0084] Electrophoresis results are as follows Figure 1 The knockout strain VdΔ hat1 Successfully built.

[0085] Example 2: Pathogenicity Verification of Knockout Mutants

[0086] (1) Disinfection and sowing

[0087] Cotton seeds were sown in small pots of nutrient soil (5 seeds per pot), and then cultured in the dark for 5 days before being cultured in the light.

[0088] (2) Preparation of Verticillium dahliae spore liquid

[0089] V592 and VdΔ hat1 The strain was cultured on solid PDA medium for about 3 days, then incubated on liquid Czapek's medium with shaking for 3 days. The bacterial culture was collected and adjusted with distilled water to a spore concentration of approximately 1.0 × 10⁻⁶. 8 cfu / mL.

[0090] (3) Vaccination

[0091] When the cotton plants in (1) have grown to 4 true leaves, pour the bacterial solution from (2) into the soil culture box in (1), about 50 mL of bacterial solution per pot. Inoculate 2 pots of cotton plants with each bacterial strain, and repeat 3 times.

[0092] (4) Results statistics and analysis

[0093] After the cotton has grown for 15-20 days, the data will be collected and photographed.

[0094] Pathogenicity was statistically analyzed based on the degree of disease on each cotton leaf, and was divided into 5 levels: Level 0: no disease; Level 1: ≤25% of leaves were diseased; Level 2: 25~50% of leaves were diseased; Level 3: 50~75% of leaves were diseased; Level 4: ≥75% of leaves were diseased.

[0095] The results are as follows Figure 2 The knockout mutant VdΔ hat1 Compared to wild-type V592 infected cotton, the incidence rate, disease index, and disease severity grade of the gene were significantly lower, indicating that this gene is directly related to the pathogenicity of Verticillium dahliae.

[0096] Example 3: Initial screening of the inhibitory effect of dsRNA on target genes

[0097] 1. Design of dsRNA molecules

[0098] by VdHAT1 Using the CDS sequence (SEQ ID NO:2) as a template, it was divided into 6 segments (see diagram). Figure 3 dsRNA molecules were designed using each DNA segment as a template. The six dsRNA molecules obtained were named dsVdHAT1-1 to dsVdHAT1-6, and their positive strand RNA sequences correspond to SEQ ID NO:4 to SEQ ID NO:9, with lengths ranging from 203 to 275 nt.

[0099] 2. Construction of engineered Trichoderma harzianum

[0100] Construct the corresponding fungal dsRNA transformation vector based on the designed dsRNA molecular sequence.

[0101] A dsRNA fragment containing a stem-loop structure (sense (dsVdHAT1-n)-loop-antisense (dsVdHAT1-n)) was inserted into the pNeo-Olic vector via homologous recombination to obtain the pNeo-Olic-dsVdHAT1i-n construct. The negative control vector, containing a dsRNA sequence targeting GFP, was constructed using the same method to obtain pNeo-Olic-dsGFPi. The recombinant vector was transformed into *E. coli* DH5α competent cells, and single colonies were picked for PCR identification and enzyme digestion verification. Positive clones were sequenced to confirm the correct insertion direction and absence of sequence mutations.

[0102] The recombinant vectors pNeo-Olic-dsGFPi and pNeo-Olic-dsVdHAT1i-n were transformed into Agrobacterium EHA105 competent cells. Positive clones were selected and cultured in LB+Kan+Rif medium at 28°C until OD600. 600 =0.6~0.8, after centrifugation and collection of bacteria, resuspend in IM+As medium. Take a suspension of wild-type Trichoderma harzianum spores (1×10⁻⁶). 6 The cfu / mL solution was mixed with Agrobacterium tumefaciens in a 1:1 volume ratio and spread onto solid IM medium lined with cellophane. The mixture was then co-cultured at 26°C for 3 days.

[0103] After co-culturing, the bacteria were transferred to PDA selection medium containing G418 (40 μg / mL) and cultured at 26°C for 3–5 days. Resistant single colonies were selected and passaged three times consecutively. Genomic DNA of the resistant strains was extracted, and dsRNA expression cassette-specific fragments were amplified by PCR to verify whether the expression cassette was expressed in *Trichoderma harzianum*. Positive strains were named Th-dsGFPi, Th-dsVdHAT1i-1 to Th-dsVdHAT1i-6, respectively.

[0104] The results are as follows Figure 4 The results showed that strains Th-dsGFPi, Th-dsVdHAT1i-1 to Th-dsVdHAT1i-6 could be detected by PCR for dsRNA expression cassette-specific fragments, indicating that the dsRNA expression cassette transformation was successful.

[0105] 3. In vitro plate antibacterial test

[0106] Strains Th-dsGFPi, Th-dsVdHAT1i-1 to Th-dsVdHAT1i-6 were cultured on Czapek's medium for 3 days. After adjusting the concentration to be consistent, they were mixed with PDA liquid medium and poured into plates. Strains V592 were used to take mycelial cakes and inverted onto PDA mixed with Trichoderma harzianum. The plates were cultured at 26°C for 3 days. The growth of V592 colonies was observed. Each treatment was repeated 9 times.

[0107] The results are shown in Table 1 and Figure 5 As shown, compared with the control strain mixed with Th-dsGFPi, the growth of V592 colonies on the plate mixed with Th-dsVdHAT1i strain was slower than that of the control strain mixed with Th-dsGFPi strain, indicating that the Th-dsVdHAT1i strain transfected with dsRNA can inhibit the growth of V592.

[0108] Table 1. Inhibitory effects of different dsRNA segments on V592

[0109] strain V592 Diameter Range (mm) V592 diameter (mm) Inhibition rate (%) Significance Th-dsGFPi 11.84~12.86 12.29 - a Th-dsVdHAT1i-1 9.27~10.47 9.92 19.31 c Th-dsVdHAT1i-2 10.84~12.25 11.60 5.65 ab Th-dsVdHAT1i-3 9.47~11.42 10.09 17.90 c Th-dsVdHAT1i-4 9.81~11.94 11.06 10.02 b Th-dsVdHAT1i-5 10.56~12.78 11.96 2.71 a Th-dsVdHAT1i-6 10.81~12.53 11.74 4.48 ab

[0110] One-way ANOVA (LSD)P The results (<0.05) showed that Th-dsVdHAT1i-1, Th-dsVdHAT1i-3, and Th-dsVdHAT1i-4 all exhibited significantly stronger inhibitory effects on V592 than the control Th-dsGFPi. Among them, Th-dsVdHAT1i-1 showed the best inhibitory effect, with an inhibition rate of 19.31%; Th-dsVdHAT1i-3 showed the weakest inhibitory effect, with an inhibition rate of 17.90%, while Th-dsVdHAT1i-4 still achieved an inhibition rate of 10.02%.

[0111] Therefore, through initial screening, dsVdHAT1-1 / 3 / 4 was preliminarily identified as a candidate dsRNA molecule for further experiments.

[0112] Example 4 Validation of Agricultural Engineered Microorganisms

[0113] Based on the initial screening results, Th-dsVdHAT1i-1, Th-dsVdHAT1i-3, and Th-dsVdHAT1i-4 were selected as test strains for soil-based root irrigation efficacy testing.

[0114] (1) Disinfection and sowing

[0115] Sow cotton seeds in small pots of nutrient soil (5 seeds per pot), and after 5 days of dark cultivation, they can be cultivated under light.

[0116] (2) Preparation of Verticillium dahliae spore liquid

[0117] V592 and Harz engineered strains transformed with different dsRNAs were cultured on solid PDA medium for about 3 days, followed by shaking culture on liquid Czapek's medium for 3 days. The bacterial culture was collected and adjusted to a spore concentration of approximately 1.0 × 10⁻⁶ spores with distilled water. 8 cfu / mL.

[0118] (3) Vaccination

[0119] When the cotton plants in (1) have grown to 4 true leaves, pour the bacterial solution (V592 and Trichoderma harzianum transformed with dsRNA in equal proportions) from (2) into the soil culture box in (1), about 50 mL of bacterial solution per pot. Inoculate 2 pots of cotton plants with each bacterial strain, and repeat 3 times.

[0120] (4) Results statistics and analysis

[0121] After the cotton has grown for 15-20 days, the data will be collected and photographed.

[0122] Pathogenicity was statistically analyzed based on the degree of disease on each cotton leaf, and was divided into 5 levels: Level 0: no disease; Level 1: ≤25% of leaves were diseased; Level 2: 25~50% of leaves were diseased; Level 3: 50~75% of leaves were diseased; Level 4: ≥75% of leaves were diseased.

[0123] The results are as follows Figure 6 The results showed that, compared with the control Th-dsGFPi strain, the Th-dsVdHAT1i strain could inhibit the pathogenicity of V592 to cotton. Among them, Th-dsVdHAT1i-3 had the best effect, while Th-dsVdHAT1i-1 and 4 had weaker effects, but all of them showed obvious resistance to Verticillium wilt compared with the negative control.

[0124] Example 5: Hairy Root System Verification of HIGS Inhibition of Pathogenic Gene Expression

[0125] The hairy root system utilizes Agrobacterium rhizogenes (… Agrobacterium rhizogenes Agrobacterium-mediated genetic transformation technology induces the production of hairy roots by infecting explants (such as cotyledons and hypocotyls) with Agrobacterium. Traditional genetic transformation methods suffer from problems such as genotype limitations, long transformation cycles, and cumbersome operations, while the hairy root system overcomes these drawbacks. This genetic transformation method has been successfully applied in a variety of plants, including the herbaceous plants rubber grass and crown vetch, the tuberous plant sweet potato, and the woody plants ailanthus and Aralia elata. Currently, a large number of studies have used the hair follicle root transfer system for cotton genetic transformation, including for rapid screening of gene function and verification of the activity of the CRISPR / Cas system (Cao X, Xie H, Song M, et al. Cut-dip-budding delivery system enables genetic modifications inplants without tissue culture[J]. Innovation, 2022, 25;4(1):100345; Zhou Guantong, Lei Jianfeng, Dai Peihong, et al. Study on efficient screening system of effective sgRNA for cotton CRISPR / Cas9 gene editing[J]. Acta Agronomica Sinica, 2021,47(03):427-437.).

[0126] The Ruby reporter system is a reporter system built on the betaine synthesis pathway, which researchers have incorporated the genes of three enzymes in the pathway ( CYP76AD1 , DODA , GTThis gene, expressed through fusion with a self-cleaving polypeptide, can reconstruct the metabolic pathway of betalain in vivo, thereby accumulating red betalain in cells (He Y, Zhang T, Sun H, et al. A reporter for noninvasively monitoring gene expression and plant transformation[J]. Horticulture Research,2020,7(1):821-826.). Therefore, we constructed a dsRNA expression cassette from the candidate dsRNA fragments obtained from the initial screening, and integrated the cassette with the Ruby reporter system into the same expression vector. After transforming hairy roots, we used the Ruby reporter system to indicate whether the dsRNA expression cassette was successfully integrated into the hairy root genome, and then conducted further functional verification experiments on the dsRNA.

[0127] 1. Construction of dsRNA-derived Agrobacterium rhizogenes

[0128] Plant transformation vectors for dsRNA designed based on candidate dsRNA molecular sequences

[0129] PCR was used to obtain a dsRNA fragment containing a stem-loop structure (sense (dsVdHAT1-n)-loop-antisense (dsVdHAT1-n)). This fragment was then inserted into the pCAM1300-Ruby vector via homologous recombination to obtain the pCAM1300-(dsVdHAT1-n)-Ruby vector. The control vector pCAM1300-Ruby and the recombinant vector pCAM1300-(dsVdHAT1-n)-Ruby were transformed into *E. coli* DH5α competent cells. Single colonies were picked for PCR identification and enzyme digestion verification. Positive clones were sequenced to confirm that the target fragment was inserted in the correct orientation and that there were no sequence mutations. The pCAM1300-Ruby and pCAM1300-(dsVdHAT1-n)-Ruby vectors were transformed into Agrobacterium rhizogenes K599 competent cells, respectively. Positive clones were selected and designated as K599-Ruby and K599-(dsVdHAT1-n)-Ruby strains, respectively.

[0130] 2. Detection of target gene expression using a hairy root infection system

[0131] (1) Preparation of spore suspension

[0132] Verticillium dahliae V592 was cultured on liquid Czapek's medium with shaking for 3 days. The bacterial culture was collected and adjusted with distilled water to a spore concentration of approximately 1.0 × 10⁻⁶. 8 cfu / mL.

[0133] (2) Inoculation with hairy roots

[0134] ① Inoculate Agrobacterium strains K599-Ruby and K599-(dsVdHDAC-n)-Ruby into 1 mL LB+Strep medium and shake for 6-8 h;

[0135] ② Spread 100 μL of bacterial suspension onto LB+Strep solid medium and incubate overnight. Scrape colonies from the plate and resuspend them in injection conversion buffer to OD. 600 =0.5-0.6;

[0136] ③ Cut the above-ground part of the seedling obliquely from the base of the cotton stem, make a light cut, insert it into the bacterial conversion solution, and incubate it overnight in the dark;

[0137] ④ Insert the base of the explant stem into moist vermiculite, cover it, and incubate overnight;

[0138] ⑤ Cultured under normal LD ​​conditions, and after 12 days of culture, it was removed and placed in a hydroponic box to continue growing.

[0139] (3) Detect the expression level of target genes

[0140] Successfully transformed hairy roots are red. Once sufficient hairy roots of cotton plants transformed with both control strain K599-Ruby and target strain K599-(dsVdHAT1-n)-Ruby have grown, they are inoculated with a V592 spore suspension. Three days after inoculation, samples are taken, and total RNA is extracted from the cotton roots. 1 μg of total RNA is used for reverse transcription according to the instructions of the reverse transcription kit (R333-01, Vazyme) to synthesize the first strand of cDNA, which is then stored at -20℃ for later use. Using the cDNA as a template... VdHAT1 Gene-specific primers (based on) VdHAT1 Gene sequence design, upstream primer: 5'-ctgacatcaacgtgcccg-3', downstream primer: 5'-gacatggtatgcatttcgacc-3') for RT-qPCR amplification, using the housekeeping gene of Verticillium dahliae (e.g.) VdElf () was used as an internal reference gene to correct for differences in template amount. 2 -ΔΔCt Method for calculating each treatment group VdHAT1 The relative transcription level of the gene was set at 1, with the transcription level of the Ruby control group being 1.

[0141] The results are as follows Figure 7 As shown: Compared with the control (K599-Ruby), the hairy roots transformed with K599-(dsVdHAT1-n)-Ruby showed increased levels of Verticillium dahliae after infection with V592. VdHAT1 Gene expression levels were downregulated to varying degrees, indicating that the candidate dsVdHAT1 region could inhibit V592 expression. VdHAT1 Gene expression was inhibited. Among the inhibitory effects, dsVdHAT1-4 showed the most significant inhibition (expression reduction of approximately 48.8%), followed by dsVdHAT1-1 (reduction of approximately 20.5%) and dsVdHAT1-3 (reduction of approximately 19.7%). These results confirm that the dsVdHAT1 fragment can effectively interfere with the expression of key pathogen genes in plants, providing direct evidence for subsequent disease resistance applications.

[0142] Example 6: Verification of disease resistance of RNAi pesticide formulations.

[0143] 1. Preparation of nanoparticles

[0144] dsVdHAT1-1 / 3 / 4 was prepared in large quantities using an in vitro transcription system with T7 RNA polymerase, and then purified and quantified by LiCl precipitation. The purified dsVdHAT1-1 / 3 / 4 (100 μg / mL) was mixed with chitosan solution (2 mg / mL, dissolved in 1% acetic acid) at a ratio of 1:3 (w / w), and TPP solution (1 mg / mL) was slowly added dropwise while magnetically stirring for 30 min to form dsVdHAT1-n-chitosan-TPP nanocomplexes.

[0145] 2. Verification of disease resistance in potted plants

[0146] (1) Disinfection and sowing

[0147] Sow cotton seeds in small pots of nutrient soil (5 seeds per pot), and after 5 days of dark cultivation, they can be cultivated under light.

[0148] (2) Transplanting and inoculating cotton

[0149] After the cotton plants had developed four true leaves, six treatment groups were set up, with four cotton plants in each group, and the treatments were repeated three times. The specific treatments are as follows:

[0150] Treatment 1: Water control;

[0151] Treatment 2: Water control + V592;

[0152] Treatment 3: Blank nanocomposite (without dsVdHDAC components) + V592;

[0153] Treatment 4: dsVdHAT1-1 nanocomposite + V592;

[0154] Treatment 5: dsVdHAT1-3 nanocomposite + V592;

[0155] Treatment 6: dsVdHAT1-4 nanocomposite + V592.

[0156] V592 in the above treatment refers to the use of Verticillium dahliae spore suspension (1.0 × 10⁻⁶). 7 The roots were inoculated by soaking in a solution of cfu / mL; subsequently, the roots were drenched every 7 days with a nanocomposite containing dsVdHAT1-n and a blank nanocomposite.

[0157] (3) Disease resistance test of potted plants

[0158] The incidence of disease in cotton in each treatment group was investigated 15-20 days after inoculation. The incidence rate was recorded and the disease index was calculated to evaluate the control effect of different treatments.

[0159] Pathogenicity was statistically analyzed based on the degree of disease on each cotton leaf, and was divided into 5 levels: Level 0: no disease; Level 1: ≤25% of leaves were diseased; Level 2: 25~50% of leaves were diseased; Level 3: 50~75% of leaves were diseased; Level 4: ≥75% of leaves were diseased.

[0160] The results are as follows Figure 8 The results showed that after root irrigation, the incidence rates of diseases in treatments 4 to 6 were significantly lower than those in the water control, indicating that the dsVdHAT1 molecules in these candidate segments can all be used in biopesticides.

Claims

1. A method for inhibiting or silencing a pathogenic gene of Verticillium dahliae by RNAi (RNA interference), characterized in that, VdHAT1 the method for expressing is applied in the prevention and treatment of Verticillium wilt, characterized in that, The pathogenic gene is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO:

3. The RNAi is mediated by a dsRNA molecule that targets the gene and can reduce the virulence of Verticillium dahliae.

2. Use according to claim 1, characterized in that, The inhibition or silencing is achieved through host-induced gene silencing, microbial-mediated gene silencing, or RNAi pesticide formulation treatment.

3. A dsRNA molecule for the prevention and control of Verticillium wilt, characterized in that, The dsRNA molecule is capable of targeting the pathogenic gene as claimed in claim 1 VdHAT1 and inhibiting or silencing the expression of the gene, and the nucleotide sequence of the sense strand of the dsRNA molecule is selected from SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO:

7.

4. A recombinant vector, characterized in that, A DNA sequence comprising the expression of the dsRNA molecule of claim 3.

5. The recombinant vector according to claim 4, characterized in that, The vector is a plant expression vector or a microbial expression vector.

6. A recombinant microorganism, characterized in that, It includes the recombinant vector as described in claim 4 or 5.

7. A recombinant agricultural engineered bacteria, characterized in that, The agricultural engineering fungus is Trichoderma harzianum ( Trichoderma harzianum Its genome contains a DNA sequence capable of expressing the dsRNA molecule described in claim 3.

8. A method for cultivating plants resistant to Verticillium wilt, characterized in that, The invention includes introducing the recombinant vector of claim 4 or 5 into a plant or plant cell, wherein the recombinant vector is a plant expression vector, so that the cotton or cotton cell expresses the dsRNA molecule of claim 3; wherein the plant is cotton.

9. A plant resistant to Verticillium wilt, characterized in that, The plant contains an exogenous DNA sequence capable of expressing the dsRNA molecule of claim 3, and the plant is cotton.

10. An RNAi pesticide formulation, characterized in that, It includes an agriculturally acceptable vector and the dsRNA molecule of claim 3, and / or the siRNA molecule generated from said dsRNA molecule.

Images