Digital PCR primer probe combination for PIK3CA-related overgrowth spectrum molecular diagnosis and application

Abstract

The invention provides a digital PCR (Polymerase Chain Reaction) primer probe combination for PIK3CA (Polymerase Chain Reaction) related overgrowth spectrum molecular diagnosis and application of the digital PCR primer probe combination. Specifically, the invention provides a digital PCR (Polymerase Chain Reaction) primer combination for molecular diagnosis of PIK3CA-related overgrowth spectroscopy (PROS). Through acquisition and treatment of pathological specimens, establishment of reaction internal reference, design of digital PCR primers and probes for PIK3CA-related excessive growth spectrum (PROS) molecular diagnosis and automatic analysis and treatment of digital PCR results, the digital PCR detection and automatic analysis system provided by the invention can be used for carrying out PROS-related molecular diagnosis and liquid biopsy in a disease range of application; the correlation between mutation sites and abundance and disease phenotypes is disclosed, so that the method has a relatively great clinical popularization and application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to digital PCR primer-probe combinations and their applications for molecular diagnostics of PIK3CA-related overgrowth profiles. Background Technology

[0002] PIK3CA-associated excessive growth spectrum (PROS) is a collective term for a group of diseases caused by mutations in the PIK3CA gene, characterized by localized excessive growth in the trunk or limbs. Patients present with a wide variety of clinical manifestations, varying in severity, but these diseases can cause significant impairment to a patient's appearance, function, and quality of life.

[0003] Since the concept of PROS (Proliferative Epilepsy of the Disease) was proposed at the 2014 National Institutes of Health (NIH) meeting in the United States, international research on PROS has been booming. Currently, it is believed that the diagnosis of PROS requires not only considering the disease's progression during the patient's development and the clinical characteristics presented at the time of diagnosis, but also genetic testing to detect PIK3CA gene mutations. The genetic testing procedure requires a surgeon to puncture or remove a very small piece of skin or adipose tissue from the lesion area under anesthesia, which is then sent to a specialized sequencing company for gene analysis. This procedure is invasive, resulting in postoperative scar tissue hyperplasia, and children require general anesthesia, significantly limiting the accessibility of this testing method. Furthermore, gene mutations are limited to local tissues and are usually of very low abundance, requiring highly sensitive detection methods.

[0004] Therefore, there is an urgent need in this field to develop a highly sensitive digital PCR primer-probe combo and its application for molecular diagnostics of PIK3CA-related overgrowth spectrum (PROS) for liquid biopsy, to reveal the correlation between mutation sites and abundance and disease phenotype, and to provide an effective supplement to existing clinical testing methods for PROS-related molecular diagnostics and in vitro detection. Summary of the Invention

[0005] The purpose of this invention is to provide a digital PCR primer-probe combination for molecular diagnosis of PIK3CA-related excessive growth spectrum (PROS) and its application. It has high sensitivity, can be used for liquid biopsy, reveals the correlation between mutation sites and abundance and disease phenotype, and can be used for molecular diagnosis and in vitro detection of PROS, providing an effective supplement to existing clinical detection methods.

[0006] In a first aspect, the present invention provides a digital PCR primer-probe combination for detecting PIK3CA-associated excessive growth spectrum (PROS), the digital PCR primer-probe combination being used to detect mutations in the pathogenic gene of PIK3CA-associated excessive growth spectrum (PROS), wherein the mutation of the PROS pathogenic gene is selected from the following group:

[0007] p.Glu81Lys, p.Gly118Asp, p.Asp350Gly, p.Cys420Arg, p.Glu542Lys, p.Glu545Lys, p.Glu545Ala, p.Gln546Lys, p.His1047Leu, p.His1047Arg, p.Glu453Lys, p.Asn345Lys, or combinations thereof.

[0008] In another preferred embodiment, the primer-probe combination for detecting the p.Glu81Lys mutation includes primer pairs as shown in SEQ ID NO: 2-3 and probes as shown in SEQ ID NO: 4.

[0009] In another preferred embodiment, the primer-probe combination for detecting the p.Gly118Asp mutation comprises primer pairs as shown in SEQ ID NO: 6-7 and probes as shown in SEQ ID NO: 8.

[0010] In another preferred embodiment, the primer-probe combination for detecting the p.Asp350Gly mutation comprises primer pairs as shown in SEQ ID NO: 10-11 and probes as shown in SEQ ID NO: 12.

[0011] In another preferred embodiment, the primer-probe combination for detecting the p.Cys420Arg mutation comprises primer pairs as shown in SEQ ID NO: 14-15 and probes as shown in SEQ ID NO: 15.

[0012] In another preferred embodiment, the primer-probe combination for detecting the p.Glu542Lys mutation comprises primer pairs as shown in SEQ ID NO: 18-19 and probes as shown in SEQ ID NO: 20.

[0013] In another preferred embodiment, the primer-probe combination for detecting the p.Glu545Lys mutation includes primer pairs as shown in SEQ ID NO: 22 and SEQ ID NO: 19 and probes as shown in SEQ ID NO: 20.

[0014] In another preferred embodiment, the primer-probe combination for detecting the p.Glu545Ala mutation includes primer pairs as shown in SEQ ID NO: 24 and SEQ ID NO: 19 and probes as shown in SEQ ID NO: 20.

[0015] In another preferred embodiment, the primer-probe combination for detecting the p.Gln546Lys mutation comprises primer pairs as shown in SEQ ID NO: 26-27 and probes as shown in SEQ ID NO: 28.

[0016] In another preferred embodiment, the primer-probe combination for detecting the p.His1047Leu mutation includes primer pairs as shown in SEQ ID NO: 30-31 and probes as shown in SEQ ID NO: 32.

[0017] In another preferred embodiment, the primer-probe combination for detecting the p.His1047Arg mutation includes primer pairs as shown in SEQ ID NO: 33 and SEQ ID NO: 31 and probes as shown in SEQ ID NO: 32.

[0018] In another preferred embodiment, the primer-probe combination for detecting the p.Glu453Lys mutation comprises primer pairs as shown in SEQ ID NO: 35-36 and probes as shown in SEQ ID NO: 37.

[0019] In another preferred embodiment, the primer-probe combination for detecting the p.Asn345Lys mutation includes primer pairs as shown in SEQ ID NO: 39-40 and probes as shown in SEQ ID NO: 41.

[0020] In another preferred embodiment, the probe is modified with a fluorescent group.

[0021] In another preferred embodiment, the fluorescent group is selected from the group consisting of FAM, VIC, HEX, FITC, BODIPY-FL, G-Dye100, FluorX, Cy3, Cy5, Texas Red, or combinations thereof.

[0022] In another preferred embodiment, the probe 3' end is marked with a quenching group.

[0023] In another preferred embodiment, the quenching group is selected from the group consisting of: DABCYL, TAMRA, BHQ1, BHQ2, BHQ3, MGB, BBQ-650, TQ1-TQ6, QSY 7carboxylic acid, TQ7, eclipse, with MGB being preferred, to increase the Tm value and reduce the fluorescence background.

[0024] In another preferred embodiment, the p.Glu81Lys mutation refers to the mutation of glutamic acid Glu at position 81 of the PIK3CA protein amino acid sequence into lysine Lys (i.e., p.Glu81Lys).

[0025] In another preferred embodiment, the p.Glu81Lys mutation refers to the mutation of guanine G at position 241 of the PIK3CA gene nucleic acid sequence into adenine A (i.e., c.241G>A).

[0026] In another preferred embodiment, the p.Gly118Asp mutation refers to the mutation of glycine Gly at position 118 of the amino acid sequence of the PIK3CA protein into aspartic acid Asp (i.e., p.Gly118Asp).

[0027] In another preferred embodiment, the p.Gly118Asp mutation refers to the mutation of guanine G at position 353 of the PIK3CA gene nucleic acid sequence into adenine A (i.e., c.353G>A).

[0028] In another preferred embodiment, the p.Asp350Gly mutation refers to the mutation of the aspartic acid Asp at position 350 of the PIK3CA protein amino acid sequence to glycine Gly (i.e., p.Asp350Gly).

[0029] In another preferred embodiment, the p.Asp350Gly mutation refers to the mutation of adenine A at position 1049 of the PIK3CA gene nucleic acid sequence into guanine G (i.e., c.1049A>G).

[0030] In another preferred embodiment, the p.Cys420Arg mutation refers to the mutation of cysteine ​​Cys at position 420 of the PIK3CA protein amino acid sequence to arginine Arg (i.e., p.Cys420Arg).

[0031] In another preferred embodiment, the p.Cys420Arg mutation refers to the thymine T mutation at position 1258 of the PIK3CA gene nucleic acid sequence being replaced by cytosine C (i.e., c.1258T>C).

[0032] In another preferred embodiment, the p.Glu542Lys mutation refers to the mutation of glutamic acid Glu at position 542 of the PIK3CA protein amino acid sequence into lysine Lys (i.e., p.Glu542Lys).

[0033] In another preferred embodiment, the p.Glu542Lys mutation refers to the mutation of guanine G at position 1624 of the PIK3CA gene nucleic acid sequence into adenine A (i.e., c.1624G>A).

[0034] In another preferred embodiment, the p.Glu545Lys mutation refers to the mutation of glutamic acid Glu at position 545 of the PIK3CA protein amino acid sequence into lysine Lys (i.e. p.Glu545Lys).

[0035] In another preferred embodiment, the p.Glu545Lys mutation refers to the mutation of guanine G at position 1633 of the PIK3CA gene nucleic acid sequence into adenine A (i.e., c.1633G>A).

[0036] In another preferred embodiment, the p.Glu545Ala mutation refers to the mutation of glutamic acid Glu at position 545 of the PIK3CA protein amino acid sequence to alanine Ala (i.e. p.Glu545Ala).

[0037] In another preferred embodiment, the p.Glu545Ala mutation refers to the mutation of adenine A at position 1634 of the PIK3CA gene nucleic acid sequence into cytosine C (i.e., c.1634A>C).

[0038] In another preferred embodiment, the p.Glu546Lys mutation refers to the mutation of glutamic acid Glu at position 546 of the PIK3CA protein amino acid sequence into lysine Lys (i.e., p.Glu546Lys).

[0039] In another preferred embodiment, the p.Glu546Lys mutation refers to the mutation of cytosine C at position 1636 of the PIK3CA gene nucleic acid sequence to adenine A (i.e., c.1636C>A).

[0040] In another preferred embodiment, the p.Glu546Lys mutation refers to the mutation of glutamic acid Glu at position 546 of the PIK3CA protein amino acid sequence into lysine Lys (i.e., p.Glu546Lys).

[0041] In another preferred embodiment, the p.Glu546Lys mutation refers to the mutation of cytosine C at position 1636 of the PIK3CA gene nucleic acid sequence to adenine A (i.e., c.1636C>A).

[0042] In another preferred embodiment, the p.His1047Leu mutation refers to the mutation of histidine His at position 1047 of the amino acid sequence of the PIK3CA protein to leucine Leu (i.e., p.His1047Leu).

[0043] In another preferred embodiment, the p.His1047Leu mutation refers to the mutation of adenine A at position 3140 of the PIK3CA gene nucleic acid sequence into thymine T (i.e., c.3140A>T).

[0044] In another preferred embodiment, the p.His1047Arg mutation refers to the mutation of histidine His at position 1047 of the amino acid sequence of the PIK3CA protein to arginine Arg (i.e., p.His1047Arg).

[0045] In another preferred embodiment, the p.His1047Arg mutation refers to the mutation of adenine A at position 3140 of the PIK3CA gene nucleic acid sequence into guanine G (i.e., c.3140A>G).

[0046] In another preferred embodiment, the p.Glu453Lys mutation refers to the mutation of glutamic acid Glu at position 453 of the PIK3CA protein amino acid sequence to lysine Lys (i.e., p.Glu453Lys).

[0047] In another preferred embodiment, the p.Glu453Lys mutation refers to the mutation of guanine G at position 1357 of the PIK3CA gene nucleic acid sequence into adenine A (i.e., c.1357G>A).

[0048] In another preferred embodiment, the p.Asn345Lys mutation refers to the mutation of asparagine Asn at position 345 of the PIK3CA protein amino acid sequence to lysine Lysine (i.e., p.Asn345Lys).

[0049] In another preferred embodiment, the p.Asn345Lys mutation refers to the thymine T mutation at position 1035 of the PIK3CA gene nucleic acid sequence being replaced by adenine A (i.e., c.1035T>A).

[0050] In a second aspect of the invention, a reagent is provided for detecting PIK3CA-related overgrowth profiles (PROS), said reagent being selected from the group consisting of:

[0051] (a) A primer-probe combination for detecting the p.Glu81Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 1-3 and the probe sequence shown in SEQ ID NO: 4, wherein,

[0052] The primers shown in SEQ ID NO: 1 and SEQ ID NO: 3 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein at position 81, which is Glu.

[0053] The primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the 81st position mutated to Lys;

[0054] The probe sequence shown in SEQ ID NO: 4 is a common probe sequence, and the probe is preferably an MGB probe;

[0055] (b) A primer-probe combination for detecting the p.Gly118Asp mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 5-7 and the probe sequence shown in SEQ ID NO: 8, wherein,

[0056] The primers shown in SEQ ID NO: 5 and SEQ ID NO: 7 are used to amplify the sequence containing the PIK3CA protein amino acid sequence at position 118, which is Gly.

[0057] The primers shown in SEQ ID NO: 6 and SEQ ID NO: 7 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with the mutation at position 118 to Asp;

[0058] The probe sequence shown in SEQ ID NO: 8 is a common probe sequence, and the probe is preferably an MGB probe;

[0059] (c) A primer-probe combination for detecting the p.Asp350Gly mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 9-11 and the probe sequence shown in SEQ ID NO: 12, wherein,

[0060] The primers shown in SEQ ID NO: 9 and SEQ ID NO: 11 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with Asp at position 350.

[0061] The primers shown in SEQ ID NO: 10 and SEQ ID NO: 11 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with a mutation at position 350 to Gly.

[0062] The probe sequence shown in SEQ ID NO: 12 is a common probe sequence, and the probe is preferably an MGB probe;

[0063] (d) A primer-probe combination for detecting the p.Cys420Arg mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 13-15 and the probe sequence shown in SEQ ID NO: 16, wherein,

[0064] The primers shown in SEQ ID NO: 13 and SEQ ID NO: 15 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with Cys at position 420.

[0065] The primers shown in SEQ ID NO: 14 and SEQ ID NO: 15 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with a mutation at position 420 to Arg.

[0066] The probe sequence shown in SEQ ID NO: 16 is a common probe sequence, and the probe is preferably an MGB probe;

[0067] (e) A primer-probe combination for detecting the p.Glu542Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 17-19 and the probe sequence shown in SEQ ID NO: 20, wherein,

[0068] The primers shown in SEQ ID NO: 17 and SEQ ID NO: 19 are used to amplify the sequence containing Glu at position 542 of the PIK3CA protein amino acid sequence;

[0069] The primers shown in SEQ ID NO: 18 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 542 to Lys;

[0070] The probe sequence shown in SEQ ID NO: 20 is a common probe sequence, and the probe is preferably an MGB probe;

[0071] (f) A primer-probe combination for detecting the p.Glu545Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 19, 21 and 22 and the probe sequence shown in SEQ ID NO: 20, wherein,

[0072] The primers shown in SEQ ID NO: 21 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein at position 545, which is Glu.

[0073] The primers shown in SEQ ID NO: 22 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 545 to Lys;

[0074] The probe sequence shown in SEQ ID NO: 20 is a common probe sequence, and the probe is preferably an MGB probe;

[0075] (g) A primer-probe combination for detecting the p.Glu545Ala mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 19, 23 and 24 and the probe sequence shown in SEQ ID NO: 20, wherein,

[0076] The primers shown in SEQ ID NO: 23 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein at position 545, which is Glu.

[0077] The primers shown in SEQ ID NO: 24 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the 545th position mutated to Ala.

[0078] The probe sequence shown in SEQ ID NO: 20 is a common probe sequence, and the probe is preferably an MGB probe;

[0079] (h) A primer-probe combination for detecting the p.Gln546Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 25-27 and the probe sequence shown in SEQ ID NO: 28, wherein,

[0080] The primers shown in SEQ ID NO: 25 and SEQ ID NO: 27 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with Gln at position 546.

[0081] The primers shown in SEQ ID NO: 26 and SEQ ID NO: 27 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 546 to Lys;

[0082] The probe sequence shown in SEQ ID NO: 28 is a common probe sequence, and the probe is preferably an MGB probe;

[0083] (i) a primer-probe combination for detecting the p.His1047Leu mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 29-31 and the probe sequence shown in SEQ ID NO: 32, wherein,

[0084] The primers shown in SEQ ID NO: 29 and SEQ ID NO: 31 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with His at position 1047.

[0085] The primers shown in SEQ ID NO: 30 and SEQ ID NO: 31 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 1047 to Leu.

[0086] The probe sequence shown in SEQ ID NO: 32 is a common probe sequence, and the probe is preferably an MGB probe;

[0087] (j) A primer-probe combination for detecting the p.His1047Arg mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 29, 31 and 33 and the probe sequence shown in SEQ ID NO: 32, wherein,

[0088] The primers shown in SEQ ID NO: 29 and SEQ ID NO: 31 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with His at position 1047.

[0089] The primers shown in SEQ ID NO: 33 and SEQ ID NO: 31 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 1047 to Arg;

[0090] The probe sequence shown in SEQ ID NO: 32 is a common probe sequence, and the probe is preferably an MGB probe;

[0091] (k) A primer-probe combination for detecting the p.Glu453Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 34-36 and the probe sequence shown in SEQ ID NO: 37, wherein,

[0092] The primers shown in SEQ ID NO: 34 and SEQ ID NO: 36 are used to amplify the sequence containing Glu at position 453 of the PIK3CA protein amino acid sequence;

[0093] The primers shown in SEQ ID NO: 35 and SEQ ID NO: 36 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 453 to Lys;

[0094] The probe sequence shown in SEQ ID NO: 37 is a common probe sequence, and the probe is preferably an MGB probe;

[0095] (l) A primer-probe combination for detecting the p.Asn345Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 38-40 and the probe sequence shown in SEQ ID NO: 41, wherein,

[0096] The primers shown in SEQ ID NO: 38 and SEQ ID NO: 40 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with the 345th position being Asn;

[0097] The primers shown in SEQ ID NO: 39 and SEQ ID NO: 40 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 345 to Lys;

[0098] The probe sequence shown in SEQ ID NO: 41 is a common probe sequence, and the probe is preferably an MGB probe;

[0099] (m) Any two or more combinations of (a)-(l) above.

[0100] In another preferred embodiment, the primer pair is designed based on ARMS-PCR.

[0101] In a third aspect of the invention, a kit is provided for detecting PIK3CA-associated overgrowth profile (PROS), the kit comprising a digital PCR primer-probe combination as described in the first aspect of the invention or a reagent as described in the second aspect of the invention.

[0102] In another preferred embodiment, the kit performs simultaneous detection in a single reaction system based on a multiplex fluorescent PCR or multiplex digital PCR platform.

[0103] In another preferred embodiment, the kit includes instructions for use, which state:

[0104] If a hotspot mutation of a PROS-causing gene selected from the following groups is detected, it suggests that the patient belongs to the PIK3CA-associated proliferative spectrum (PROS):

[0105] p.Glu81Lys, p.Gly118Asp, p.Asp350Gly, p.Cys420Arg, p.Glu542Lys, p.Glu545Lys, p.Glu545Ala, p.Gln546Lys, p.His1047Leu, p.His1047Arg, p.Glu453Lys, p.Asn345Lys, or combinations thereof.

[0106] In another preferred embodiment, the kit includes a digital PCR buffer MIX.

[0107] In a fourth aspect of the invention, there is provided the use of a primer-probe combination as described in the first aspect of the invention, or a reagent as described in the second aspect of the invention, or a kit as described in the third aspect of the invention, for preparing a diagnostic product for predicting the efficacy of a drug for treating PROS in a subject.

[0108] In another preferred embodiment, the drug for treating PROS is selected from the group consisting of Vijoice, inavolisib (GDC-0077), or other PIK3CA inhibitors.

[0109] In another preferred embodiment, the PIK3CA inhibitor is selected from alpelisib (BYL719).

[0110] In another preferred embodiment, the product is used to test lymph fluid samples.

[0111] In another preferred embodiment, the subject is a patient with PIK3CA-associated proliferative spectrum (PROS).

[0112] In another preferred embodiment, the subject is a child with PIK3CA-associated excessive growth spectrum (PROS).

[0113] In a fifth aspect of the present invention, a method for detecting whether a sample to be tested contains a gene mutation is provided, comprising the steps of:

[0114] (S1) A PCR reaction system is provided, wherein the PCR reaction system contains a test sample as a template and a primer-probe combination as described in the first aspect of the present invention for amplification.

[0115] (S2) Perform a PCR reaction on the PCR reaction system described in step (S1) to obtain the amplification product;

[0116] (S3) Analyze the amplification products generated in step (S2) to obtain the analysis results of whether the sample to be tested contains gene mutations.

[0117] In another preferred embodiment, the analytical results are qualitative or quantitative, with the quantitative results calculated based on the ratio of the number of mutation-positive points to the internal reference.

[0118] In another preferred embodiment, the gene mutation is a hotspot mutation of the PROS pathogenic gene.

[0119] In another preferred example, hotspot mutations in the PROS pathogenic gene are selected from the following group:

[0120] p.Glu81Lys, p.Gly118Asp, p.Asp350Gly, p.Cys420Arg, p.Glu542Lys, p.Glu545Lys, p.Glu545Ala, p.Gln546Lys, p.His1047Leu, p.His1047Arg, p.Glu453Lys, p.Asn345Lys, or combinations thereof.

[0121] In another preferred embodiment, the PCR reaction system is a digital PCR reaction system.

[0122] In another preferred embodiment, the digital PCR is dPCR.

[0123] In another preferred embodiment, the primer pairs used to detect wild-type and mutant genes are designed based on ARMS-PCR, with the 3' end bases complementary to the wild-type or mutant sites, and a mismatched base introduced at the penultimate base, thereby amplifying only the corresponding wild-type or mutant sequences; the same probe marker (such as HEX, FAM) is used, preferably the Taqman MGB probe.

[0124] In another preferred embodiment, the probe contains locked nucleotides.

[0125] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0126] In another preferred embodiment, the method is an in vitro method.

[0127] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0128] Figure 1 The results shown are partial characterizations of the PIK3CA-related overgrowth spectrum (PROS).

[0129] Figure 2 This chart shows the percentage of hotspot mutations in all known PROS pathogenic genes. Detailed Implementation

[0130] Through extensive and in-depth research, the inventors have developed a digital PCR primer-probe combination and its application for molecular diagnosis of PIK3CA-related excessive growth spectrum (PROS). Using lymph fluid from children with PROS as the test sample, containing exfoliated lymphatic endothelial cells (LECs), and based on the principle of PIK3CA mutation liquid biopsy, the procedure is simple and allows for repeated sampling, enabling non-surgical acquisition of samples for gene testing. Multiple tests can be performed to assess changes in gene mutation abundance. The digital PCR system provided by this invention can detect 5 mutation sites per reaction, and 10 mutation sites can be detected with 2 sets of reactions, covering more than 95% of reported common mutation sites. The digital PCR system provided by this invention has high sensitivity, enabling the detection of gene mutations with a mutation abundance ratio of 0.1%, which is a significant advantage over traditional fluorescent PCR. It eliminates the need to consider amplification efficiency and is particularly suitable for detecting rare mutations, minimal residual disease, and copy number variations (CNVs). Quantification only requires calculating the ratio of mutation-positive wells to internal controls, resulting in simple and clear results. The digital PCR system has a short detection time and low cost, significantly lower than traditional NGS. Panel detection: This invention extracts lymphatic fluid from PROS tissues of children with PROS who respond to and do not respond to rapamycin treatment. Using a digital PCR detection system for PROS molecular diagnosis, the abundance of PIK3CA mutations can be dynamically detected, providing a basis for targeted drug treatment and discontinuation criteria.

[0131] the term

[0132] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0133] The term “about” can refer to a value or composition within an acceptable margin of error for a particular value or composition as determined by a person skilled in the art, depending in part on how the value or composition is measured or determined. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0134] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0135] PIK3CA-related overgrowth spectrum (PROS)

[0136] PIK3CA-associated excessive growth spectrum (PROS) is a collective term for a group of diseases caused by mutations in the PIK3CA gene, characterized by localized excessive growth in the trunk or limbs. Patients present with a wide variety of clinical manifestations, varying in severity.

[0137] As used in this article, the term “PROS” stands for PIK3CA-associated overgrowth spectrum, encompassing known and emerging clinical entity mutations associated with somatic PIK3CA.

[0138] The PROS classification was proposed by researchers and parent representatives from patient family support and advocacy organizations at a 2013 NIH workshop to unite a group of rare overgrowth conditions caused by PIK3CA mutations.

[0139] Specific conditions associated with PROS include Klippel-Trenaunay syndrome, syringo syndrome, solitary lymphangiogenic malformation, megalencephaly-capillary malformation, unilateral megalencephaly / developmental dysplasia-focal cortical dysplasia type II, hemiproliferative-multiple lipomatosis, facial invasive lipomatosis, fibrofatty-vascular dysplasia, macrodactyly, muscular unilateral hyperplasia, fibrofatty hyperplasia or overgrowth, CLAPO syndrome and epidermal nevus, benign lichenoid keratosis or seborrheic keratosis. Figure 1 The estimated prevalence of PROS disease is approximately 14 per million people. Vijoice is the first FDA-approved drug for the treatment of PROS disease. Vijoice is a kinase inhibitor that works by inhibiting phosphatidylinositol-3-kinase (PI3K), primarily the PI3K-α isomer. Inhibition of the PI3K pathway can prevent or improve organ abnormalities associated with these diseases.

[0140] Digital PCR (dPCR)

[0141] Digital PCR (DPCR) technology, based on single-molecule PCR, is a method for absolute quantification of nucleic acids. It primarily employs microfluidics or microdropletization methods, currently a hot research area in analytical chemistry, to disperse a large-scale diluted nucleic acid solution into microreactors or microdroplets on a chip. Each reactor contains no more than one nucleic acid template. After PCR cycles and amplification, the fluorescence signal of each microdroplet is analyzed. Reactors containing nucleic acid template molecules will produce a fluorescence signal, while those without template molecules will not. Based on the relative proportions and reactor volumes, the nucleic acid concentration of the original solution can be calculated.

[0142] Compared to conventional qPCR, digital PCR can accurately quantify and detect target nucleic acid molecules with high sensitivity. The analysis of conventional qPCR results is a simulation method, whereas digital PCR, whose results are analyzed digitally (because the obtained signal has values ​​of "0" or "1"), has the advantages of analyzing large-volume samples, simultaneously detecting different samples, and performing different tests simultaneously. Digital PCR is a technique that uses single-molecule counting without a standard curve to absolutely quantify DNA samples, and can perform more precise absolute quantification of individual droplets per well through PCR (see Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol. Diagn. 4(1), 41-47 (2004)). Digital PCR has advantages such as high sensitivity, accurate quantification without a standard curve, and simple operation.

[0143] In digital PCR, droplets containing a sample gene template, amplification primers, and a fluorescent probe prepared for dilution to an average copy number of 0.5–1 are dispensed into individual wells, and microemulsion PCR is performed. Wells displaying a fluorescent signal are counted as "1" because samples with a gene copy number of 1 were dispensed into these wells and amplified, resulting in a fluorescent signal. Wells displaying no signal are counted as "0" because samples with a gene copy number of 0 were dispensed into these wells and, due to no amplification, did not display a fluorescent signal. This method allows for absolute quantification.

[0144] Digital PCR, as a third-generation PCR technology, can theoretically amplify and detect single-copy target nucleic acid fragments, making it the most sensitive nucleic acid detection technology currently available. Utilizing a multicolor fluorescent digital PCR platform, combined with the application of different fluorescently labeled hydrolysis probes, multiple target fragments can be detected simultaneously. This invention presents a kit and method for simultaneously detecting multiple pathogenic drug genes using a multiplex digital PCR platform. It enables absolute quantification, and compared to NGS sequencing and quantitative real-time PCR, digital PCR exhibits higher detection sensitivity and accuracy, making it particularly suitable for detecting rare mutations, including clinically recognized minimal residual disease (MRD).

[0145] Primers

[0146] A primer is a macromolecule with a specific nucleotide sequence that is stimulated to synthesize at the initiation of nucleotide polymerization and is covalently linked to the reactant. Primers are usually two artificially synthesized oligonucleotide sequences, one primer being complementary to one DNA template strand at one end of the target region, and the other primer being complementary to the other DNA template strand at the other end of the target region.

[0147] In this invention, in order to improve the sensitivity of the detection system, the corresponding gene fragment in the detection system is pre-amplified, and therefore primers corresponding to the sequence where the mutation is located are designed.

[0148] probe

[0149] In this paper, "probe," "nucleic acid probe," and "gene probe" are interchangeable and refer to a nucleic acid sequence (DNA or RNA) with a known sequence and a detection marker that is complementary to the target gene. Gene probes bind to the target gene through molecular hybridization, generating a hybridization signal that reveals the target gene from the vast genome. According to the principle of hybridization, the nucleic acid sequence used as a probe must meet at least the following two conditions: ① It should be single-stranded; if double-stranded, it must be denatured first; ② It should carry an easily detectable marker. Nucleic acid probes can include the entire gene or only a part of it; they can be DNA itself or RNA transcribed from it. In this invention, the probe also refers to a modified primer, which has chemical modification groups at both ends or in the middle. These chemical modifications have special functions, including but not limited to: signal indication, enhancing the connection with reactants, etc.

[0150] The main advantages of this invention are:

[0151] (1) Using the lymph fluid of the child with PROS as a test sample, it is possible to obtain the gene test specimen non-surgically and to repeat the test multiple times to assess the changes in gene mutation abundance.

[0152] (2) The digital PCR system provided by the present invention can detect 5 mutation sites each time, and 10 mutation sites can be detected in 2 sets of reactions, with a coverage of more than 95%.

[0153] (3) The digital PCR system provided by the present invention has high sensitivity and can achieve pg-level gene mutation detection.

[0154] (4) The digital PCR system provided by the present invention has a short detection time and low cost, which is significantly lower than that of traditional NGS panel detection.

[0155] (5) The PROS molecular diagnostic digital PCR detection system provided by the present invention can dynamically detect the abundance of PIK3CA mutations, providing a basis for targeted drug treatment and discontinuation criteria.

[0156] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0157] Unless otherwise specified, all experimental materials and reagents used in the following examples are available from commercially available sources.

[0158] This invention discloses a digital PCR primer combination and its application for molecular diagnosis of PIK3CA-related Proliferative Spectrum (PROS), including hotspot mutation combinations of all PIK3CA-related PROS pathogenic genes, acquisition and processing of lesion specimens, establishment of internal control for the reaction, design of digital PCR primers for molecular diagnosis of PIK3CA-related PROS, automated analysis and processing of digital PCR results, and the range of diseases for which this digital PCR detection and automated analysis system is applied.

[0159] The acquisition and processing of the aforementioned lesion specimens were constructed using a specific optimization adapted to the digital PCR system. The aforementioned internal control for the reaction consisted of positive reaction internal control primers adapted to the digital PCR system.

[0160] The digital PCR primers for the molecular diagnostic of PIK3CA-related overgrowth spectrum (PROS) were designed and validated after specific optimization of the PIK3CA gene mutation hotspot region.

[0161] The automated analysis and processing of the digital PCR results involves artificial intelligence processing, such as noise reduction, artifact removal, and automated comparison, performed by the dedicated software of the digital PCR instrument. This allows for the direct display of the detection abundance of each hotspot mutation site.

[0162] The scope of diseases that this digital PCR detection and automated analysis system can be applied to is based on the gene mutation sites in the PIK3CA-related Proliferative Spectrum (PROS). It can perform PROS-related molecular diagnosis and liquid biopsy, revealing the correlation between mutation sites and abundance and disease phenotypes, thus having great potential for clinical application.

[0163] Experimental methods:

[0164] Digital PCR (dPCR) is a technique for absolute quantification of nucleic acid molecules. Compared to traditional real-time quantitative PCR (qPCR), it can directly count the number of DNA molecules, achieving absolute quantification of the starting sample. Digital PCR technology divides the sample into numerous tiny reaction units, each containing zero or one target DNA molecule, then performs PCR amplification and fluorescence signal detection, and uses statistical methods to analyze and determine the precise number of DNA molecules.

[0165] The specific experimental steps for digital PCR detection typically include:

[0166] 1. Sample preparation: Extract and purify DNA or RNA. If it is for gene expression analysis, mRNA needs to be reverse transcribed into cDNA.

[0167] 2. Reaction solution preparation: Add template DNA or cDNA, primers, probes, and reaction buffer to the reaction system. Primer and probe design is crucial, ensuring specificity and coverage of the target sequence.

[0168] 3. Droplet generation: The prepared reaction system is dispersed into thousands of nano-level droplets using a droplet generator, each droplet containing zero or one target molecule.

[0169] 4. PCR amplification: The generated droplets are amplified in a conventional PCR instrument without the need for real-time detection of fluorescence signals.

[0170] 5. Droplet analysis: After amplification, a dedicated droplet analyzer is used to detect the fluorescence signal in each droplet.

[0171] 6. Data Analysis: Based on the Poisson distribution principle, analyze the proportion of positive droplets and calculate the absolute number of target molecules in the sample.

[0172] 7. Result Interpretation: The software automatically analyzes the results and provides quantitative data on the target gene.

[0173] Digital PCR technology boasts high sensitivity and accuracy, making it suitable for rare mutation detection, copy number variation analysis, viral load detection, and gene expression analysis. Its advantages include the elimination of the need for a standard curve, enabling direct absolute quantification, and high tolerance to inhibitors.

[0174] In addition, digital PCR technology can also be used to analyze subtle differences in gene expression, such as by comparing the copy number of the Nix gene in different sexes of Aedes aegypti mosquitoes to determine gene expression regulation.

[0175] Example 1

[0176] Based on the above experimental methods, the experimental process of this embodiment is as follows:

[0177] (1) Under non-anesthesia, 3 ml of lymph fluid was punctured and aspirated. After centrifugation at 5000 rpm, the supernatant was discarded and stored at 4℃ or -20℃.

[0178] (2) After centrifuging the lymph fluid, extract genomic DNA from the cell mixture and store it at 4°C or -20°C.

[0179] (3) Following the operating steps, add the extracted DNA to the digital PCR reaction system, perform the test, and automatically obtain the test results.

[0180] The primer and probe designs for PI3K3CA-related mutant genes are shown in Table 1 below:

[0181] Table 1

[0182]

[0183]

[0184] Note: In the PIK3CA gene shown in the table, taking "c.241G>A(p.Glu81Lys)" as an example, c.241G>A represents the mutation of guanine G to adenine A at position 241 of the PIK3CA gene nucleic acid sequence (i.e., c.241G>A); p.Glu81Lys represents the mutation of glutamic acid Glu to lysine at position 81 of the PIK3CA protein amino acid sequence (i.e., p.Glu81Lys).

[0185] The corresponding primer Fw refers to the forward primer for amplifying the unmutated sequence (also known as the wild-type sequence or original sequence) of the PIK3CA gene locus (such as guanine G at position 241 of the PIK3CA gene nucleic acid sequence); primer Fm refers to the forward primer for amplifying the mutated sequence of the PIK3CA gene locus (such as guanine G at position 241 of the PIK3CA gene nucleic acid sequence mutated to adenine A); primer R refers to the reverse sequence for amplifying the corresponding PIK3CA gene locus; other genes follow the same principle and will not be elaborated further; primer Rw represents the reverse primer for amplifying the original sequence of the corresponding PIK3CA gene locus, primer Rm represents the reverse primer for amplifying the mutated sequence of the corresponding PIK3CA gene locus, primer F refers to the forward sequence for amplifying the corresponding PIK3CA gene locus; SEQ represents the sequence number SEQ ID NO:.

[0186] The primer and probe sequences for the internal reference gene CFTR are shown below:

[0187] Forward primer F: AACCTGCCTTCTCTGGGAAT (SEQ ID NO: 42);

[0188] Reverse primer R: AAGCCTGGCAATAAACAATGA (SEQ ID NO: 43);

[0189] Probe P: TGCTGCCTGAACAT (SEQ ID NO: 44).

[0190] The amino acid sequence of wild-type PIK3CA (GenBank: KAI6063561.1) is shown below:

[0191]

[0192] (4) Combine the patient’s phenotype and genotype to perform PROS-related molecular diagnosis to guide targeted drug treatment or guidance on drug discontinuation.

[0193] This embodiment uses lymphatic fluid from a child with PROS (Prostate-Induced Syndrome) as the test sample, achieving non-surgical acquisition of specimens for gene testing. Multiple tests can be repeated to assess changes in gene mutation abundance. The invention employs a digital PCR system capable of detecting 5 mutation sites per test, with two sets of reactions detecting 10 mutation sites, covering over 95% of reported common mutation sites. This digital PCR system has high sensitivity, enabling the detection of gene mutations with a mutation abundance ratio of 0.1%. The system also boasts short testing time and low cost, significantly lower than traditional NGS panel testing. This digital PCR detection system for PROS molecular diagnostics can dynamically detect the abundance of PIK3CA mutations, providing a basis for targeted drug treatment and discontinuation criteria.

[0194] discuss

[0195] In recent years, with the increasing popularity of liquid biopsy, it has become possible to perform gene testing for PIK3CA gene mutations using digital PCR technology in peripheral blood or lymph.

[0196] Digital PCR (dPCR), as a third-generation PCR technology, can achieve absolute quantification. Compared with NGS sequencing and quantitative real-time PCR, digital PCR shows higher detection sensitivity and accuracy, especially suitable for detecting rare mutations, including clinically significant residual disease (MRD). Digital PCR systems have demonstrated extremely high detection sensitivity and reliability in multiple clinical case studies. Mature kits for detecting the PIK3CA mutation hotspot E545K are available, employing allele-specific PCR (AS-PCR, also known as ARMS-PCR) combined with Taqman probes to effectively distinguish between mutation sites and wild-type. The basic principle is to design a mismatch at the third-to-last base of the 3' end of the PCR primer, ensuring that the primer can only amplify specific mutation SNP sites and not wild-type templates, thus detecting specific genotypes. Previous studies have used Naica CN-based digital PCR (dPCR) to detect the abundance of the PIK3CA gene p.H1047R / p.H1047L / p.E542K point mutation sites in the ctDNA of cystic fluid from children with lymphangiomas. Figure 2 This study validated the feasibility of dPCR liquid biopsy for detecting gene mutation sites and abundance. Previous large-scale NGS sequencing of PROS tissues (110 cases have been sequenced, 88 of which had PIK3CA mutations) showed a high degree of consistency between PROS lesion tissues and lymph fluid in PIK3CA mutation detection results.

[0197] Therefore, lymph fluid from children with PROS (Prostate-Induced Syndrome) containing exfoliated lymphatic endothelial cells (LECs) was used as the test sample. Based on the principle of PIK3CA mutation liquid biopsy, the procedure is simple and repeatable. In this study, lymph fluid was extracted from PROS tissues of children with PROS who responded to and did not respond to rapamycin treatment. Digital PCR was used to detect the PIK3CA mutation site and abundance. This method can be used for molecular diagnosis and liquid biopsy of PROS, revealing the correlation between mutation site and abundance and disease phenotype, thus showing great promise for clinical application.

[0198] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A digital PCR primer-probe combination for detecting PIK3CA-related overgrowth spectrum (PROS), characterized in that, The digital PCR primer-probe combination is used to detect mutations in PIK3CA-associated Proliferative Spectrum (PROS) pathogenic genes, and the mutations in the PROS pathogenic genes are selected from the following group: p.Glu81Lys, p.Gly118Asp, p.Asp350Gly, p.Cys420Arg, p.Glu542Lys, p.Glu545Lys, p.Glu545Ala, p.Gln546Lys, p.His1047Leu, p.His1047Arg, p.Glu453Lys, p.Asn345Lys, or combinations thereof.

2. The primer-probe combination as described in claim 1, characterized in that, The probe is modified with a fluorescent group; the fluorescent group is selected from the group consisting of: FAM, VIC, HEX, FITC, BODIPY-FL, G-Dye100, FluorX, Cy3, Cy5, Texas Red, or a combination thereof.

3. The primer-probe combination as described in claim 1, characterized in that, The 3' end of the probe is labeled with a quenching group; the quenching group is selected from the following group: DABCYL, TAMRA, BHQ1, BHQ2, BHQ3, MGB, BBQ-650, TQ1-TQ6, QSY7carboxylic acid, TQ7, eclipse, with MGB being preferred, to increase the Tm value and reduce the fluorescence background.

4. A reagent for detecting PIK3CA-related overgrowth spectrum (PROS), characterized in that, The reagents are selected from the following group: (a) A primer-probe combination for detecting the p.Glu81Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 1-3 and the probe sequence shown in SEQ ID NO: 4, wherein, The primers shown in SEQ ID NO: 1 and SEQ ID NO: 3 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein at position 81, which is Glu. The primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the 81st position mutated to Lys; The probe sequence shown in SEQ ID NO: 4 is a common probe sequence, and the probe is preferably an MGB probe; (b) A primer-probe combination for detecting the p.Gly118Asp mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 5-7 and the probe sequence shown in SEQ ID NO: 8, wherein, The primers shown in SEQ ID NO: 5 and SEQ ID NO: 7 are used to amplify the sequence containing the PIK3CA protein amino acid sequence at position 118, which is Gly. The primers shown in SEQ ID NO: 6 and SEQ ID NO: 7 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with the mutation at position 118 to Asp; The probe sequence shown in SEQ ID NO: 8 is a common probe sequence, and the probe is preferably an MGB probe; (c) A primer-probe combination for detecting the p.Asp350Gly mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 9-11 and the probe sequence shown in SEQ ID NO: 12, wherein, The primers shown in SEQ ID NO: 9 and SEQ ID NO: 11 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with Asp at position 350. The primers shown in SEQ ID NO: 10 and SEQ ID NO: 11 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with a mutation at position 350 to Gly. The probe sequence shown in SEQ ID NO: 12 is a common probe sequence, and the probe is preferably an MGB probe; (d) A primer-probe combination for detecting the p.Cys420Arg mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 13-15 and the probe sequence shown in SEQ ID NO: 16, wherein, The primers shown in SEQ ID NO: 13 and SEQ ID NO: 15 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with Cys at position 420. The primers shown in SEQ ID NO: 14 and SEQ ID NO: 15 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with a mutation at position 420 to Arg. The probe sequence shown in SEQ ID NO: 16 is a common probe sequence, and the probe is preferably an MGB probe; (e) A primer-probe combination for detecting the p.Glu542Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 17-19 and the probe sequence shown in SEQ ID NO: 20, wherein, The primers shown in SEQ ID NO: 17 and SEQ ID NO: 19 are used to amplify the sequence containing Glu at position 542 of the PIK3CA protein amino acid sequence; The primers shown in SEQ ID NO: 18 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 542 to Lys; The probe sequence shown in SEQ ID NO: 20 is a common probe sequence, and the probe is preferably an MGB probe; (f) A primer-probe combination for detecting the p.Glu545Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 19, 21 and 22 and the probe sequence shown in SEQ ID NO: 20, wherein, The primers shown in SEQ ID NO: 21 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein at position 545, which is Glu. The primers shown in SEQ ID NO: 22 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 545 to Lys; The probe sequence shown in SEQ ID NO: 20 is a common probe sequence, and the probe is preferably an MGB probe; (g) A primer-probe combination for detecting the p.Glu545Ala mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 19, 23 and 24 and the probe sequence shown in SEQ ID NO: 20, wherein, The primers shown in SEQ ID NO: 23 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein at position 545, which is Glu. The primers shown in SEQ ID NO: 24 and SEQ ID NO: 19 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the 545th position mutated to Ala. The probe sequence shown in SEQ ID NO: 20 is a common probe sequence, and the probe is preferably an MGB probe; (h) A primer-probe combination for detecting the p.Gln546Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 25-27 and the probe sequence shown in SEQ ID NO: 28, wherein, The primers shown in SEQ ID NO: 25 and SEQ ID NO: 27 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with Gln at position 546. The primers shown in SEQ ID NO: 26 and SEQ ID NO: 27 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 546 to Lys; The probe sequence shown in SEQ ID NO: 28 is a common probe sequence, and the probe is preferably an MGB probe; (i) a primer-probe combination for detecting the p.His1047Leu mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 29-31 and the probe sequence shown in SEQ ID NO: 32, wherein, The primers shown in SEQ ID NO: 29 and SEQ ID NO: 31 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with His at position 1047. The primers shown in SEQ ID NO: 30 and SEQ ID NO: 31 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 1047 to Leu. The probe sequence shown in SEQ ID NO: 32 is a common probe sequence, and the probe is preferably an MGB probe; (j) A primer-probe combination for detecting the p.His1047Arg mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 29, 31 and 33 and the probe sequence shown in SEQ ID NO: 32, wherein, The primers shown in SEQ ID NO: 29 and SEQ ID NO: 31 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with His at position 1047. The primers shown in SEQ ID NO: 33 and SEQ ID NO: 31 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 1047 to Arg; The probe sequence shown in SEQ ID NO: 32 is a common probe sequence, and the probe is preferably an MGB probe; (k) A primer-probe combination for detecting the p.Glu453Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 34-36 and the probe sequence shown in SEQ ID NO: 37, wherein, The primers shown in SEQ ID NO: 34 and SEQ ID NO: 36 are used to amplify the sequence containing Glu at position 453 of the PIK3CA protein amino acid sequence; The primers shown in SEQ ID NO: 35 and SEQ ID NO: 36 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 453 to Lys; The probe sequence shown in SEQ ID NO: 37 is a common probe sequence, and the probe is preferably an MGB probe; (l) a primer-probe combination for detecting the p.Asn345Lys mutation, the primer-probe combination comprising the primers shown in SEQ ID NO: 38-40 and the probe sequence shown in SEQ ID NO: 41, wherein, The primers shown in SEQ ID NO: 38 and SEQ ID NO: 40 are used to amplify the sequence containing the PIK3CA protein amino acid sequence with the 345th position being Asn; The primers shown in SEQ ID NO: 39 and SEQ ID NO: 40 are used to amplify the sequence containing the amino acid sequence of PIK3CA protein with the mutation at position 345 to Lys; The probe sequence shown in SEQ ID NO: 41 is a common probe sequence, and the probe is preferably an MGB probe; (m) Any two or more combinations of (a)-(l) above.

5. A kit for detecting PIK3CA-related overgrowth profiles (PROS), characterized in that, The kit comprises the primer-probe combination as described in any one of claims 1-3 or the reagent as described in claim 4.

6. The reagent kit as described in claim 5, characterized in that, The kit includes an instruction manual, which states: If a hotspot mutation of a PROS pathogenic gene selected from the following groups is detected, it indicates that the patient belongs to the PIK3CA-associated excessive growth spectrum (PROS): p.Glu81Lys, p.Gly118Asp, p.Asp350Gly, p.Cys420Arg, p.Glu542Lys, p.Glu545Lys, p.Glu545Ala, p.Gln546Lys, p.His1047Leu, p.His1047Arg, p.Glu453Lys, p.Asn345Lys, or a combination thereof.

7. Use of a primer-probe combination as described in any one of claims 1-3, a reagent as described in claim 4, or a kit as described in claim 5, for preparing a diagnostic product for predicting the efficacy of a drug for treating PROS in a subject.

8. The use as described in claim 7, characterized in that, The diagnostic product described is for testing lymph fluid samples.

9. A method for detecting whether a sample to be tested contains a gene mutation, comprising the following steps: (S1) A PCR reaction system is provided, wherein the PCR reaction system contains a test sample as a template and a primer-probe combination as described in claim 1 for amplification; (S2) Perform a PCR reaction on the PCR reaction system described in step (S1) to obtain the amplification product; (S3) Analyze the amplification products generated in step (S2) to obtain the analysis results of whether the sample to be tested contains gene mutations.

10. The method as described in claim 9, characterized in that, The analytical results are qualitative or quantitative, and the quantitative results are calculated based on the ratio of the number of mutation positive points to the internal reference.

Images