Novel isoxazole compounds as TM4SF5 specific inhibitors and uses thereof

Abstract

The present invention relates to a novel isoxazole compound as a TM4SF5 specific inhibitor and a use thereof, and more specifically, to a novel isoxazole compound, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the same, in which the compound can inhibit the expression, protein-protein binding or signal transduction activity of a TM4SF5 protein, and can inhibit the TM4SF5 protein. Or the immune checkpoint function is inhibited by activating the killing efficacy of T and NK immune cells or regulating the distribution of the T and NK immune cells. Specifically, the isoxazole compound provided by the invention is a TM4SF5 specific isoxazole compound, and can inhibit immune checkpoints of NK cells, so that the isoxazole compound has the advantage of being used as an inhibitor of liver diseases or liver cancer.

Description

Technical Field

[0001] This invention relates to novel isoxazole compounds as specific inhibitors of TM4SF5 and their uses, and more specifically, to novel isoxazole compounds, pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising the compounds, having the efficacy of regulating the expression, protein-protein binding, signal transduction activity, or regulating the activity and distribution of T and NK immune cells of TM4SF5 protein. Background Technology

[0002] Inflammation in the human liver is both a cause and a characteristic feature of many chronic liver diseases. The inflammatory response accompanying chronic hepatocellular damage and death caused by alcohol, viral infections, toxin accumulation, and abnormal metabolic function plays a crucial role in further inducing and aggravating liver diseases. In a normal liver, non-alcoholic fatty liver disease caused by metabolic dysfunction, accompanied by inflammation due to cell damage and death, can further develop into steatohepatitis and can further aggravate into fibrosis and cirrhosis, leading to extracellular matrix accumulation and abnormal cell proliferation. Furthermore, changes in the metabolic-inflammatory environment caused by the interaction between epithelial cells and immune cells, including macrophages, T cells, and NK (natural killer) cells, can inhibit or promote carcinogenesis in fibrotic / cirrhotic liver tissue.

[0003] In a normal liver, chronic liver diseases such as non-alcoholic fatty liver (NAFL), non-alcoholic steatohepatitis (NASH), liver fibrosis, cirrhosis, and liver cancer develop and worsen due to metabolic abnormalities and inflammatory immune system disorders. Non-alcoholic fatty liver disease (NAFLD), affecting approximately 30% of the global population, lacks a definitive diagnostic biomarker and has no treatment options. If it progresses to liver cancer, it represents advanced-stage liver cancer. Furthermore, no treatment drugs for liver cancer have been developed, and immunotherapy drugs with limited efficacy against solid tumors have been shown to potentially have adverse effects in treating liver cancer that develops from NASH (Nature, 2021, Vol 592:450). In recent years, attempts have been made to combine immunotherapy drugs with angiogenesis inhibitors, but their clinical efficacy remains uncertain. Therefore, in the progression of NASH to liver cancer, there is an urgent need to discover new targets that play an important role and develop their inhibitors, and the importance of T or NK cell immune checkpoint inhibitors is becoming increasingly prominent. From this perspective, the development of novel TM4SF5-specific inhibitors is considered extremely important.

[0004] TM4SF5 is a tetraspanin (a family of tetraspanin proteins) whose expression is increased in hepatocytes and macrophages under the influence of various cytokines / chemokines induced by chronic hepatocellular injury. Therefore, the interactions between hepatocytes, macrophages, T cells, and NK cells depend on TM4SF5 expression, which can remodel the liver's inflammatory response and immune environment, further inducing fibrosis / cirrhosis from steatohepatitis, and promoting carcinogenesis by regulating NK cell function. Ultimately, at the stage of carcinogenesis, TM4SF5 expression in hepatocytes can suppress the anti-cancer activity of immune cells, including T cells and NK (natural killer) cells, thereby enabling immune escape and increasing the effective rate of carcinogenesis or cancer incidence.

[0005] Therefore, if small molecule synthetic compounds or antibodies are used as inhibitors to suppress TM4SF5 expression or regulate multiple functions of TM4SF5, the incidence of liver disease / liver cancer can be reduced by abnormal proliferation / survival / migration of hepatocytes, or by regulating and inhibiting the interaction between hepatocytes and immune cells in liver tissue, the progression of fatty liver disease to fibrosis / cirrhosis can be inhibited, and finally, by inhibiting and eliminating the anti-cancer immune escape function of T cells and NK cells, the immune checkpoint inhibition method for liver cancer can be achieved.

[0006] The inventors have confirmed that novel isoxazole compounds can be used as specific inhibitors of TM4SF5, and thus completed this invention. Summary of the Invention

[0007] The technical problem that the invention aims to solve

[0008] The purpose of this invention is to provide a novel isoxazole compound that can inhibit the expression, protein-protein binding, and signal transduction activity of TM4SF5 protein, or regulate the activity and distribution of T cells and NK immune cells to inhibit immune checkpoint function.

[0009] Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of liver diseases, comprising the compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[0010] Another object of the present invention is to provide a pharmaceutical preparation comprising the said pharmaceutical composition.

[0011] Another object of the present invention is to provide a method comprising administering a pharmaceutically effective amount of the above-mentioned compound to a sample to inhibit the expression, protein-protein binding, signal transduction activity, or activation of the killing efficacy or regulation of the distribution of T cells and NK immune cells in the sample or cells, thereby inhibiting immune checkpoint function.

[0012] Another object of the present invention is to provide the use of the said compound or a pharmaceutically acceptable salt thereof for the prevention or treatment of liver diseases.

[0013] means for solving problems

[0014] This invention provides a compound selected from compounds represented by the following chemical formula 1, their pharmaceutically acceptable salts, hydrates, and solvates:

[0015] [Chemical Formula 1]

[0016]

[0017] In the chemical formula 1,

[0018] X1 is either O or N;

[0019] X2 is either C or N;

[0020] X3 is either C or N;

[0021] It can be a single bond or a double bond;

[0022] R1 is hydrogen, RaNH-, or RaO-;

[0023] Ra is hydrogen, C1-5 alkyl, RbSO2- or RbCO-;

[0024] Each Rb is independently hydrogen, C1-5 alkyl, C2-5 alkenyl, or unsubstituted or C6-10 aryl with C1-5 alkyl substituted.

[0025] R2 is hydrogen, halogen, C1-5 alkyl, halo-C1-6 alkyl, RcNH- or RcO-;

[0026] Rc is hydrogen, C1-5 alkyl, RdSO2- or RdCO-;

[0027] Each Rd is independently hydrogen, C1-5 alkyl, or unsubstituted or C6-10 aryl with C1-5 alkyl substituted;

[0028] n is an integer from 1 to 2.

[0029] (When X1 and X2 in the above chemical formula 1 are N, the compound shown in chemical formula 1 is represented as a compound of chemical formula 3.)

[0030] Furthermore, the present invention provides a pharmaceutical composition for the prevention or treatment of liver diseases, comprising the compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[0031] Furthermore, the present invention provides a pharmaceutical composition for the prevention or treatment of liver diseases, comprising the compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[0032] Furthermore, the present invention provides a method comprising administering a pharmaceutically effective amount of the compound to a sample to inhibit the expression of TM4SF5 protein, protein-protein binding, or signal transduction activity in the sample or cells, or to activate the killing efficacy of T cells and NK immune cells or regulate their distribution, thereby inhibiting immune checkpoint function.

[0033] Furthermore, the present invention provides the use of the said compound or a pharmaceutically acceptable salt thereof for the prevention or treatment of liver diseases.

[0034] The effects of the invention

[0035] In this invention, the isoxazole compound represented by chemical formula 1 can be effectively utilized as a therapeutic agent for treating liver diseases due to its excellent inhibitory effects on the expression of TM4SF5 protein, protein-protein binding, and signal transduction activity, or on the activity and distribution of T cells and NK immune cells. Attached Figure Description

[0036] Figure 1 The synthesis method of Example 32, a representative compound of isoxazole, is shown.

[0037] Figure 2a and Figure 2b The results show the inhibition of phosphorylation of TM4SF5 expression-dependent signal transduction factors by the isoxazole compound.

[0038] Figures 3a to 3c The results show the inhibitory effects of isoxazole on TM4SF5 expression in two-dimensional and three-dimensional cell growth / proliferation in a dependent manner.

[0039] Figure 4 The results show the effects of isoxazole treatment on the inhibition of TM4SF5 binding to multiple cell membrane receptors.

[0040] Figures 5a to 5c The results show that isoxazole compounds induce phosphorylation of TM4SF5 expression-dependent signal transduction factors and inhibit the proliferation of three-dimensional spheres.

[0041] Figure 6The results show the effect of isoxazole treatment on the inhibition of TM4SF5 binding to various cell membrane receptors and signaling factors.

[0042] Figure 7 The results show that isoxazole compounds inhibit TM4SF5 expression-dependent cell migration.

[0043] Figures 8a to 8i The results show that isoxazole compounds induce NASH-dependent inhibition of TM4SF5 expression.

[0044] Figures 9a to 9c The results show the inhibition of phosphorylation of TM4SF5 expression-dependent signal transduction factors by the isoxazole compound.

[0045] Figures 10a to 10c The results show the inhibitory effect of isoxazole on TM4SF5 expression-dependent three-dimensional cell growth / proliferation.

[0046] Figures 11a to 11e The study demonstrates the inhibitory effect of isoxazole on TM4SF5-dependent xenograft hepatocellular carcinoma formation.

[0047] Figures 12a to 12d The results show that isoxazole compounds induce phosphorylation of TM4SF5 expression-dependent signal transduction factors and inhibit three-dimensional cell growth / proliferation.

[0048] Figures 13a to 13j The results show that isoxazole compounds reduce the expression of TM4SF5-dependent NK cell natural killer-related ligands and inhibit their binding to TM4SF5.

[0049] Figures 14a to 14d The results demonstrate the importance of TM4SF5-dependent reduction in Slamf7 expression associated with NK cell natural killer function and the role of N-glycosylation of both proteins in binding to TM4SF5.

[0050] Figures 15a to 15h The results show that isoxazole compounds reduce the expression, degrade, and regulate the intracellular localization of ligands related to natural killer function in TM4SF5-dependent NK cells.

[0051] Figures 16a to 16g This demonstrates the reduced natural killer function of NK cells induced by TM4SF5 expression.

[0052] Figures 17a to 17dThis study demonstrates how isoxazole compounds induce PD-L1 expression and inhibition of immune escape from T and NK cells in a TM4SF5-dependent manner.

[0053] Figures 18a to 18b The results show that isoxazole compounds inhibit TM4SF5-dependent PD-1 expression and T cell activity.

[0054] Figures 19a to 19e The results show the binding of isoxazole compounds to TM4SF5 and the inhibition of cholesterol binding ability of TM4SF5 and PD-L1 after isoxazole treatment.

[0055] Figures 20a to 20d The results show the inhibition of hepatocellular carcinoma formation and hepatocellular carcinoma marker expression by isoxazole compounds in a liver-orthotopic xenograft model using TM4SF5-expressing cell lines.

[0056] Figures 21a to 21e The results show the inhibition of hepatocellular carcinogenesis and hepatocellular carcinoma marker expression by isoxazole compounds in a PDX model expressing TM4SF5.

[0057] Figures 22a to 22e This study demonstrates the effects of isoxazole on hepatocellular carcinogenesis, regulation of NK cell natural killer ligand expression, and confirmation of NK cell infiltration within tumor tissue in a liver-orthotopic xenograft model using TM4SF5-expressing cell lines.

[0058] Figures 23a to 23c This study demonstrates the effects of isoxazole on the inhibition of hepatocellular carcinogenesis and the regulation of ligand expression related to NK cell natural killer function in TM4SF5 gene-modified animals after DEN treatment.

[0059] Figures 24a to 24d This study demonstrates the effects of isoxazole compounds on the inhibition of hepatocellular carcinogenesis and the regulation of ligand expression related to NK cell natural killer function in a subcutaneous xenograft hepatocellular carcinoma model of severe immunodeficiency (NOD-SCID mouse). Detailed Implementation

[0060] The inventors have confirmed in TM4SF5 expression-dependent cell line models and animal models that the enhanced signal transduction activity and membrane receptor binding function due to TM4SF5 expression, TM4SF5 expression-dependent cell survival / proliferation and migration in two-dimensional and three-dimensional environments, and the pathogenesis of liver diseases including NASH-fibrosis and hepatocellular carcinoma are inhibited (particularly, in the two compounds ST-5-001 and ST-5-002, the effects are shown at concentrations below 1 μM or 2.5 mpk). In particular, the inventors have confirmed and reported that TM4SF5 can reduce the killing function of NK immune cells (Korean Patent Application No. 10-2021-0171614 and PCT Application No. PCT / KR2021 / 018197), and the novel isoxazole compounds of the present invention exhibit a mechanism of action capable of inhibiting TM4SF5-mediated NK cell function decline. Furthermore, the PD-L1 immune checkpoint, which induces immune escape during hepatocellular carcinogenesis, is expressed and functions not only in NK cells but also in T cells. Therefore, this can be explained by the novel isoxazole compound of this invention exhibiting a mechanism of action capable of inhibiting TM4SF5-mediated T cell function decline. Further, TM4SF5 expressed in hepatocellular carcinoma cells can bind to ligands such as SLAMF7 that induce NK cell activity, inducing its localization and degradation to lysosomes, thereby inhibiting NK cell activity and reducing natural killer efficacy. Isoxazole, acting as a specific inhibitor of TM4SF5, can inhibit this degradation function, thereby enhancing NK cell activity and natural killer efficacy. Moreover, isoxazole can reverse the phenomenon of TM4SF5 increasing PD-L1 expression and stabilizing it through direct binding, as well as the phenomenon of inducing PD-1 expression in T cells, thereby inhibiting T cell activity and cancer cell killing function.

[0061] Therefore, this invention belongs to the following invention: a novel isoxazole compound that acts as a specific inhibitor of TM4SF5 can inhibit the onset of liver diseases and liver cancer, and can interrupt the continuous aggravation between the diseases. Based on its efficacy as an immune checkpoint inhibitor of T cells and NK cells that are abundant in the liver, it has application value as an anti-liver cancer drug.

[0062] In this invention, the term "TM4SF5 protein" refers to Transmembrane 4 L6 family member 5 (also known as Four Transmembrane L6 Superfamily member 5 or "L6H"), belonging to the four-transmembrane receptor group—tetraspanin, tetraspan, or Transmembrane 4 Super Family (TM4SF); the TM4SF (transmembrane 4 superfamily) protein consists of four similar structures that cross the cell membrane four times. Biochemically, they share a structure containing four hydrophobic regions presumed to be transmembrane domains; in particular, the biochemical function of the Four-Transmembrane L6 Superfamily (including L6, TM4SF5, L6D, and IL-TMP) containing TM4SF5 within the tetraspanin group has not been fully elucidated.

[0063] The TM4SF5 is a non-water-soluble protein with four transmembrane regions that cross the cell membrane, two extracellular loop structures, and two tertiary structures in the cytoplasm. It is known to be highly expressed in various cancer cells, including pancreatic cancer, lung cancer, gastric cancer, prostate cancer, breast cancer, esophageal cancer, rectal cancer, and liver cancer (Muller-Pillasch, F., et al., Gene208:25, 1998; Pascual-Le Tallec, L. et al., J Clin Endocrinol Metab 87:501, 2002).

[0064] In this invention, the term "liver disease" refers to all diseases that cause a decline in liver function, such as those caused by viruses (e.g., type A, B, C, D, or E viruses), alcohol, aflatoxin, medications (e.g., anti-tuberculosis drugs, aspirin, antibiotics, anesthetics, antihypertensive drugs, oral contraceptives, etc.), congenital metabolic abnormalities, etc. Specific examples of liver diseases include chronic liver injury, non-alcoholic or alcoholic liver disease or fatty liver, hepatitis, liver fibrosis, cirrhosis, and liver cancer. The liver diseases are preferably liver cancer, fatty liver, hepatitis, liver fibrosis, and cirrhosis, but are not limited thereto.

[0065] In this invention, the term "halogen" refers to fluorine, chlorine, bromine or iodine unless otherwise specified, preferably fluorine, but not limited thereto.

[0066] In this invention, the term "alkyl" means, unless otherwise specified, a saturated, straight-chain or branched monovalent hydrocarbon group.

[0067] In this invention, the term "alkenyl" unless otherwise specified refers to a monovalent hydrocarbon group containing at least one carbon-carbon double bond, each double bond having an E- or Z-stereoconfiguration.

[0068] These alkyl and alkenyl groups can be linear (i.e., straight-chain structure) or branched. According to their respective definitions, the number of carbon atoms in an alkyl group can be 1, 2, 3, 4, 5, or 6, or 1, 2, 3, or 4. Examples of alkyl groups include methyl, ethyl, propyl (including n-propyl and isopropyl), butyl (including n-butyl, sec-butyl, isobutyl, and tert-butyl), pentyl (including n-pentyl, 1-methylbutyl, isopentyl, neopentyl, and tert-pentyl), and hexyl (including n-hexyl, 3,3-dimethylbutyl, and isohexyl). The double bond in the alkenyl group can be in any position.

[0069] In this invention, the term "aryl" means, unless otherwise specified, a substituted or unsubstituted aromatic group, such as phenyl, biphenyl, naphthyl, tolyl, anthracene, or all possible isomers thereof, and is not limited thereto.

[0070] In this invention, the numerical range referred to by the term "to" refers to the range that includes the values ​​recorded before and after "to" as the lower limit and upper limit, respectively.

[0071] According to one aspect, the compound represented by Formula 1 can exist as a solvate. The term "solvate" can include molecular complexes formed by the compound and one or more pharmaceutically acceptable solvent molecules (e.g., ethanol or water). Complexes in which the solvent molecule is water are also referred to as "hydrates".

[0072] According to the aforementioned aspect, the compound represented by Chemical Formula 1 and its solvates can exist in the form of pharmaceutically acceptable salts.

[0073] In this invention, "pharmaceutically acceptable salt" refers to a salt with low toxicity to humans and that does not adversely affect the biological activity and physicochemical properties of the parent compound. Pharmaceutically acceptable salts may include, but are not limited to, acid addition salts formed by pharmaceutically acceptable free acids and basic compounds of Formula 1, alkali metal salts (such as sodium salts) and alkaline earth metal salts (such as calcium salts), organic base addition salts formed by organic bases and carboxylic acid structures of Formula 1, and amino acid addition salts.

[0074] According to the present invention, the preferred salt form of the compound may include a salt formed with an inorganic acid or an organic acid. The inorganic acid may be hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, perchloric acid, bromic acid, etc. Furthermore, the organic acid may be acetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, fumaric acid, maleic acid, malonic acid, phthalic acid, succinic acid, lactic acid, citric acid, gluconic acid, tartaric acid, salicylic acid, malic acid, oxalic acid, benzoic acid, epanic acid, aspartic acid, glutamic acid, etc. Organic bases that can be used to prepare organic base addition salts include tris(hydroxymethyl)methylamine, dicyclohexylamine, etc. In addition to the inorganic acids, organic acids, organic bases, and amino acids exemplified above, other acids or bases may be used, as will be apparent to those skilled in the art.

[0075] The salt can be prepared by conventional methods. For example, it can be prepared by dissolving the compound represented by chemical formula 1 in a water-miscible solvent such as methanol, ethanol, acetone, or 1,4-dioxane, adding a free acid or a free base, and then crystallizing.

[0076] The details of the prevention or treatment methods can be directly applied to the above description of the pharmaceutical composition described in one aspect of the present invention.

[0077] In this invention, the term "treatment" is used as a concept encompassing the treatment, improvement, amelioration, or management of a disease.

[0078] In this invention, the term "prevention" refers to the prevention of disease, such as the prevention of said disease, pathological state, or disorder in an individual who may have a predisposition to disease, pathological state, or disorder but has not yet experienced or exhibited the pathology or signs of disease.

[0079] In this invention, the term "administration" means providing an individual with a predetermined amount of the composition of this invention by any suitable method.

[0080] In this invention, the term "individual" or "patient" refers to any animal including mammals, such as nematodes, fruit flies, zebrafish, mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, or primates and humans.

[0081] The present invention will now be described in more detail.

[0082] According to one embodiment of the present invention, the novel isoxazole compound can be represented by the following chemical formula 1:

[0083] [Chemical Formula 1]

[0084] A compound selected from those represented by Chemical Formula 1 below, or a pharmaceutically acceptable salt, hydrate, or solvate thereof:

[0085]

[0086] In the chemical formula 1,

[0087] X1 is either O or N;

[0088] X2 is either C or N;

[0089] X3 is either C or N;

[0090] It can be a single bond or a double bond;

[0091] R1 is hydrogen, RaNH- or RaO-, preferably amine, acetamide, methanesulfonamide, p-toluenesulfonamide, 4-methylbenzamide, acrylamide, methoxy or hydroxyl;

[0092] Ra is hydrogen, C1-5 alkyl, RbSO2- or RbCO-;

[0093] Each Rb is independently hydrogen, C1-5 alkyl, C2-5 alkenyl, or unsubstituted or C6-10 aryl with C1-5 alkyl substituted.

[0094] R2 is hydrogen, halogen, C1-5 alkyl, halogenated C1-6 alkyl, RcNH- or RcO-, preferably methoxy, propoxy, tert-butyl, fluorine, trifluoromethyl, hydroxyl, p-toluenesulfonate, acetamide or 4-methylbenzamide;

[0095] Rc is hydrogen, C1-5 alkyl, RdSO2- or RdCO-;

[0096] Each Rd is independently hydrogen, C1-5 alkyl, or unsubstituted or C6-10 aryl with C1-5 alkyl substituted;

[0097] n is an integer from 1 to 2.

[0098] (When X1 and X2 in the above chemical formula 1 are N, the compound shown in chemical formula 1 is represented as a compound of chemical formula 3.)

[0099] According to another embodiment of the present invention, the compound represented by chemical formula 1 may be represented as any of the following compounds of chemical formulas 2 to 4.

[0100] [Chemical Formula 2]

[0101]

[0102] [Chemical Formula 3]

[0103]

[0104] [Chemical Formula 4]

[0105]

[0106] In the chemical formulas 2 to 4, X1, X3, R1, Ra, Rb, R2, Rc, Rd, and n are as defined in claim 1.

[0107] Furthermore, according to the present invention, preferred examples of the compound represented by chemical formula 1 are as follows, but are not limited thereto:

[0108] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline;

[0109] 4-(5-(3-methoxyphenyl)isoxazole-3-yl)aniline;

[0110] 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline;

[0111] 4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)aniline;

[0112] 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline;

[0113] 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline;

[0114] 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline;

[0115] 4-(5-(4-propoxyphenyl)isoxazole-3-yl)aniline;

[0116] 3-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline;

[0117] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0118] N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)methanesulfonamide;

[0119] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide;

[0120] N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide;

[0121] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide;

[0122] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide;

[0123] N-(4-(5-(3-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide;

[0124] N-(4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0125] N-(4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)phenyl)acetamide;

[0126] N-(4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0127] N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazole-3-yl)phenyl)acetamide;

[0128] N-(4-(5-(4-fluorophenyl)isoxazole-3-yl)phenyl)acetamide;

[0129] N-(4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)acetamide;

[0130] N-(4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)acetamide;

[0131] N-(3-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide;

[0132] N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide;

[0133] N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0134] 4-(3-(4-acetamidophenyl)isoxazole-5-yl)phenyl-4-methylbenzenesulfonate;

[0135] N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide;

[0136] N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide;

[0137] N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide;

[0138] N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)acetamide;

[0139] N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide;

[0140] N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide;

[0141] N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide;

[0142] N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide;

[0143] N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; and

[0144] N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazole-3-yl)phenyl)acetamide.

[0145] Furthermore, preferred examples of the compounds of Formula 1 described in this invention are set forth in Table 1 below.

[0146] Table 1

[0147]

[0148]

[0149]

[0150]

[0151]

[0152] According to another embodiment of the present invention, a pharmaceutical composition for the prevention or treatment of liver diseases is provided, comprising the compound represented by chemical formula 1 and its pharmaceutically acceptable salt as active ingredients.

[0153] The liver disease can be liver cancer, chronic liver injury, non-alcoholic or alcoholic liver disease or steatosis, hepatitis, liver fibrosis or cirrhosis.

[0154] The pharmaceutical composition can be used to treat liver diseases by inhibiting the expression, protein-protein binding, or signal transduction activity of TM4SF5 protein, or by activating the killing efficacy of T and NK immune cells or regulating their distribution to inhibit immune checkpoint function.

[0155] According to another embodiment of the present invention, a pharmaceutical preparation comprising the said pharmaceutical composition is provided.

[0156] The pharmaceutical preparations of the present invention can be administered orally in various forms such as patches, ointments, inhalers, nasal drops, tablets, pills, powders, capsules, syrups or emulsions, or administered orally in forms such as injections, intramuscular, intravenous or subcutaneous administration.

[0157] In addition to the active ingredient, the pharmaceutical preparation may also contain conventional, non-toxic, pharmaceutically acceptable additives, such as at least one selected from the group consisting of carrier, adjuvant, and excipient, and be formulated according to conventional methods.

[0158] The excipients that can be used in the pharmaceutical formulations of this invention include, but are not limited to, sweeteners, binders, solvents, solubilizers, wetting agents, emulsifiers, isotonic agents, adsorbents, disintegrants, antioxidants, preservatives, lubricants, fillers, and flavorings. For example, as excipients, lactose, glucose, sucrose, mannitol, sorbitol, cellulose, glycine, silicon dioxide, magnesium aluminum silicate, starch, gelatin, tragacanth gum, alginic acid, sodium alginate, methylcellulose, sodium carboxymethyl cellulose, water, ethanol, polyethylene glycol, polyvinylpyrrolidone, sodium chloride, calcium chloride, orange flavoring, strawberry flavoring, and vanilla flavoring.

[0159] When the pharmaceutical formulation of the present invention is in the form of oral administration, the carrier used includes, but is not limited to, cellulose, calcium silicate, corn starch, lactose, sucrose, glucose, calcium phosphate, stearic acid, magnesium stearate, calcium stearate, gelatin, and talc.

[0160] When the pharmaceutical preparation of the present invention is in the form of an injection, the carrier includes, for example, water, physiological saline, glucose aqueous solution, similar sugar aqueous solution, alcohol, ethylene glycol, ether, oil, fatty acid, fatty acid ester and glyceride, etc., but is not limited thereto.

[0161] To use the compounds according to the invention as pharmaceuticals, they are prepared into pharmaceutical formulations containing, in addition to the active ingredient for oral or parenteral administration, a suitable pharmaceutically inert organic or inorganic carrier substance, such as water, gelatin, gum arabic, lactose, starch, vegetable oil, and polyalkylene glycols. The pharmaceutical formulation may be in solid form, such as tablets, sugar-coated tablets, suppositories, or capsules, or in liquid form, such as liquids, suspensions, or emulsions. Furthermore, it may optionally contain excipients, such as preservatives, stabilizers, wetting agents, or emulsifiers; and salts or buffers for altering osmotic pressure.

[0162] For administration outside the intestine, injectable solutions or suspensions are particularly preferred.

[0163] As a carrier system, surfactants such as bile salts or phospholipids of animal or plant origin, or mixtures thereof, as well as liposomes or components thereof, may also be used.

[0164] When used for oral administration, it is particularly suitable for tablets, sugar-coated tablets, or capsules containing talc and / or hydrocarbon carriers or binders, such as lactose, corn starch, or potato starch. Additionally, it can be administered in liquid form, such as fruit juice with added sweeteners.

[0165] According to another embodiment of the present invention, a method is provided comprising administering a pharmaceutically effective amount of the compound represented by Formula 1 to a sample to inhibit the expression, protein-protein binding, or signal transduction activity of TM4SF5 protein in the sample or cells, or to activate the killing efficacy of T and NK immune cells or regulate their distribution, thereby inhibiting immune checkpoint function.

[0166] According to another embodiment of the invention, a method is provided comprising administering a pharmaceutically effective amount of the compound represented by Chemical Formula 1 to a sample to prevent or treat liver disease in the sample. Preferably, the sample refers to an individual or a patient, but is not limited thereto.

[0167] According to another embodiment of the invention, the compound represented by chemical formula 1 or a pharmaceutically acceptable salt thereof is provided for use in the prevention or treatment of liver diseases.

[0168] The present invention will be described in more detail below through the following embodiments and experimental examples. However, these embodiments and experimental examples are only used to help understand the present invention, and the scope of the present invention is not limited thereto in any way. Detailed Implementation

[0169] Example 1: Preparation of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline

[0170] Step 1) Preparation of tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate

[0171]

[0172] tert-butyl(4-formylphenyl)carbamate (3.00 g, 13.56 mmol), sodium acetate (3.34 g, 40.67 mmol), and hydroxylamine hydrochloride (2.83 g, 40.67 mmol) were dissolved in ethanol (50 mL) and stirred at room temperature for 3 hours. After the reaction was complete, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:4), and the resulting solution was concentrated to obtain the target compound in 2.10 g, 66% yield.

[0173] 1HNMR (DMSO-d6, 800MHz) δ10.98 (s, 1H), 9.50 (s, 1H), 8.02 (s, 1H), 7.48-7.45 (m, 4H), 1.47 (s, 9H)

[0174] Step 2) Preparation of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0175]

[0176] The tert-butyl(E)-(4-((hydroxyimino)methyl)phenyl)carbamate (750 mg, 3.17 mmol) prepared in step 1) and 4-ethynyl anisole (286 mg, 2.12 mmol) were dissolved in 1,4-dioxane:water (5:1, 36 mL), and [bis(trifluoroacetoxy)iodide]benzene (1.82 g, 4.24 mmol) was added dropwise. The mixture was then stirred at room temperature for 3 hours. After the reaction was complete, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:3), and the resulting solution was concentrated to give 650 mg of the target compound, with a yield of 82%.

[0177] 1HNMR (DMSO-d6, 800MHz) δ9.62 (s, 1H), 7.84 (d, J=8.8Hz, 2H), 7.79 (d, J=8.7Hz, 2H), 7.61 (d, J=8.4Hz, 2H), 7.37 (s, 1H), 7.12 (d, J=8.8Hz, 2H), 3.84 (s, 3H), 1.49 (s, 9H).

[0178] Step 3) Preparation of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline

[0179]

[0180] The tert-butyl(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate (310 mg, 0.85 mmol) prepared in step 2) was dissolved in dichloromethane (15 mL), and trifluoroacetic acid (0.65 mL, 8.46 mmol) was added dropwise. The mixture was then stirred at room temperature for 3 hours. After the reaction was complete, the solution was concentrated under reduced pressure. The resulting residue was dissolved in dichloromethane, and a saturated aqueous solution of sodium bicarbonate was added dropwise. After extraction three times with dichloromethane, the solution was dried over anhydrous magnesium sulfate and concentrated under reduced pressure. The resulting residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:2), and the resulting solution was concentrated to obtain the target compound in 215 mg, 96% yield.

[0181] 1HNMR (DMSO-d6, 800MHz) δ7.81 (d, J=8.8Hz, 2H), 7.55 (d, J=8.6Hz, 2H), 7.23 ( s, 1H), 7.10 (d, J=8.9Hz, 2H), 6.65 (d, J=8.6Hz, 2H), 5.56 (s, 2H), 3.83 (s, 3H).

[0182] Example 2: Preparation of 4-(5-(3-methoxyphenyl)isoxazole-3-yl)aniline

[0183] Step 1) Preparation of tert-butyl (4-(5-(3-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0184]

[0185] Except that 4-ethynyl anisole in step 2) of Example 1 was replaced with 1-ethynyl-3-methoxybenzene (93 mg, 0.71 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 160 mg and 62% yield.

[0186] 1HNMR (DMSO-d6, 800MHz) δ9.63 (s, 1H), 7.80 (d, J=8.7Hz, 2H), 7.62 (d, J=8.5Hz, 2H), 7.56 (s, 1H), 7.49-7.47 (m, 2H), 7.44-7.43 (m, 1H), 7.11-7.08 (m, 1H), 3.86 (s, 3H), 1.50 (s, 9H)

[0187] Step 2) Preparation of 4-(5-(3-methoxyphenyl)isoxazole-3-yl)aniline

[0188]

[0189] Except that tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 was replaced with tert-butyl(4-(5-(3-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate (100 mg, 0.27 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 64 mg and 88% yield.

[0190] 1HNMR (DMSO-d6, 800MHz) δ7.57 (d, J=8.5Hz, 2H), 7.48-7.44 (m, 2H), 7.42 (s, 1H), 7.41-7.4 0 (m, 1H), 7.08 (ddd, J=7.6, 2.5, 1.9Hz, 1H), 6.65 (d, J=8.5Hz, 2H), 5.57 (s, 2H), 3.85 (s, 3H)

[0191] Example 3: Preparation of 4-(5-(2-methoxyphenyl)isoxazole-3-yl)aniline

[0192] Step 1) Preparation of tert-butyl (4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0193]

[0194] Except for replacing 4-ethynyl anisole in step 2) of Example 1 with 1-ethynyl-2-methoxybenzene (93 mg, 0.71 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 185 mg and 72% yield.

[0195] 1HNMR (DMSO-d6, 800MHz) δ9.61 (dd, J=7.7, 1.6Hz, 1H), 7.88 (dd, J=7.7, 1.6Hz, 1H), 7.84 (d, J=8.7Hz, 2H), 7.61 (d, J=8.4Hz, 2H), 7.53-7.51 (m, 1H), 7.31 (s, 1H), 7.25 (d, J=8.3Hz, 1H), 7.14-7.12 (m, 1H), 3.99 (s, 3H), 1.50 (s, 9H).

[0196] Step 2) Preparation of 4-(5-(2-methoxyphenyl)isoxazole-3-yl)aniline

[0197]

[0198] Except for replacing tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 with tert-butyl(4-(5-(2-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate (30 mg, 0.08 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 19 mg and 87% yield.

[0199] 1HNMR (DMSO-d6, 800MHz) δ7.86 (dd, J=7.7, 1.6Hz, 1H), 7.59 (d, J=8.5Hz, 2H), 7.50 (ddd, J=8.5, 7.2, 1.5Hz, 1H), 7.23 (d, J=8.1Hz, 1H), 7.18 (s, 1H), 7.12 (td, J=7.5, 0.8Hz, 1H), 6.65 (d, J=8.6Hz, 2H), 5.55 (s, 2H), 3.98 (s, 3H)

[0200] Example 4: Preparation of 4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)aniline

[0201] Step 1) Preparation of tert-butyl (4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)phenyl)carbamate

[0202]

[0203] Except that 4-ethynyl anisole in step 2) of Example 1 was replaced with 4-ethynyl-1,2-dimethoxybenzene (115 mg, 0.71 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 120 mg and 43% yield.

[0204] 1HNMR (DMSO-d6, 800MHz) δ9.62 (s, 1H), 7.79 (d, J=8.6Hz, 2H), 7.61 (d, J=8.5Hz, 2H), 7.47 (dd, J=8.3, 1.9Hz , 1H), 7.43 (dd, J=8.3, 1.9Hz, 1H), 7.43 (s, 1H), 7.13 (d, J=8.4Hz, 1H), 3.87 (s, 3H), 3.83 (s, 3H), 1.50 (s, 9H)

[0205] Step 2) Preparation of 4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)aniline

[0206]

[0207] Except that tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 was replaced with tert-butyl(4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)phenyl)carbamate (100 mg, 0.25 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 68 mg and 91% yield.

[0208] 1HNMR (DMSO-d6, 800MHz) δ7.55 (d, J=8.5Hz, 2H), 7.44 (dd, J=8.3, 2.0Hz, 1H), 7.41 (d, J=2.0Hz, 1H ), 7.29 (s, 1H), 7.11 (d, J=8.4Hz, 1H), 6.65 (d, J=8.6Hz, 2H), 5.55 (s, 2H), 3.86 (s, 3H), 3.83 (s, 3H)

[0209] Example 5: Preparation of 4-(5-(4-(tert-butyl)phenyl)isoxazole-3-yl)aniline

[0210] Step 1) Preparation of tert-butyl (4-(5-(4-(tert-butyl)phenyl)isoxazole-3-yl)phenyl)carbamate

[0211]

[0212] Except for replacing 4-ethynyl anisole in step 2) of Example 1 with 1-(tert-butyl)-4-ethynylbenzene (112 mg, 0.71 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 194 mg and 70% yield.

[0213] 1HNMR (DMSO-d6, 800MHz) δ9.63 (s, 1H), 7.83 (d, J=8.4Hz, 2H), 7.81 (d, J=8.7Hz, 2H), 7.61 (d, J=8.4Hz, 2H), 7.59 (d, J=8.5Hz, 2H), 7.46 (s, 1H), 1.50 (s, 9H), 1.32 (s, 9H).

[0214] Step 2) Preparation of 4-(5-(4-(tert-butyl)phenyl)isoxazole-3-yl)aniline

[0215]

[0216] Except that tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 was replaced with tert-butyl(4-(5-(4-(tert-butyl)phenyl)isoxazole-3-yl)phenyl)carbamate (90 mg, 0.23 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 61 mg and 91% yield.

[0217] 1HNMR (DMSO-d6, 800MHz) δ7.80 (d, J=8.4Hz, 2H), 7.57 (d, J=8.4Hz, 4H), 7.32 (s, 1H), 6.65 (d, J=8.5Hz, 2H), 5.56 (s, 2H), 1.32 (s, 9H).

[0218] Example 6: Preparation of 4-(5-(4-fluorophenyl)isoxazole-3-yl)aniline

[0219] Step 1) Preparation of tert-butyl (4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)carbamate

[0220]

[0221] Except that 4-ethynyl anisole in step 2) of Example 1 was replaced with 1-ethynyl-4-fluorobenzene (85 mg, 0.71 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 210 mg and 84% yield.

[0222] 1HNMR (DMSO-d6, 800MHz) δ9.64 (s, 1H), 7.96 (dd, J=8.7, 5.3Hz, 2H), 7.80 (d, J=8. 7Hz, 2H), 7.62 (d, J=8.4Hz, 2H), 7.52 (s, 1H), 7.43 (t, J=8.8Hz, 2H), 1.50 (s, 9H).

[0223] Step 2) Preparation of 4-(5-(4-fluorophenyl)isoxazole-3-yl)aniline

[0224]

[0225] Except that tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 was replaced with tert-butyl(4-(5-(4-fluorophenyl)isoxazole-3-yl)phenyl)carbamate (30 mg, 0.08 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 20 mg and 93% yield.

[0226] 1HNMR (DMSO-d6, 800MHz) δ7.93 (dd, J=8.8, 5.4Hz, 2H), 7.56 (d, J=8.5Hz, 2H), 7.41 (t, J=8.8Hz, 2H), 7.38 (s, 1H), 6.65 (d, J=8.5Hz, 2H), 5.58 (s, 2H).

[0227] Example 7: Preparation of 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline

[0228] Step 1) Preparation of tert-butyl (4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)carbamate

[0229]

[0230] Except for replacing 4-ethynyl anisole in step 2) of Example 1 with 1-ethynyl-4-(trifluoromethyl)benzene (96 mg, 0.56 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 195 mg and 85% yield.

[0231] 1HNMR (DMSO-d6, 800MHz) δ9.65 (s, 1H), 8.13 (d, J=8.2Hz, 2H), 7.95 (d, J=8.3H z, 2H), 7.82 (d, J=8.6Hz, 2H), 7.75 (s, 1H), 7.63 (d, J=8.4Hz, 2H), 1.50 (s, 9H).

[0232] Step 2) Preparation of 4-(5-(4-(trifluoromethyl)phenyl)isoxazole-3-yl)aniline

[0233]

[0234] Except that tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 was replaced with tert-butyl(4-(5-(4-(trifluoromethyl)phenyl)isoxazole-3-yl)phenyl)carbamate (80 mg, 0.20 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 52 mg and 86% yield.

[0235] 1HNMR (DMSO-d6, 800MHz) δ8.10 (d, J=8.2Hz, 2H), 7.93 (d, J=8.3Hz, 2H), 7.61 (s, 1H), 7.59 (d, J=8.5Hz, 2H), 6.66 (d, J=8.6Hz, 2H), 5.61 (s, 2H).

[0236] Example 8: Preparation of 4-(5-(4-propoxyphenyl)isoxazole-3-yl)aniline

[0237] Step 1) Preparation of tert-butyl (4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0238]

[0239] Except that 4-ethynyl anisole in step 2) of Example 1 was replaced with 1-ethynyl-4-propoxybenzene (114 mg, 0.71 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 220 mg and 79% yield.

[0240] 1H NMR (DMSO-d6, 800MHz) δ9.62 (s, 1H), 7.82 (d, J=8.7Hz, 2H), 7.79 (d, J=8.7Hz, 2H), 7.61 (d, J=8.4Hz, 2 H), 7.36 (s, 1H), 7.10 (d, J=8.8Hz, 2H), 4.01 (t, J=6.4Hz, 2H), 1.78-1.74 (m, 2H), 1.00 (t, J=7.3Hz, 3H)

[0241] Step 2) Preparation of 4-(5-(4-propoxyphenyl)isoxazole-3-yl)aniline

[0242]

[0243] Except that tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 was replaced with tert-butyl(4-(5-(4-propoxyphenyl)isoxazole-3-yl)phenyl)carbamate (30 mg, 0.08 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 19 mg and 85% yield.

[0244] 1H NMR (DMSO-d6, 800MHz) δ7.79 (d, J=8.8Hz, 2H), 7.55 (d, J=8.5Hz, 2H), 7.22 (s, 1H), 7.09 (d, J=8.8Hz, 2H ), 6.64 (d, J=8.5Hz, 2H), 5.55 (s, 2H), 4.01 (t, J=6.5Hz, 2H), 1.78-1.73 (m, 2H), 0.99 (t, J=7.4Hz, 3H).

[0245] Example 9: Preparation of 3-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline

[0246] Step 1) Preparation of tert-butyl(E)-(3-((hydroxyimino)methyl)phenyl)carbamate

[0247]

[0248] Except that tert-butyl(4-formylphenyl)carbamate in step 1) of Example 1 was replaced with tert-butyl(3-formylphenyl)carbamate (800 mg, 3.62 mmol), the process of step 1) of Example 1 was repeated to obtain the target compound in 355 mg and 42% yield.

[0249] 1H NMR (DMSO-d6, 800MHz) δ 8.08 (s, 1H), 7.62 (s, 1H), 7.35 (d, J=7.8Hz, 1H), 7.28 (t, J=7.9Hz, 1H), 7.24 (s, 2H), 7.22 (d, J=7.7Hz, 1H), 1.50 (s, 9H).

[0250] Step 2) Preparation of tert-butyl (3-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate

[0251]

[0252] Except for replacing tert-butyl(E)-(4-((hydroxyimino)methyl)phenyl)carbamate in step 2) of Example 1 with tert-butyl(E)-(3-((hydroxyimino)methyl)phenyl)carbamate (290 mg, 1.23 mmol), the process of step 2) of Example 1 was repeated to obtain the target compound in 250 mg and 84% yield.

[0253] 1H NMR (DMSO-d6, 800MHz) δ9.55 (s, 1H), 8.11 (s, 1H), 7.88 (d, J=8.8Hz, 2H), 7.51 (d, J=7.7Hz, 1H), 7.47 (dt , J=6.3, 1.3Hz, 1H), 7.41 (t, J=7.8Hz, 1H), 7.35 (s, 1H), 7.12 (d, J=8.9Hz, 2H), 3.84 (s, 3H), 1.50 (s, 9H).

[0254] Step 3) Preparation of 3-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline

[0255]

[0256] Except for replacing tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in step 3) of Example 1 with tert-butyl(3-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate (210 mg, 0.57 mmol), the process of step 3) of Example 1 was repeated to obtain the target compound in 135 mg and 88% yield.

[0257] 1H NMR (DMSO-d6, 800MHz) δ7.85 (d, J=8.9Hz, 2H), 7.28 (s, 1H), 7.16 (t, J=7.7Hz, 1H), 7.12-7.10 (m , 3H), 6.99 (dt, J=6.2, 1.2Hz, 1H), 6.68 (ddd, J=7.9, 2.2, 0.8Hz, 1H), 5.31 (s, 2H), 3.84 (s, 3H).

[0258] Example 10: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0259]

[0260] The 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline (20 mg, 0.08 mmol) prepared in step 3) of Example 1 was dissolved in dichloromethane (2 mL), and N,N-diisopropylethylamine (0.04 mL, 0.23 mmol) was added dropwise at 0 °C. The mixture was stirred at room temperature for 12 hours, and water was added dropwise after the reaction was complete. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:1), and the resulting solution was concentrated to obtain the target compound in 21 mg, 91% yield.

[0261] 1H NMR (DMSO-d6, 800MHz) δ10.16 (s, 1H), 7.84 (d, J=8.9Hz, 2H), 7.83 (d, J=8.9Hz, 2H), 7.74 (d, J=8.6Hz, 2H), 7.38 (s, 1H), 7.12 (d, J=8.8Hz, 2H), 3.8 4 (s, 3H), 2.08 (s, 3H) 13CNMR (DMSO-d6, 200MHz) δ 169.5, 168.6, 162.1, 16 0.8, 141.0, 127.2, 127.1, 123.1, 119.6, 119.1, 114.7, 96.9, 55.4, 24.1.

[0262] Example 11: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)methanesulfonamide

[0263]

[0264] The 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (50 mg, 0.19 mmol) prepared in step 3) of Example 1 was dissolved in pyridine (2.5 mL), and methanesulfonyl chloride (0.02 mL, 0.28 mmol) was added dropwise. The mixture was stirred at room temperature for 1 hour, and water was added dropwise after the reaction was complete. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:3), and the resulting solution was concentrated to obtain the target compound in 60 mg, 93% yield.

[0265] 1H NMR (DMSO-d6, 800MHz) δ10.08 (s, 1H), 7.85 (dd, J=12.7, 8.8Hz, 4H), 7.40 (s, 1H), 7.34 (d, J=8.6Hz, 2H), 7.12 (d, J=8.9Hz, 2H), 3.84 (s, 3H), 3.08 (s, 3H).

[0266] Example 12: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0267]

[0268] 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline (30 mg, mmol) prepared in step 3) of Example 1 was dissolved in pyridine (0.02 mL, 0.23 mmol), and 4-toluenesulfonyl chloride (43 mg, 0.23 mmol) was added dropwise. The mixture was stirred at room temperature for 6 hours, and water was added dropwise after the reaction was complete. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:2), and the resulting solution was concentrated to obtain the target compound in 30 mg, 63% yield.

[0269] 1H NMR (DMSO-d6, 800 MHz) δ 10.56 (s, 1H), 7.81 (d, J = 8.8 Hz, 2H), 7.75 (d, J = 8.7 Hz, 2H), 7.70 (d, J = 8.4 Hz, 2H), 7.36 (d, J = 8.2 Hz, 2H), 7.32 (s, 1H), 7.23 (d, J = 8.7 Hz, 2H), 7.11 (d, J = 8.9 Hz, 2H), 3.83 (s, 3H), 2.33 (s, 3H).

[0270] Example 13: Preparation of N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0271]

[0272] The N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide (30 mg, 0.07 mmol) prepared in Example 12 was dissolved in dichloromethane (3 mL), and boron tribromide (0.11 mL, 0.11 mmol) was added dropwise. The mixture was stirred at room temperature for 12 hours, and water was added dropwise after the reaction was complete. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:1), and the resulting solution was concentrated to obtain the target compound in 18 mg, 62% yield.

[0273] 1H NMR (DMSO-d6, 800 MHz) δ 10.54 (s, 1H), 10.08 (s, 1H), 7.74 (d, J= 8.7 Hz, 2H), 7.70 (d, J = 8.2 Hz, 2H), 7.69 (d, J = 8.7 Hz, 2H), 7.36 (d, J = 8.1 Hz, 2H), 7.23 (d, J = 8.8 Hz, 2H), 7.22 (s, 1H), 6.91 (d, J = 8.7 Hz, 2H), 2.33 (s, 3H).

[0274] Example 14: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide

[0275]

[0276] 20 mg (0.08 mmol) of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline, prepared in step 3) of Example 1, and N,N-diisopropylethylamine (0.04 mL, 0.23 mmol) were dissolved in dichloromethane (3 mL), and p-toluamide chloride (0.02 mL, 0.15 mmol) was added dropwise. The mixture was stirred at room temperature for 12 hours, and water was added dropwise after the reaction was complete. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:3), and the resulting solution was concentrated to give 21 mg of the target compound, with a yield of 73%.

[0277] 1H NMR (DMSO-d6, 800 MHz) δ 10.38 (s, 1H), 7.96 (d, J = 8.7 Hz, 2H), 7.90 (d, J = 8.2 Hz, 2H), 7.89 (d, J = 8.7 Hz, 2H), 7.85 (d, J = 8.8 Hz, 2H),7.43 (s, 1H), 7.36 (d, J = 7.8 Hz, 2H), 7.13 (d, J = 8.8 Hz, 2H), 3.85 (s,3H), 2.40 (s, 3H)13C NMR (DMSO-d6, 200 MHz) δ 169.6, 165.6, 162.1, 160.9,141.8, 141.0, 131.8, 129.0, 127.8, 127.3, 127.0, 123.6, 120.4, 119.6, 114.7,96.9, 55.4, 21.0.

[0278] Example 15: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide

[0279]

[0280] 20 mg (0.08 mmol) of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline prepared in step 3) of Example 1 was dissolved in a saturated aqueous solution of tetrahydrofuran:sodium bicarbonate (4:1, 2.5 mL), and acryloyl chloride (0.01 mL, 0.11 mmol) was added dropwise. The mixture was stirred at room temperature for 12 hours, and water was added dropwise after the reaction was complete. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:1), and the resulting solution was concentrated to obtain the target compound in 17 mg, 71% yield.

[0281] 1H NMR (DMSO-d6, 800 MHz) δ 10.38 (s, 1H), 7.87 (d, J = 8.7 Hz, 2H), 7.85 (d, J = 8.8 Hz, 2H), 7.83 (d, J = 8.7 Hz, 2H), 7.41 (s, 1H), 7.13 (d, J = 8.8 Hz, 2H), 6.47 (dd, J = 16.9, 10.2 Hz, 1H), 6.30 (dd, J = 17.0, 1.7 Hz, 1H), 5.80 (dd, J = 10.1, 1.7 Hz, 1H), 3.84 (s, 3H)13C NMR (DMSO-d6, 200 MHz)δ 169.6, 163.4, 162.1, 160.9, 140.7, 131.7, 127.4, 127.2, 127.2, 123.6, 119.6, 119.5, 114.7, 96.9, 55.4.

[0282] Example 16: Preparation of N-(4-(5-(3-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0283]

[0284] Except that in Example 10, 4-(5-(3-methoxyphenyl)isoxazole-3-yl)aniline (20 mg, 0.08 mmol) prepared in step 2 of Example 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the steps of Example 10 were repeated to obtain the target compound in 21 mg and 91% yield.

[0285] 1H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.84 (d, J = 8.6 Hz, 2H), 7.75 (d, J = 8.6 Hz, 2H), 7.58 (s, 1H), 7.50–7.47 (m, 2H), 7.45–7.44 (m, 1H),7.11–7.09 (m, 1H), 3.86 (s, 3H), 2.08 (s, 3H)13C NMR (DMSO-d6, 200 MHz) δ169.3, 168.6, 162.2, 159.7, 141.1, 130.5, 128.1, 127.2, 122.9, 119.1, 117.8, 116.4, 110.6, 98.7, 55.4, 24.1.

[0286] Example 17: Preparation of N-(4-(5-(2-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0287]

[0288] Except that in Example 10, 4-(5-(2-methoxyphenyl)isoxazole-3-yl)aniline (6 mg, 0.02 mmol) prepared in step 2 of Example 3 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the steps of Example 10 were repeated to obtain the target compound in 6 mg and 86% yield.

[0289] 1H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.90–7.88 (m, 3H), 7.74 (d, J = 8.6 Hz, 2H), 7.52 (ddd, J = 8.8, 7.4, 1.7 Hz, 1H), 7.33 (s, 1H), 7.25(d, J = 8.2 Hz, 1H), 7.13 (td, J = 7.6, 0.9 Hz, 1H), 3.99 (s, 3H), 2.08 (s,3H)13C NMR (DMSO-d6, 200 MHz) δ 168.6, 165.7, 162.0, 156.0, 141.0, 131.8,127.2, 127.0, 123.1, 120.8, 119.1, 115.4, 112.2, 101.4, 55.8, 24.1.

[0290] Example 18: Preparation of N-(4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0291]

[0292] Except that in Example 10, 4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)aniline (20 mg, 0.07 mmol) prepared in step 2 of Example 4 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the steps of Example 10 were repeated to obtain the target compound in 17 mg and 74% yield.

[0293] 1H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.83 (d, J = 8.7 Hz, 2H), 7.74 (d, J = 8.6 Hz, 2H), 7.47 (dd, J = 8.3, 2.0 Hz, 1H), 7.44 (s, 1H), 7.44(s, 1H), 7.13 (d, J = 8.4 Hz, 1H), 3.87 (s, 3H), 3.84 (s, 3H), 2.08 (s, 3H)13C NMR (DMSO-d6, 200 MHz) δ 169.7, 168.6, 162.1, 161.6, 149.1, 133.2, 127.1,123.1, 119.7, 119.1, 118.5, 116.4, 112.0, 108.9, 97.1, 55.7, 55.6, 24.2.

[0294] Example 19: Preparation of N-(4-(5-(4-propoxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0295]

[0296] Except that in Example 10, 4-(5-(4-propoxyphenyl)isoxazole-3-yl)aniline (9 mg, 0.03 mmol) prepared in step 2 of Example 8 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the steps of Example 10 were repeated to obtain the target compound in 8 mg and 78% yield.

[0297] 1H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.82 (dd, J = 8.7, 3.1 Hz, 4H), 7.73 (d, J = 8.6 Hz, 2H), 7.37 (s, 1H), 7.11 (d, J = 8.8 Hz, 2H), 4.02(t, J = 6.5 Hz, 2H), 2.08 (s, 3H), 1.78–1.74 (m, 2H), 1.00 (t, J = 7.4 Hz,3H)13C NMR (DMSO-d6, 200 MHz) δ 169.6, 168.6, 162.1, 160.3, 141.0, 127.2,127.1, 123.1, 119.4, 119.1, 115.1, 96.8, 69.2, 24.1, 21.9, 10.3.

[0298] Example 20: Preparation of N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazole-3-yl)phenyl)acetamide

[0299]

[0300] Except that in Example 10, 4-(5-(4-(trifluoromethyl)phenyl)isoxazole-3-yl)aniline (27 mg, 0.09 mmol) prepared in step 2 of Example 7 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the process of Example 10 was repeated to obtain the target compound in 25 mg and 81% yield.

[0301] 1H NMR (DMSO-d6, 800 MHz) δ 10.15 (s, 1H), 8.09 (d, J=8.1 Hz, 2H), 7.92 (d, J=8.3Hz, 2H), 7.83 (d, J=8.7 Hz, 2H), 7.74-7.71 (m, 4H), 2.05 (s, 3H).

[0302] Example 21: Preparation of N-(4-(5-(4-fluorophenyl)isoxazole-3-yl)phenyl)acetamide

[0303]

[0304] Except that in Example 10, 4-(5-(4-fluorophenyl)isoxazole-3-yl)aniline (10 mg, 0.04 mmol) prepared in step 2 of Example 6 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the process of Example 10 was repeated to obtain the target compound in 9 mg and 77% yield.

[0305] 1H NMR (DMSO-d6, 800 MHz) δ 10.18 (s, 1H), 7.98-7.96 (m, 2H), 7.84 (d, J=8.7 Hz, 2H), 7.75 (d, J=9.0 Hz, 2H), 7.53 (s, 1H), 7.44-7.41 (m, 2H), 2.08 (s, 3H); 13C NMR (DMSO-d6, 200 MHz) δ 168.7, 168.6, 163.8, 162.5, 162.3, 141.1, 133.2, 128.1, 128.0, 127.2, 123.6, 122.9, 119.1, 116.5, 116.4, 98.3, 24.1.

[0306] Example 22: Preparation of N-(4-(5-(4-(tert-butyl)phenyl)isoxazole-3-yl)phenyl)acetamide

[0307]

[0308] Except that in Example 10, 4-(5-(4-(tert-butyl)phenyl)isoxazole-3-yl)aniline (15 mg, 0.05 mmol) prepared in step 2 of Example 5 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the process of Example 10 was repeated to obtain the target compound in 11 mg and 64% yield.

[0309] 1H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.85 (d, J = 8.7 Hz, 2H), 7.83 (d, J = 8.5 Hz, 2H), 7.74 (d, J = 8.6 Hz, 2H), 7.59 (d, J = 8.5 Hz, 2H), 7.48 (s, 1H), 2.08 (s, 3H), 1.33 (s, 9H); 13C NMR (DMSO-d6, 200 MHz) δ 169.6, 168.6, 162.1, 153.2, 141.1, 127.2, 126.1, 125.4, 124.3, 123.0, 119.1, 97.8, 34.7, 30.9, 24.1.

[0310] Example 23: Preparation of N-(4-(5-(pyridin-4-yl)isoxazole-3-yl)phenyl)acetamide

[0311]

[0312] Except that 4-ethynyl phenyl ether in step 2) of Example 1 was replaced with 4-ethynylpyridine (58.2 mg, 0.56 mmol), the steps of step 2) of Example 1 were repeated to obtain tert-butyl (4-(5-(pyridin-4-yl)isoxazole-3-yl)phenyl)carbamate in 130 mg and 45% yield.

[0313] The steps of step 3 of Example 1 were repeated except that the tert-butyl (4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate in Example 1 step 3 was replaced with the tert-butyl (4-(5-(pyridin-4-yl)isoxazole-3-yl)phenyl)carbamate obtained therein, to obtain the target compound in 62 mg and 77% yield.

[0314] Subsequently, the steps of Example 10 were repeated except that the obtained 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline (20 mg, 0.08 mmol) was substituted for the 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline in Example 10, and the final target compound was obtained in 18 mg and 77% yield.

[0315] 1H NMR (DMSO-d6, 800 MHz) δ 10.20 (s, 1H), 8.79 (dd, J=4.4, 1.6 Hz, 2H), 7.87-7.86 (m, 3H), 7.86 (s, 1H), 7.84 (s, 1H), 7.76 (d, J=8.6 Hz, 2H), 2.08 (s, 3H) 13NMR (DMSO-d6, 200 MHz) δ 168.7, 167.1, 162.5, 150.8, 141.3, 133.4, 127.3, 122.5, 119.4, 119.1, 101.4, 24.1.

[0316] Example 24: Preparation of N-(3-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0317]

[0318] Except that 3-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline (20 mg, 0.08 mmol) prepared in step 3 of Example 9 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline in Example 10, the steps of Example 10 were repeated to obtain the target compound in 15 mg and 65% yield.

[0319] 1H NMR (DMSO-d6, 800 MHz) δ 10.14 (s, 1H), 8.18 (t, J = 1.7 Hz, 1H), 7.88 (d, J = 8.9 Hz, 2H), 7.70 (dd, J = 8.1, 1.0 Hz, 1H), 7.54 (dt, J = 6.5, 1.2 Hz, 1H), 7.46 (t, J =7.9 Hz, 1H), 7.37 (s, 1H), 7.13-7.11 (m, 2H), 3.84 (s, 3H), 2.08 (s, 3H) 13C NMR (DMSO-d6, 200 MHz) δ 169.8, 168.5, 162.5, 160.9, 139.9, 129.5, 129.1, 127.3, 121.5, 120.7, 119.5, 116.6, 114.7, 97.1, 55.4, 24.0.

[0320] Example 25: Preparation of N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide

[0321]

[0322] Except that the 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline in Example 14 was replaced with 3-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline (20 mg, 0.08 mmol) prepared in step 3 of Example 9, the process of Example 14 was repeated to obtain the target compound in 22 mg and 76% yield.

[0323] 1H NMR (DMSO-d6, 800MHz) δ 10.36 (s, 1H), 8.39 (t, J=1.8Hz, 1H), 7.92 (d, J=8.1Hz, 3H), 7.89 (d, J=8.8Hz, 2H), 7.61 (dt, J=6.4, 1.3Hz, 1H), 13C NMR (DMSO-d6, 200MHz) δ 169.8, 165.5, 162.5, 160.9, 141.8, 139.9, 131.8, 129.4, 129.0, 129.0, 127.7, 127.3, 122.0, 122.0, 119.5, 118.1, 114.7, 97.1, 55.4, 21.0.

[0324] Example 26: Preparation of N-(4-(5-(4-hydroxyphenyl)isoxazole-3-yl)phenyl)acetamide

[0325]

[0326] Except that N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)-4-methylbenzenesulfonamide in Example 13 was replaced with N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide (20 mg, 0.07 mmol) prepared in Example 10, the process of Example 13 was repeated to obtain the target compound in 16 mg and 84% yield.

[0327] 1H NMR (DMSO-d6, 800MHz) δ 10.12 (s, 1H), 10.05 (s, 1H), 7.78 (d, J=8.7Hz, 2H), 7.69 (d, J=8.5Hz, 2H), 7.69 (d, J=8.6Hz, 2H), 7.24 (s, 1H), 6.88 (d, J=8.7Hz, 2H), 2.04 (s, 3H); 13C NMR (DMSO-d6, 200MHz) δ 169.9, 168.6, 162.0, 159.4, 141.0, 127.3, 127.1, 123.2, 119.1, 118.1, 116.0, 96.1, 24.1.

[0328] Example 27: Preparation of 4-(3-(4-acetamidophenyl)isoxazole-5-yl)phenyl-4-methylbenzenesulfonate

[0329]

[0330] Except that 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline in Example 12 was replaced with N-(4-(5-(4-hydroxyphenyl)isoxazole-3-yl)phenyl)acetamide (5 mg, 0.02 mmol) prepared in Example 26, and pyridine was replaced with potassium carbonate (3.5 mg, 0.03 mmol), the process of Example 12 was repeated to obtain the target compound in 6 mg and 79% yield.

[0331] 1H NMR (DMSO-d6, 800MHz) δ 10.18 (s, 1H), 7.91 (d, J=8.7Hz, 2H), 7.82 (d, J=8.7Hz, 2H), 7.78 (d, J=8.3Hz, 2H), 7.74 (d, J=8.7 Hz,2H),7.55(s,1H),7.49(d,J=8.0Hz,2H),7.23(d,J=8.8Hz,2H),2.43(s,3H),2.08(s,3H); 13C NMR (DMSO-d6, 200MHz) δ 168.6, 168.2, 162.3, 150.1, 146.1, 141.2, 131.1, 130.3, 128.3, 127.4, 127.2, 126.0, 123.1, 122.7, 119.1, 99.1, 24.1, 21.2.

[0332] Example 28: Preparation of N-(4-(3-(4-methoxyphenyl)isoxazole-5-yl)phenyl)acetamide

[0333] Step 1: Preparation of (E)-4-methoxybenzaldehyde oxime

[0334]

[0335] Except that tert-butyl (4-formylphenyl) carbamate in step 1 of Example 1 was replaced with 4-methoxybenzaldehyde (2.0 g, 14.69 mmol), the process of step 1 of Example 1 was repeated to obtain the target compound in 1.37 g and 62% yield.

[0336] 1H NMR (CDCl3, 800MHz) δ 8.14 (d, J=9.0Hz, 2H), 7.90 (s, 1H), 7.05 (d, J=9.1Hz, 2H), 3.92 (s, 3H).

[0337] Step 2) Preparation of N-(4-(3-(4-methoxyphenyl)isoxazole-5-yl)phenyl)acetamide

[0338]

[0339] Except that tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate in step 2 of Example 1 was replaced with (E)-4-methoxybenzaldehyde oxime (610 mg, 4.04 mmol) prepared in step 1 of Example 28, and 4-ethynyl anisole was replaced with N-(4-ethynylphenyl)acetamide (428 mg, 2.69 mmol), the process of step 2 of Example 1 was repeated to obtain the target compound in 560 mg and 68% yield.

[0340] 1H NMR (DMSO-d6, 800MHz) δ 10.22 (s, 1H), 7.85-7.82 (m, 4H), 7.76 (d, J=8.6Hz, 2H), 7.40 (s, 1H), 7.09 (d, J=8.8Hz, 2H), 3.83 (s, 3H), 2.09 (s, 3H); 13C NMR (DMSO-d6, 200MHz) δ 169.3, 168.7, 162.1, 160.7, 141.2, 128.0, 126.3, 121.5, 121.0, 119.1, 114.5, 97.2, 55.3, 24.1.

[0341] Example 29: Preparation of N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide

[0342]

[0343] The N-(4-(3-(4-methoxyphenyl)isoxazole-5-yl)phenyl)acetamide (10 mg, 0.03 mmol) prepared in step 2 of Example 28 was dissolved in ethanol (2 mL), and 0.3 mL of 37% hydrochloric acid aqueous solution was added dropwise. The mixture was heated to 70 °C and stirred for 3 hours. After the reaction was complete, a saturated aqueous solution of sodium bicarbonate was added dropwise at room temperature. The mixture was extracted three times with a chloroform:isopropanol (4:1) mixture, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:2), and the resulting solution was concentrated to obtain the target compound in 8.0 mg, 93% yield.

[0344] Except that the process of Example 12 was repeated in place of the obtained 4-(3-(4-methoxyphenyl)isoxazole-5-yl)aniline (10 mg, 0.04 mmol) in Example 12, the final target compound was obtained in 14 mg and 89% yield.

[0345] 1H NMR (DMSO-d6, 800MHz) δ 10.64 (s, 1H), 7.81 (d, J=8.8Hz, 2H), 7.74 (d, J=8.2Hz, 2H), 7.70 (d, J=8.3Hz, 2H), 7.36 (d, J=7.8 Hz,1H),7.35(s,1H),7.23(d,J=7.9Hz,2H),7.08(d,J=8.9Hz,2H),3.82(s,3H),2.33(s,3H); 13C NMR (DMSO-d6, 200MHz) δ 162.1, 160.7, 129.8, 128.0, 126.7, 120.9, 119.4, 114.5, 55.3, 20.9.

[0346] Example 30: Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide

[0347]

[0348] Except that N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)-4-methylbenzenesulfonamide in Example 13 was replaced with N-(4-(3-(4-methoxyphenyl)isoxazole-5-yl)phenyl)-4-methylbenzenesulfonamide (15 mg, 0.04 mmol) prepared in step 2 of Example 29, the process of Example 13 was repeated to obtain the target compound in 11 mg and 76% yield.

[0349] 1H NMR (DMSO-d6, 800MHz) δ 10.63 (s, 1H), 9.92 (s, 1H), 7.74 (d, J=8.7Hz, 2H), 7.70 (d, J=7.9Hz, 2H), 7.69 (d, J=8.5Hz, 2H), 7 13C NMR (DMSO-d6, 200MHz) δ 168.7, 162.3, 159.2, 143.6, 139.7, 136.4, 129.8, 128.1, 126.7, 126.7, 122.3, 119.4, 119.3, 115.8, 97.5, 20.9.

[0350] Example 31: Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazole-5-yl)phenyl)acetamide

[0351]

[0352] Except that N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)-4-methylbenzenesulfonamide in Example 13 was replaced with N-(4-(3-(4-methoxyphenyl)isoxazole-5-yl)phenyl)acetamide (15 mg, 0.05 mmol) prepared in step 2 of Example 28, the process of Example 13 was repeated to obtain the target compound in 10 mg and 70% yield.

[0353] 1H NMR (DMSO-d6, 800MHz) δ 10.21 (s, 1H), 9.95 (s, 1H), 7.82 (d, J=8.7Hz, 2H), 7.75 (d, J=8.7Hz, 2H), 7 .72 (d, J=8.6Hz, 2H), 7.33 (s, 1H), 6.89 (d, J=8.6Hz, 2H), 2.08 (s, 3H); 13C NMR (DMSO-d6, 200MHz) δ 169.1, 168.7, 162.3, 141.1, 128.1, 126.3, 121.6, 119.4, 119.1, 115.8, 97.1, 24.1.

[0354] Example 32: Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide

[0355] Step 1) Preparation of N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide

[0356]

[0357] Except that in Example 14, 4-(3-(4-methoxyphenyl)isoxazole-5-yl)aniline (15 mg, 0.06 mmol) prepared in step 1 of Example 29 was used instead of 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline, the process of Example 14 was repeated to obtain the target compound in 13 mg and 60% yield.

[0358] 1H NMR (DMSO-d6, 800MHz) δ 10.42 (s, 1H), 7.99 (d, J=8.7Hz, 2H), 7.90 (d, J=8.1Hz, 2H), 7.89 (d, J=8.7Hz, 2H), 7.85 (d, J=8.7 Hz,2H),7.45(s,1H),7.36(d,J=7.9Hz,2H),7.10(d,J=8.8Hz,2H),3.84(s,3H),2.40(s,3H);13C NMR (DMSO-d6, 200MHz) δ 169.3, 165.6, 162.1, 160.7, 141.9, 141.2, 131.8, 129.0, 128.0, 127.8, 126.1, 122.0, 121.0, 120.4, 114.5, 97.4, 55.3, 21.0.

[0359] Step 2) Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide

[0360]

[0361] Except that in Example 13, N-(4-(3-(4-methoxyphenyl)isoxazole-5-yl)phenyl)-4-methylbenzamide (108 mg, 0.28 mmol) prepared in step 1 was used instead of N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)-4-methylbenzenesulfonamide, the process of Example 13 was repeated to obtain the target compound in 65 mg and 63% yield.

[0362] 1H NMR (DMSO-d6, 800MHz) δ 10.41 (s, 1H), 9.96 (s, 1H), 7.99 (d, J=8.7Hz, 2H), 7.90 (d, J=8.0Hz, 2H), 7.88 (d, J=8.7Hz, 2H), 7 .73 (d, J=8.6Hz, 2H), 7.38 (s, 1H), 7.36 (d, J=7.9Hz, 2H), 6.90 (d, J=8.6Hz, 2H), 2.08 (s, 3H); 13C NMR (DMSO-d6, 200MHz) δ 169.1, 165.6, 162.3, 159.2, 141.9, 141.1, 131.8, 129.0, 128.1, 127.8, 126.1, 122.0, 120.4, 119.4, 115.8, 97.3, 21.0.

[0363] Example 33: Preparation of N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide

[0364] Step 1) Preparation of 4-(4-(4-aminophenyl)-1H-1,2,3-triazol-1-yl)phenol

[0365]

[0366] 4-Ethynylaniline (100 mg, 0.85 mmol), 4-iodophenol (187.8 mg, 0.85 mmol), sodium azide (82.9 mg, 1.28 mmol), cuprous iodide (32.4 mg, 0.17 mmol), L-proline (19.6 mg, 0.17 mmol), and sodium carbonate (135.1 mg, 1.28 mmol) were dissolved in dimethyl sulfoxide (3 mL). The mixture was heated to 70 °C and stirred for 12 hours. After the reaction was complete, water was added dropwise. The mixture was extracted three times with a chloroform:isopropanol (4:1) mixture, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 3:2), and the resulting solution was concentrated to obtain the target compound in 114 mg, 80% yield.

[0367] 1H NMR (DMSO-d6, 400MHz) δ 9.92 (s, 1H), 8.91 (s, 1H), 7.68 (d, J=8.8Hz, 2H), 7.57 (d, J=8.8Hz, 2H), 6.94 (d, J=8.8Hz, 2H), 6.64 (d, J=6.8Hz, 2H), 5.27 (s, 2H).

[0368] Step 2) Preparation of N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide

[0369]

[0370] The 4-(4-(4-aminophenyl)-1H-1,2,3-triazol-1-yl)phenol (50 mg, 0.2 mmol) and pyridine (0.03 mL, 0.4 mmol) prepared in step 1 of Example 33 were dissolved in dichloromethane (2 mL), and 4-toluenesulfonyl chloride (45.3 mg, 0.24 mmol) and 4-dimethylaminopyridine (4.8 mg, 0.04 mmol) were added dropwise. After stirring at room temperature for 12 hours, 1N hydrochloric acid aqueous solution was added dropwise. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 2:1), and the resulting solution was concentrated to obtain the target compound in 40 mg, 50% yield.

[0371] 1H NMR (DMSO-d6, 800MHz) δ 10.16 (s, 1H), 8.90 (s, 1H), 7.73 (d, J=8.5Hz, 2H), 7.65 (d, J=8.2Hz, 2H), 7.64 (d, J=8.8H z, 2H), 7.33 (d, J=8.2Hz, 2H), 7.15 (d, J=8.5Hz, 2H), 6.93 (d, J=8.9Hz, 2H), 2.30 (s, 3H).

[0372] Example 34: Preparation of N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide

[0373]

[0374] N-(4-ethynylphenyl)acetamide (50 mg, 0.31 mmol), 1-azido-4-methoxybenzene (42 mg, 0.28 mmol), copper sulfate pentahydrate (12 mg, 0.05 mmol), and sodium ascorbate (28 mg, 0.14 mmol) were dissolved in tetrahydrofuran:water (1:1, 3 mL). After stirring at room temperature for 12 hours, 1N hydrochloric acid aqueous solution was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:1), and the resulting solution was concentrated to obtain the target compound in 45 mg, 46% yield.

[0375] 1H NMR (DMSO-d6, 800MHz) δ 10.06 (s, 1H), 9.09 (s, 1H), 7.85-7.83 (m, 4H), 7.69 (d, J=8.6Hz, 2H), 7.17 (d, J=9.0Hz, 2H), 3.84 (s, 3H), 2.07 (s, 3H); 13C NMR (DMSO-d6, 200MHz) δ 168.4, 159.2, 147.00, 139.2, 130.1, 125.7, 125.1, 121.6, 119.2, 118.9, 114.9, 55.6, 24.0.

[0376] Example 35: Preparation of N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0377]

[0378] (E)-N-(4-(3-(4-hydroxyphenyl)acryloyl)phenyl)-4-methylbenzenesulfonamide (TSAHC) (100 mg, 0.25 mmol) was dissolved in ethanol (2.5 mL) with hydrazine hydrate (0.03 mL, 0.51 mmol), and the mixture was heated to 70 °C and stirred for 12 hours. After the reaction was complete, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 2:1), and the resulting solution was concentrated to obtain the target compound in 45 mg, 44% yield.

[0379] 1H NMR (DMSO-d6, 800 MHz) δ 13.05 (s, 1H), 10.32 (s, 1H), 9.78 (s, 1H), 7.65-7.63 (m, 4H), 7.57 (d, J=8.2 Hz, 2H), 7.33 (d, J=8.2 Hz, 2H), 7.11 (d, J=8.5 Hz, 2H), 6.87 (s, 1H), 6.80 (d, J=8.5 Hz, 2H), 2.30 (s, 3H).

[0380] Example 36: Preparation of N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0381]

[0382] (E)-N-(4-(3-(4-hydroxyphenyl)acryloyl)phenyl)-4-methylbenzenesulfonamide (TSAHC) (100 mg, 0.25 mmol) and hydroxylamine hydrochloride (35.3 mg, 0.51 mmol) were dissolved in ethanol (2.5 mL), heated to 70 °C, and stirred for 12 hours. After the reaction was complete, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:2), and the resulting solution was concentrated to obtain the target compound in 32 mg, 30% yield.

[0383] 1H NMR (DMSO-d6, 800 MHz) δ 9.68 (s, 1H), 7.66 (d, J=8.3 Hz, 2H), 7.52 (d, J=8.7Hz, 2H), 7.33 (d, J=8.1 Hz, 2H), 7.16-7.12 (m, 4H), 6.73 (d, J=8.6 Hz, 2H), 5.52 (dd, J=10.6, 9.1 Hz, 1H), 4.67-4.65 (m, 1H), 3.22 (dd, J=17.1, 8.9 Hz, 1H), 2.30 (s, 3H).

[0384] Example 37: Preparation of N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide

[0385] Step 1) Preparation of tert-butyl (4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)carbamate

[0386]

[0387] 4-Vinylstyrene (0.11 mL, 0.83 mmol), (diacetoxyiodine)benzene (266 mg, 0.83 mmol), and trifluoroacetic acid (0.015 mL) were dissolved in methanol (10 mL). Tert-butyl(E)-(4-((hydroxyimino)methyl)phenyl)carbamate (150 mg, 0.64 mmol) prepared in step 1) of Example 1 was slowly added dropwise. After stirring at room temperature for 12 hours, a saturated aqueous sodium bicarbonate solution was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The residue was purified by rapid column chromatography (ethyl acetate:n-hexane = 1:4), and the resulting solution was concentrated to obtain the target compound in 154 mg, 66% yield.

[0388] 1H NMR (DMSO-d6, 800 MHz) δ 9.59 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.53 (d, J=8.6Hz, 2H), 7.31 (d, J=8.7 Hz, 2H), 6.94 (d, J=8.7 Hz, 2H), 3.78-3.73 (m, 4H), 3.31 (m, 1H), 1.48 (s, 9H).

[0389] Step 2) Preparation of N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide

[0390]

[0391] Except that in step 3) of Example 1, tert-butyl(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazole-3-yl)phenyl)carbamate (100 mg, 0.27 mmol) prepared in step 1) was used instead of tert-butyl(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)carbamate, the process of step 3) of Example 1 was repeated to obtain the target compound in 51 mg and 70% yield.

[0392] Subsequently, the obtained 4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazole-3-yl)aniline (50 mg, 0.186 mmol) was substituted for the 4-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline in Example 10, and the remaining steps were the same. The process of Example 10 was repeated, and the target compound was finally obtained in 48 mg, with a yield of 83%.

[0393] 1H NMR (DMSO-d6, 800 MHz) δ 10.13 (s, 1H), 7.66 (d, J=8.8 Hz, 2H), 7.63 (d, J=8.8Hz, 2H), 7.32 (d, J=8.7 Hz, 2H), 6.94 (d, J=8.7 Hz, 2H), 5.63 (dd, J=10.6, 9.0 Hz, 1H), 3.77 (dd, J=16.9, 10.7 Hz, 1H), 3.75 (s, 3H), 3.33 (d, J=9.3 Hz, 1H), 2.06 (s, 3H); 13C NMR (DMSO-d6, 200 MHz) δ 168.6, 159.1, 156.1, 140.9, 132.7, 127.7, 127.3, 123.8, 118.8, 113.9, 81.7, 55.1, 41.9, 24.1.

[0394] Experiment Example 1. Experiment Preparation

[0395] 1.1. Cell Culture

[0396] In human hepatocellular carcinoma cells that do not express TM4SF5, such as SNU449, SNU761, or Huh7KO (cell lines with the TM4SF5 gene removed using the CRISPR / Cas9 system), cell lines prepared by infection with retroviruses expressing TM4SF5 or transfected with complementary DNA (cDNA) (SNU449Tp, SNU449T7, SNU449-TM4SF5, SNU761-TM4SF5, or Huh7KO-TM4SF5), as well as cell lines infected with control viruses or transfected with control empty vectors (SNU449Cp, SNU449-EV, SNU761-EV, or Huh7KO-EV), were tested in DMEM medium (Dulbecco's Modified Eagle Medium) or RPMI-1640 medium (Roswell Park Memorial Medium) containing 10% fetal bovine serum (FBS) and antibiotics (Invitrogen, CA, USA). Cells were cultured at 37°C in a 5% CO2 incubator at Institute-1640 (WelGene, Daegu, South Korea). Human natural killer (NK) cell lines (NK92) were cultured in α-MEM medium (Invitrogen) containing 200.0 U / ml of recombinant human interleukin-2 (IL-2, Peprotech), 12.5% ​​fetal bovine serum (FBS), and 12.5% ​​fetal horse serum (GenDEPOT). NK92 cells were infected with a retrovirus expressing TM4SF5-HA to prepare NK92-TM4SF5-HA. HEK293FT or human Jurkat T cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS).

[0397] 1.2. Gene transfer (transfection or infection) and expression suppression.

[0398] Depending on the circumstances, wild-type (WT) or mutant complementary DNA (cDNA) of TM4SF5, SLAMF7, or PD-L1 contained in empty vectors (EVs) or mammalian expression plasmids is transfected into cell lines using lipofectamine 3000 (Thermo Fisher Scientific Inc.) and PEI (Polyscience). Alternatively, lentiviruses containing empty vectors or cDNA are used to infect host cells, and the resulting lentiviruses are used to infect the target cell lines, thereby artificially expressing the genes in the target cell lines.

[0399] 1.3. Evaluation of cell survival / proliferation (sphere growth) inhibition under three-dimensional suspension culture conditions

[0400] Equal numbers (200 cells / well or 1000 cells / well) of cells not expressing TM4SF5 (SNU449Cp) and cells expressing TM4SF5 (SNU449T7) were added to each well of a Costar Ultra-Low Attachment Multiple Well Plate (CORNING). After adding cells to each well, the cells were treated with vehicle (DMSO) or different concentrations of the drug, and cultured in a cell culture incubator at 37°C and 5% CO2. From the start of cell culture, the cells were repeatedly treated with the same concentration at regular time intervals as shown. On the final observation day, the proliferation of the cells (sphere) was observed and photographed using an optical microscope.

[0401] 1.4. Analysis of cell migration trajectory and migration function

[0402] Human hepatocellular carcinoma cells SNU449-TM4SF5 expressing TM4SF5 via lentivirus and SNU449-EV cells expressing TM4SF5 via an empty vector (EV) were seeded at a density of 40% in 8-chamber plates (Thermo) coated with 10 μg / ml collagen type 1 (Advanced Biomatrix). After seeding for 3 hours in a cell culture environment containing 10% FBS (GenDEPOT), DMSO and the drug were added to the culture medium at the indicated concentrations. Following drug treatment, the location of migrating cells was repeatedly photographed every 20 minutes over 17 hours using a microscope. Cell imaging was performed using an IX81-ZDC microscope (Olympus) equipped with a UPLSAPO 10X2, NA0.4 Super Apochromatic objective lens (Olympus). During cell imaging, a controller (Live Cell Instrument) continuously aerated 5% CO2 at a flow rate of 40–60 mL / min at 37°C to maintain the standard cell culture environment. Cell migration distance and path were calculated using the "Track Object" application of MetaMorph software (Molecular Devices LLC). The migration trajectories of multiple cells were measured simultaneously, with the original position of each cell set as the origin of a concentric circle. Different colored lines were used to mark the migration paths, thus representing the degree of cell migration.

[0403] 1.5. Construction of mice overexpressing the Mouse™4SF5 gene only in hepatocytes

[0404] For details relating to the mouse construction described in Examples 1.5 and 1.6, please refer to Korean Patent Applications No. 10-2022-0007048, 10-2021-0171614, and 10-2021-0150240 filed by the inventors. The mouse construction methods described in the aforementioned Korean patent applications are briefly described below.

[0405] The Mouse Tm4sf5 gene (NM_029360) was ligated into the albumin promoter sequence to enable its expression in albumin-highly expressed hepatocytes. The constructed plasmid was then introduced into C57BL / 6 mouse zygotes via microinjection. PCR was performed on 2-week-old founder mice using (ALB Forward-CAGCTTGGCTTGAACTCGTTC-3′, TM4SF5 Reverse-CAATTCCTGGACACAGCACCA-3′) to confirm the acquisition of a 689 bp amplification product. Overexpression mice were then confirmed, thus completing the preparation of (pALB-mTm4sf5-(Flag)3-transgenic mouse: Alb-TgTm4sf5-Flag).

[0406] 1.6. Construction of TM4SF5 gene knockout (KO) mice

[0407] Cas9 / RGEN KO mice were constructed using C57BL / 6 mice. Multiple mice with 29 bp deletions were obtained using the RGEN site (sgRNA sequences targeting mouse Tm4sf5Exon 1: sgRNA1 5′GAGGTTGCCGTCCGTCCAGGTGG3′, sgRNA2 5′GCTGAGGTTGCCGTCCGTCCAGG3′) [custom-made by Macrogen]. The 556 bp PCR product was confirmed using a Mouse TM4SF5 primer (Forward, 5′-ACTTCCTCAGGGCCTCTCTC-3′; Reverse, 5′-CCTTTCCCACATTCCTCAGA-3′). Heteroduplex formation between WT / mutant PCR products was observed using the T7E1 assay to screen for mutant mice, and precisely KO-positive mice were used for experiments. This study used Tm4sf5 Exon1- / - mice, which have a 29 bp deletion that contains the 36th amino acid Threonine at the start of the extracellular loop 2 of mouse TM4SF5 in Exon 1.

[0408] 1.7. Establish a mouse model of non-alcoholic steatohepatitis (NASH) using the MCD (methionine-choline-deficient) diet.

[0409] Normal (WT), Alb-TgTm4sf5-Flag, and Tm4sf5- / - (Tm4sf5 gene deletion) KO C57BL / 6N mice were housed in a well-controlled, temperature- and humidity-free animal laboratory. Two-two-week-old mice were used to establish a NASH (non-steatotic hepatitis) disease model. To induce NASH using the MCD (TD.90262, Teklad) diet, six-week-old male mice were randomly divided into a normal chow diet (NCD, Purina, Cat # 38057) group and an MCD group, with free access to food for four weeks (n=7 per group). Drug treatment was administered via intraperitoneal injection twice weekly at a dose of 5 mg / kg. After the experiment, liver tissue was harvested and analyzed using H&E, immunohistochemistry staining, Western blot, and qRT-PCR.

[0410] 1.8. Establishing a liver cancer model using DEN drugs

[0411] Hepatocellular carcinoma (HCC) models were induced in 2-week-old male wild-type (WT), Alba-TgTm4sf5-Flag (a transgenic animal with Tm4sf5 overexpression regulated by an Albamin gene promoter, custom-made by Macrogen), and Tm4sf5- / - KOC57BL / 6N male mice by a single intraperitoneal injection (IPinjection) of DEN (diethylnitrosamine, Sigma-Aldrich) at a dose of 25 mg / kg, followed by 10 months of feeding. Following DEN treatment, mice were fed a normal diet for 40 weeks in a pathogen-free room with well-controlled temperature and humidity. During the last 6 weeks, mice were treated twice weekly with intraperitoneal injections of isoxazole (dissolved in 40% DMSO) at the indicated concentration. Forty-six weeks after DEN injection, the animals were sacrificed, and liver tissue was obtained and analyzed by tissue staining, Western blotting, and qRT-PCR (real-time quantitative reverse transcription polymerase chain reaction).

[0412] 1.9. Evaluation of the anticancer efficacy of isoxazole compounds in a subcutaneous xenograft model of TM4SF5-expressing hepatocellular carcinoma cell lines.

[0413] Cells not expressing TM4SF5 (SNU449Cp) or cells expressing TM4SF5 (SNU449T7) were cultured in a cell culture incubator at 37°C and 5% CO2. The following day, cells were treated with T / E (Trypsin / EDTA) solution to detach them and centrifuged at 150×g for 3 minutes to obtain pellets. After removing the supernatant, the pellets were resuspended in phosphate-buffered saline (PBS) for further preparation. To induce hepatocellular carcinoma, 10 mg of the TM4SF5 compound was injected subcutaneously into the right thigh of 8-week-old male BALB / c-Nude mice. 7 Cells / 100μl. Animals were anesthetized with 20% isoflurane before injection. Starting from day 7 post-injection, animals were intraperitoneally injected with ST-2-001, ST-3-006, and ST-3-011 at 5 mg / kg body weight every 3 days, for a total of 8 injections. Animal body weight was measured weekly from the day of cell injection; tumor volume was measured every 3 days starting from day 7 post-injection. Tumor volume was calculated by measuring the length and width of the tumor using the formula (length × width × width) / 2 (mm3). Finally, on day 31 post-injection, animals were sacrificed according to standard procedures to preserve liver tissue for analysis of hepatocellular carcinoma tissue.

[0414] 1.10. Evaluation of the anticancer efficacy of isoxazole compounds in a liver-orthotopic xenograft model of TM4SF5-expressing hepatocellular carcinoma cell lines.

[0415] Cells expressing either TM4SF5 (SNU449Cp) or TM4SF5 (SNU449T7) were cultured in a cell culture incubator at 37°C and 5% CO2. The following day, cells were treated with T / E (Trypsin / EDTA) solution to detach them and centrifuged at 150×g for 3 minutes to obtain a pellet. The supernatant was then removed, retaining only the pellet. Epidermal growth factor (EGF) was mixed with matrix gel (CORNING) to a final EGF concentration of 50 ng / μl, and the cell pellet was resuspended in the EGF / CORNING mixture for further preparation. Then, 5×10⁵ cells were injected directly into the liver of 6-week-old male BABL / c-Nude mice. 5 Cells / 20μl. Animals were anesthetized with 20% isoflurane before injection. Starting one week after cell injection, ST-5-002 was administered intraperitoneally twice weekly at a dose of 5 mg / kg. After a total of 6 injections over 3 weeks, animals were sacrificed at week 4 post-cell injection, and liver tissue was obtained for analysis.

[0416] 1.11. Evaluation of the anticancer efficacy of isoxazole compounds in a TM4SF5-expressing PDX (hepatocellular carcinoma patient tissue xenograft) animal model.

[0417] Hepatocellular carcinoma (HCC) tissue sections (P0; HCC cube, 1 mm3) expressing TM4SF5 were obtained from Seoul National University Hospital and used for experiments after undergoing the proper IRB approval process (H-2102-059-1195). Hair was removed from the right thigh and flank of 6-week-old male NOD / SCID mice, and the mice were anesthetized with 20% isoflurane. The cancer tissue sections were then implanted into the right axilla of the mice. Four to five weeks after implantation, if the cancer tissue sections grew to a certain size, the animals were sacrificed to obtain the cancer tissue sections (P1). The cancer tissue sections were cut into 1 mm3 pieces and placed in a cryotube along with Recovery-Cell Culture Freezing Medium (Gibco) and stored in a liquid nitrogen tank at -80°C. After obtaining P2 and P3 cancer tissue sections using the same method, the P3 cancer tissue sections were transplanted into each 6-week-old male NOD / SCID mouse at a rate of 1 mm³ / section to construct the HCC-PDX mouse model used in this experiment. Starting from day 8 after cancer tissue section implantation, vehicles, ST-5-001, or ST-5-002 were administered intraperitoneally twice weekly at a dose of 5 mg / kg for a total of 6 injections. Animals were sacrificed on day 28 after cancer tissue implantation, and liver cancer tissue was obtained and analyzed.

[0418] 1.12. The anticancer efficacy of isoxazole compounds was evaluated in a subcutaneous xenograft model of TM4SF5-expressing hepatocellular carcinoma cells using severely immunodeficient animals.

[0419] Cells expressing TM4SF5 (SNU449T7) were cultured in a cell culture incubator at 37°C and 5% CO2. The following day, cells were treated with T / E (Trypsin / EDTA) solution to detach them and centrifuged at 150×g for 3 minutes to obtain a cell pellet. The supernatant was then removed, and the pellet was resuspended in phosphate-buffered saline (PBS) for further preparation. To generate cancerous tissue, 5×10⁵ cells were subcutaneously injected once into the right thigh of 6-week-old male NOD / SCID mice. 5Cells / 100μl. Animals were anesthetized with 20% isoflurane before injection. Starting from day 15 post-injection, ST-5-002 was administered intraperitoneally at a dose of 2.5 mg / kg (100μl) every 3 days for a total of 8 injections. Starting from day 12 post-injection, animal body weight and tumor volume were measured every 3 days. Tumor volume was calculated by measuring the length and width of the tumor, expressed as (length × width × width) / 2 (mm³). Animals were sacrificed on day 36 post-injection of cells (SNU449T7), and cancerous tissue was harvested and analyzed.

[0420] 1.13. Western blotting analysis of cell and tissue extracts

[0421] Cell extracts were obtained from cells that had never been treated with any substance and had grown to 70–80% density, and from cells that had been treated with a solvent, dimethyl sulfoxide (DMSO), or a drug at a given concentration for 24 hours. For extracts from hepatocytes or hepatocellular carcinoma cells, a lysis buffer containing a protease inhibitor cocktail (GenDEPOT) was used (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl, 0.25% sodium deoxycholate, pH 7.4). In addition, after washing the animal liver tissue twice with phosphate-buffered saline (PBS), lysis buffer [50 mM Tris-HCl, pH 7.4, 1% NP40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA (based on 500 ml)] was added, along with sodium dodecyl sulfate (SDS), Na3O4V, and a protease inhibitor cocktail (GenDepot). The mixture was then incubated at 4°C for 15 minutes. After centrifugation at 13,000 rpm for 30 minutes at 4°C, the supernatant was transferred to a new microcentrifuge tube. After quantification using BCA reagent (ThermoScientifics), add 4× sample buffer [100% glycerol 4ml, Tris-HCl (pH 6.8) 2.4ml, SDS 0.8g, bromophenol blue 4mg, beta-mercaptoethanol 0.4ml, H2O3].1 ml (based on 10 ml)], then boiled at 100°C for 5 minutes. The above samples were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a nitrocellulose membrane (NitrocelluloseMembranes Protran™ membrane, Whatman), and blocked with 5% skim milk for 1 hour. After blocking, p-FAK(Y861)(SC-16663), p-FAK(Y577)(SC-16665), c-Src(SC-8056), STAT3(SC-8019), p-AKT1 / 2 / 3(S473)(SC-7985), STAT5(SC-835), Lamininγ2(SC-393225), COL1A1(SC-28657), CCL5(RANTES)(SC-514019), and CCL20(MIP-3α) were added. SC-517441), SIRT1 (SC-74465), ChREBP (SC-515922), SREBP1 (SC-366513), DGAT1 (SC-271934), DGAT2 (SC-293211), MICA / B (SC-137242), SLAMF7 (SC-390840), α-tubulin (SC-5286), β-actin (SC-47778), FUCA (SC-365496) (all from Santa Cruz Biotech, USA), p-FAK (Y397) (cat#611723), FAK (cat#610088), p27 (cat#610242) (all from BD). Transduction (USA), p-FAK(Y925)(#3284), p-Src(Y416)(#2101), p-STAT3(Y705)(#9145), p70S6K1(#9202), p-p70S6K1(T389)(#9205), p-STAT5(Y694)(#9314), ACC(#3676), FASN(#3189), CPT1A(#12252), p-ACC(S79)(#11818), HA(#3724), PD-L1(#13684), PD-1(#86163), p-ERK1 / 2(T202 / Y204)(#9101s), ERK1 / 2(#9102s) (The above are from Cell Signaling Tech.)Primary antibodies against the following antibodies were used: pS10p27(S10)(ab62364), human SLAMF6(ab224201), TIGIT(ab233404), CD34(ab81289) (all from Abcam, UK), mouse SLAMF6(PA5-87823), NKG2D(PA5-102038) (all from Thermofisher, USA), α-SMA (Sigma Aldrich, A5228), CCL2 (Invitrogen, MA5-17040), CD155(PVR) (Biolegend, 337601), HA (Biolegend, USA), Strep-HRP (horse-radish peroxidase), StrepMAB-HRP (IBA, USA), and AFP (FineTest, FNab00203). The reaction was carried out at 4°C for 15 hours. The following day, after adding the secondary antibody, the reaction was developed on X-ray film using an enhanced chemiluminescence reagent (ECL, Pierce, USA). Anti-TM4SF5C-ter (epitope region of RKKQDTPH197) and anti-TM4SF5EC2 (CLMNGEWGYHFEDTAGA130) were custom-made by a specialized antibody customization company (Pro-Sci, Poway, CA, USA).

[0422] 1.14. Immunofluorescence microscopy for quantitative analysis of localization changes

[0423] After placing coverslips in each well of a 12-well plate, 10 μg / ml fibronectin (35600, BD Biosciences) diluted in phosphate-buffered saline (PBS) was added for coating, and the plate was incubated at room temperature for 1 hour. Cells were then washed three times with PBS, and 20,000 cells were seeded onto each coverslip and cultured at 37°C for 16 hours. Following culture, the aforementioned expression vectors were transfected using liposome transfection reagent (Lipofectamine 3000, L3000015, Invitrogen). After 24 hours of culture, cells were treated with or without isoxazole for 24 hours. Cells were fixed with cold 99% methanol at room temperature for 15 minutes and then blocked with 1% bovine serum albumin (BSA) in PBS for 1 hour. Primary antibodies anti-FLAG (NB600-344, Novus Biologicals), anti-LAMP1 (#9091, Cell Signaling Tech.), anti-ZO-1 (402200, Invitrogen), anti-HA (901515, BioLegend), and anti-SLAMF7 (sc-390840, Santa Cruz Biotech.) were diluted 1:500 in 1% BSA in PBS and reacted at 4°C for 16 hours. The next day, after washing the coverslips three times with PBS, fluorescently labeled secondary antibodies Alexa Fluor 488 [goat: A11055 and mouse: A21202] and 555 [goat: A21432 and mouse: A31570] (Invitrogen) were diluted 1:500 in 1% BSA in PBS and reacted at room temperature for 1 hour. The slide was then washed three times with PBS and mounted using ProLong™ Gold Antifade (P36930, Invitrogen).Cell images were randomly captured using a Nikon EclipseTi microscope equipped with a C2 confocal system. The images were analyzed using image analysis software (NIS-Elements software, Nikon, Melville, NY, USA), and colocalization between SLAMF7 and LAMP1 or ZO-1 was calculated using Pearson's correlation coefficients. All images were captured under the same software settings and corrected using the same method using image processing software (Adobe Photoshop). Each point in the image represents the measurement result from a single cell.

[0424] 1.15. Immunoprecipitation assay

[0425] Cells were cultured at approximately 60% confluency in a 37°C, 5% CO2 incubator, and then transfected with polyethyleneimine (PEI). The cells were then cultured for another 2 days at 37°C. Cell extracts were obtained following the above method. The target protein was precipitated from the cell extract using immunoprecipitation, and the bound protein was confirmed using Western blot analysis. Specifically, cells cultured for 2 days in 100mm cell culture dishes were washed twice with phosphate-buffered saline (PBS), and 500 μl of immunoprecipitation lysis buffer (0.5% Triton X-100 or Brij 58, 40 mM HEPES, 150 mM NaCl, 1 mM EDTA, pH 7.4) was added, along with a protease inhibitor cocktail (GenDepot, USA). The mixture was then incubated at 4°C for 15 minutes. After collecting the cells, centrifuge at 12,000×g for 15 minutes at 4°C. Transfer the supernatant to a new microcentrifuge tube to obtain the cell extract. Quantify the protein using BCA reagent (Thermo Scientifics, USA). Take a portion of the quantified sample, add 4×Laemmli sample buffer, and boil at 100°C for 5 minutes to prepare the electrophoresis sample. For immunoprecipitation, add streptavidin agarose resin (Thermo Fisher Scientific) or agarose beads coated with anti-HA antibody according to the quantitative protein amount. Rotate at 4°C for 4 hours, then centrifuge at 7,000×g for 5 minutes at 4°C and discard the supernatant. Add sufficient fresh lysis buffer, mix gently, and centrifuge again at 7,000×g for 5 minutes at 4°C and discard the supernatant. The procedure was repeated twice with lysis buffer and twice more with cold PBS. Then, 2× sample buffer was added, and the sample was boiled at 100°C for 5 minutes. The samples prepared as described above were then subjected to Western blot analysis using the aforementioned primary antibodies.Primary antibodies used included EGFR (SC-03), CD44 (SC-7287), IL-6Rα (SC-661), MICA / B (SC-137242), SLAMF7 (SC-390840) (all from Santa Cruz Biotech, USA), CD133 (#5860), mTOR (#2983), GLUT1 (#12939), GLUT4 (#2213), FLAG (#2368), PD-L1 (#13684) (Cell Signaling Technology, USA), SLAMF6 (ab224201), TIGIT (ab233404), PD-L1 (#205921) (Abcam, UK) or Integrin α5 (Merck Millipore, MAB1956Z). Appropriate secondary antibody solutions were then added for reaction, and Western blot analysis was performed.

[0426] 1.16. Real-time reverse transcription PCR (qRT-PCR)

[0427] After lysing cells or tissues using Qiazol (Qiagen, USA), chloroform was added, and the mixture was centrifuged at 12,000×g, 4°C for 15 minutes to separate the layers, separating the upper organic layer. Isopropanol was added to the separated organic layer to precipitate RNA, followed by washing with 70% ethanol. The RNA pellet was separated by centrifugation at 7,500×g for 5 minutes, and after evaporating the ethanol for 10 minutes, it was dissolved in 30 μl of DEPC-water. The dissolved RNA was reverse transcribed using a reverse transcription kit (Toyobo, Japan) to remove genomic DNA (gDNA) and obtain cDNA. The expression level of the obtained cDNA was determined using a real-time PCR instrument (BiRaOd, USA) with 2×Eva green master mix (Labopass, South Korea) and 0.4 μM forward / reverse primers. The expression level was calculated using the modified delta-delta Ct method by Pfaffl. The primer sequences used for qRT-PCR are listed in Table 1.

[0428] 1.17. H&E staining

[0429] After sectioning the paraffin-embedded blocks, they were placed on glass slides and fixed at 60°C for approximately 20 minutes. To separate the tissue from the paraffin, the sections were immersed in xylene three times, 5 minutes each time. Subsequently, they were sequentially immersed in 100% → 90% → 80% → 70% ethanol → distilled water for 3 minutes each, followed by immersion in hematoxylin solution for 5 minutes. After thorough rinsing with tap water, they were reacted in eosin solution for approximately 5 minutes, and then rinsed with tap water again. Afterward, they were sequentially immersed in 70% → 80% → 90% → 100% ethanol → xylene for 3 minutes each for dehydration, and finally mounted.

[0430] 1.18. Masson's Trichrome Staining

[0431] Liver tissue was stained using a Trichrome Stain Kit (Connective Tissue Stain) (ab150686, Abcam, UK). First, the tissue was separated from paraffin and reacted in preheated Bouin's solution for 1 hour. It was then rinsed with tap water until the solution was completely removed, reacted in hematoxylin solution for 10 minutes, and rinsed again with tap water. Next, it was reacted in biebrichscarlet-acid fuchsin solution for 5 minutes, placed in distilled water, and reacted in phosphotungstic / phosphomolybdic acid solution for 15 minutes. Finally, it was treated in aniline blue solution for 10 minutes, in 1% acetic acid for 1 minute, dehydrated, placed in xylene, and mounted.

[0432] 1.19. Immunohistochemistry

[0433] After obtaining IRB approval, experiments were conducted using multiple primary antibodies to perform immunohistochemical staining on animal liver tissue. Paraffin-embedded blocks and liver tissue sections were obtained through a commissioned service from Abion Inc. (Seoul, Korea), or stained in-house using the standard methods described above. The primary antibodies used include: COL1A1 (SC-28657), Lamininγ2 (SC-393225), p-STAT3 (Y705) (9145), Ki67 (SC-23900), CCL20 (MIP-3α) (SC-517441), CCL5 (RANTES) (SC-514019), human / mouse SLAMF7 (CS1) (sc-390840) (all from Santa Cruz Biotech, USA); ACC (#3676), FASN (#3189), F4 / 80 (#70076), PD-L1 (#13684), PD-1 (#86163), human TIGIT (#99567) (all from Cell Signaling Technology, USA); human / mouse NKG2D (PA5-102038, Thermo Fisher, USA); mouse TIGIT (ab233404, Abcam, UK); AFP (FineTest, FNab00203); CCL2 (Invitrogen, MA5-17040); and human TM4SF5-EC2 (commercial product, Pro-Sci, USA).

[0434] 1.20. Flow cytometry analysis of NK92 cell line

[0435] Human NK92 cell lines were infected with either an empty expression vector (EV) or a lentivirus expressing TM4SF5-HA to construct a stable NK92-TM4SF5 cell line expressing TM4SF5-HA. The cultured NK92-EV and NK92-TM4SF5 cells were centrifuged at 150×g for 5 minutes, and NK cells were collected. For drug treatment, DMSO or the drug was added to the cell culture medium [α-Minimum Essential Medium (MEM) (Invitrogen, Grand Island, NY, USA), containing 200 U / mL recombinant human interleukin (IL)-2 (PeproTech, Rocky Hill, NJ, USA), 12.5% ​​fetal bovine serum (FBS), and 12.5% ​​fetal horse serum (GenDEPOT Inc.)] at the specified concentration and thoroughly mixed to prepare a vehicle or drug-containing medium. After centrifugation, the culture medium is removed by a suction device, and the isolated NK cells are resuspended in a vehicle or drug-containing culture medium. The same number of cells are then placed in culture containers for normal culture.

[0436] NK cells were isolated by centrifugation at 150×g for 5 minutes 24 hours after drug treatment. After removing the supernatant culture medium, the cells were washed twice with PBS. 1×10⁻⁶ cells were collected from each experimental group. 6 NK cells were stained with an SLAMF7 antibody (PE / Cyanine7 anti-human CD319, Cat: 331816) conjugated with the fluorescent dye PE-Cy7 for 20 minutes at room temperature in the dark. To detect changes in SLAMF7 expression in NK92-EV or NK92-TM4SF5 cells after DMSO or drug treatment, flow cytometry analysis was performed using a MACSQuant Analyzer 10 (Miltenyi Biotec).

[0437] 1.21. Evaluation of NK cell natural killer efficacy

[0438] When human hepatocellular carcinoma cells Huh7 reached a density of 60–70% in the culture vessel, pSpCas9(BB)-2A-Puro(PX459)V2.0 (Plasmid #62988, Addgene) was transfected into the cells using polyethylenimine (408727, Sigma-Aldrich) to introduce the Cas9 gene. Subsequently, as a control gRNA sequence for AAVS1 (adeno-associated virus integration site 1), 5'-GGGCCACTAGGGACAGGAT-3' was used; for knocking out the TM4SF5 gene (exon 2), the following gRNA sequences were used: 5'-TCCGGGGATTGCAGCCGTT-3' (#1), 5'-ATTGCAGCCGTTCGGGCAG-3' (#2), and 5'-GATTGCAGCCGTTCGGGCA-3' (#3). Twenty-four hours later, 2 μg / mL puromycin was added to the cell culture medium for 3 days to screen for knockout (KO) cells. Subsequently, Huh7KO cells with TM4SF5 gene KO were infected with retroviruses expressing pBabe-HA-EV or pBabe-HA-TM4SF5 to establish stable cell lines. Then, Huh7KO-EV cells or Huh7KO-TM4SF5 cells (target cells, T) were resuspended in 50 μL of DMEM containing 1% fetal bovine serum (FBS); NK92-EV cells or NK92-TM4SF5 cells (effector cells, E) were resuspended in MEM-α containing 1% FBS, adjusting the cell number to 0.015625 × 10⁻⁶ cells. 5 0.03125×10 5 0.0625×10 5 and 0.125×10 5Cells / mL were used to achieve E:T ratios of 1.25:1, 2.5:1, 5:1, and 10:1, with three replicate wells in 96-well plates. Cells were cultured at 37°C and 5% CO2 for 16 hours. Subsequently, to evaluate the natural killing efficacy of NK cells, a lactate dehydrogenase (LDH) cytotoxicity detection kit (Cytotoxicity Detection Kit Plus, Roche) was used. LDH activity was measured using a microplate reader (SpectraMax i3x, Molecular Devices) at 492 nm and 690 nm wavelengths. Killing efficacy was calculated according to the manufacturer's instructions using the following formula: [LDH(effector-target cell mix) - LDH(effector cell) - LDH(target cell low control)] / [LDH(target cell high control) - LDH(target cell low control)] × 100.

[0439] 1.22. Adoptive transfer model

[0440] To perform the adoptive transfer experiment of NK92 cells, severely immunodeficient NOD-SCID mice (NOD.CB17-Prkdc^scid / J, Orient Bio Inc., Seongnam-si, Korea) were used. At 6 weeks of age, they were subcutaneously injected with 5 × 10⁻⁶ cells. 5 Seven days after SNU449T7 cell injection, 5 × 10⁵ SNU449T7 cells were injected via tail vein. 6 NK92-EV cells or NK92-TM4SF5 cells were injected weekly for a total of 5 times; tumor volume was measured every 3 days. Mice were sacrificed the day after the completion of the 5 NK92 cell injections, and liver tissue was collected for analysis using immunohistochemical staining.

[0441] 1.23. Binding analysis of TM4SF5 or PD-L1 with radiolabeled cholesterol and isoxazole ST-5-002

[0442] SNU761 cells and HEK293FT cells that do not express TM4SF5 were transfected with Strep-EV, Strep-TM4SF1, TM4SF5, or a TM4SF5 mutant, respectively; or Huh7 cells were transfected with Strep-PD-L1 or a PD-L1 mutant. Stable cell lines were established by infecting Huh7KO cells with retroviruses expressing pBabe-HA-EV or pBabe-HA-TM4SF5. After obtaining the cell extract, anti-HA antibody was added to the extract containing 0.2 or 0.25 mg of protein for immunoprecipitation (pulldown) of HA-tagged TM4SF5, or streptavidin agarose resin was used to pull down Strep-tagged PD-L1 (Strep-PD-L1) or Strep-tagged TM4SF5 (Strep-TM4SF5) at 4°C for 2 hours. Subsequently, under conditions with or without cold ST-5-002 (400 μM), ¹ 4 C mark ST-5-002 (¹) 4 After reacting with C-labeled ST-5-002 (10 or 25 μM) at 4°C for 1 hour, the radioisotope values ​​were repeatedly determined using a liquid scintillation counter (TriCarbscintillation counter, PerkinElmer, Waltham, MA).

[0443] After transfecting HEK293FT cells with Strep-EV or Strep-TM4SF5 expression vectors, or culturing Huh7KO cells stably expressing pBabe-HA-EV or pBabe-HA-TM4SF5, cell extracts were obtained. Strep-labeled TM4SF5 was treated with streptavidin-agarose resin or HA-labeled TM4SF5 with anti-HA antibody at 4°C for 4 hours for pull-down treatment. Different concentrations of ¹ were added to the pull-down protein. 4C-labeled ST-5-002 (10 nM, 100 nM, 1 μM, 5 μM, 10 μM, 50 μM) was reacted at 4 °C for 1 hour, and the radioisotope values ​​were repeatedly measured using a TriCarb scintillation counter. The average value of the measured TM4SF5 radioisotopes was normalized by dividing by the average value of the EV, and the half-maximum effective concentration (EC50) was calculated.

[0444] 1.24. Immunofluorescence microscopy analysis of cells

[0445] SNU449-TM4SF5 cells overexpressing TM4SF5 were seeded onto coverslips pre-coated with collagen type I (10 μg / ml). After culturing for 15 hours, PD-L1-HA cDNA was transfected using Transfectamine 3000 (Thermo Fisher). In SNU761-HA-EV or SNU761-HA-TM4SF5 cells, FLAG-SLAMF7 wild-type cDNA, N-glycosylation site amino acid mutants [1NQ (N204Q) or 3NQ (N172 / 176 / 204Q)], or deletion mutants [△ECD] were transfected, respectively. 1-225 (Mutant with deletion of the extracellular domains of amino acids 1-225), △TM 226-247[Mutant with deletion of transmembrane amino acids 226-247] cDNA. 1-2 days after transfection, cells were treated with 2.5 μM dimethyl sulfoxide (DMSO), ST-5-001, or ST-5-002 for 24 hours. Cells were then fixed with cold methanol for 10 minutes, followed by permeabilization with 0.5% Triton X-100 at room temperature for 10 minutes. After washing twice with cold phosphate-buffered saline (PBS), 4',6-diamidinyl-2-phenylindole (DAPI) was added for nuclear staining, along with primary antibodies (TM4SF5EC2, PD-L1, LAMP1, or SLAMF7 antibody). The cells were incubated at 4°C for 15 hours, followed by washing three times with PBS. Secondary antibody was added, and the reaction was carried out at room temperature for 30 minutes (LAMP1 was labeled with tetramethylrhodamine isothiocyanate (TRITC) fluorescently; TM4SF5 was labeled with TRITC or Alexa Fluor® 488 fluorescently; PD-L1 or SLAMF7 was labeled with fluorescein isothiocyanate (FITC)). Finally, the expression level of fluorescence signal, subcellular localization, and colocalization (indicated by yellow signal) were observed using a confocal fluorescence microscope.

[0446] Experiment Example 2. Experimental Results.

[0447] 2.1. The inhibitory effect of isoxazole on the phosphorylation of TM4SF5 expression-dependent signal transduction factors was confirmed (Figure 2).

[0448] Cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) were obtained separately. Cell extracts were collected before and after treatment with ST-1-024 or ST-1-025 (at the concentrations shown) for 24 hours. Western blot analysis was performed on various TM4SF5 expression-dependent phosphorylation and activity-enhanced signal transduction factors.

[0449] The results show that ( Figure 2aCompared to SNU449Cp cells, SNU449T7 cells showed significantly increased phosphorylation levels of focal adhesion kinase (FAK), c-Src, signal transduction and transcription activator 3 (STAT3), and p27. However, treatment with ST-1-025 significantly reduced the phosphorylation levels of these proteins, with a decreasing trend consistent with the positive control drug [4-(p-toluenesulfonyl-amido)-4-hydroxychalcone, 4'-(p-toluenesulfonyl)-4-hydroxychalcone]. The positive control drug was the TM4SF5-specific inhibitor TSAHC (see Korean Patent No. 10-0934706).

[0450] Therefore, the isoxazole compound can inhibit the phosphorylation of TM4SF5 expression-dependent signal transduction factors to a certain extent, indicating its potential application value as a specific inhibitor of TM4SF5.

[0451] 2.2. Confirmation of the inhibitory effect of isoxazole on TM4SF5 expression-dependent two-dimensional and three-dimensional cell growth / proliferation (Figure 3)

[0452] Equal numbers of cells not expressing TM4SF5 (SNU449Cp) and cells expressing TM4SF5 (SNU449T7) were cultured separately in conventional cell culture containers in a two-dimensional culture (2D culture) or a three-dimensional culture (3D culture) system. Changes in cell number or sphere formation and proliferation were observed using an optical microscope. Positive control drugs TSAHC or isoxazole compound ST-1-025 were used for treatment at the indicated concentrations. From the start of culture (day 0), ( Figure 3a Under two-dimensional culture conditions, the drug was treated every 24 hours, and the cell count was measured; Figure 3b In a three-dimensional culture environment, the drug was treated once at a concentration of 5 μM at the beginning of the culture, and the proliferation of spheres was observed and photographed using an optical microscope on days 5 and 7, respectively. On the other hand, ( Figure 3c Under three-dimensional culture conditions, the drug was repeatedly treated at the indicated concentration on days 0, 3 and 6, and the proliferation of spheres was observed on day 7.

[0453] The experimental results showed that: (a) In a two-dimensional culture environment, the growth or proliferation of SNU449T7 cells was significantly reduced after treatment with ST-1-025, similar to the inhibitory trend of the positive control drug TSAHC; however, no significant difference was observed in SNU449Cp cells before and after drug treatment. (b) In a three-dimensional culture environment, after treatment with the drug at a concentration of 5 μM at the beginning of culture, spheroid proliferation was observed on days 5 and 7. The results showed that both TSAHC and ST-1-025 had a certain degree of inhibitory effect on spheroid formation and proliferation of SNU449T7 cells; while SNU449Cp cells did not form obvious spheroid structures. In the case of SNU449Cp, it was confirmed that no sphere morphology was formed. (c) In a three-dimensional culture environment, after repeated drug treatment on days 0, 3, and 6, spheroid proliferation was observed on day 7. The results showed that although the inhibitory effect of ST-1-025 was weaker than that of TSAHC, it exhibited a certain degree of concentration-dependent inhibition on the proliferation of SNU449T7 cells; SNU449Cp cells still did not form spheroid structures. In the case of SNU449Cp, it was confirmed that no sphere morphology was formed.

[0454] Therefore, the isoxazole compound can inhibit the survival / proliferation of TM4SF5-dependent two-dimensional and three-dimensional cells and spheroids to a certain extent, indicating its potential application value as a TM4SF5-specific inhibitor. However, the results of this study also suggest that further structure-activity relationship (SAR) studies are still necessary to screen for compounds with higher TM4SF5-specific inhibitory activity.

[0455] 2.3. Confirmation of the inhibitory effect of isoxazole treatment on the binding of TM4SF5 to multiple cell membrane receptors ( Figure 4 )

[0456] In SNU449 hepatocytes stably transfected with either the control expression vector (empty vector, EV) or the TM4SF5 expression vector (TM), under normal serum-containing culture conditions, cells were treated with either the vector control (DMSO) or ST-1-025 (3 μM) for 24 hours. After treatment, cell lysate was obtained, and pull-down assays were performed using streptavidin agarose resin (Thermo, XA335631). Subsequently, Western blot analysis was performed using the indicated antibody.

[0457] The results showed that, compared with SNU449 control cells that did not express TM4SF5, cells expressing TM4SF5 could bind to epidermal growth factor receptor (EGFR), adhesion molecule CD44 (cluster of differentiation 44), and glucose transporter type 4 (GLUT4). Compared with the vector control (DMSO) treatment, ST-1-025 treatment slightly inhibited the binding of TM4SF5 to EGFR, CD44, and GLUT4.

[0458] Therefore, although the inhibitory effect was weak, the results showed that isoxazole compounds could inhibit the binding of TM4SF5 to important membrane receptors involved in cell survival, proliferation and metastasis to a certain extent. This result further suggests that in order to enhance the potential of isoxazole compounds as TM4SF5 specific inhibitors, more in-depth structure-activity relationship (SAR) studies are needed to screen for candidate compounds with higher TM4SF5 specific inhibitory activity.

[0459] 2.4. Confirmation of the inhibitory effect of isoxazole on TM4SF5 expression-dependent phosphorylation of signal transduction factors and three-dimensional sphere proliferation (Figure 5).

[0460] (a) Cells not expressing TM4SF5 (SNU449Cp) and cells expressing TM4SF5 (SNU449T7) were treated with vehicle (DMSO), TSAHC, and isoxazole compounds ST-2-001, ST-2-002, ST-2-003, ST-2-004, ST-2-005, ST-2-006, ST-2-007, ST-2-008, ST-2-009, ST-2-010, or ST-2-011 at 5 μM for 24 hours, and cell extracts were obtained. Western blot analysis was then used to detect TM4SF5 expression-dependent phosphorylation and increased activity of signal transduction factors. (b) In normal cell culture containers, cells not expressing TM4SF5 (SNU449Cp) or cells expressing TM4SF5 (SNU449T7) were cultured in equal numbers for three-dimensional propagation, and the proliferation of the spheres was observed using an optical microscope. On days 0 and 3 of culture, cells were treated with DMSO (vehicle), TSAHC, or the drug ST-2-001 at a concentration of 2.5 μM, respectively, and the proliferation of the spheres was observed using an optical microscope on day 6. (c) After treating SNU449Cp cells and SNU449T7 cells with DMSO (vehicle), the positive control TSAHC, or ST-2-001 at the given concentrations for 24 hours, cell extracts were obtained and Western blot analysis was performed.

[0461] The results showed that (a) compared with SNU449Cp, phosphorylation of FAK, c-Src, STAT3, and p27 was increased in SNU449T7 cells; however, phosphorylation of signal transduction factors decreased when treated with ST-2-001, to a degree similar to that of the positive control TSAHC. (b) SNU449Cp did not form sphere structures. However, in SNU449T7, compared with the control group, cell proliferation was inhibited after treatment with ST-2-001, with an effect similar to that of TSAHC treatment. (c) compared with SNU449Cp, phosphorylation of FAK, c-Src, STAT3, p27, S6K1, and AKT was increased in SNU449T7 cells; however, phosphorylation of these factors decreased in a drug concentration-dependent manner when treated with TSAHC or ST-2-001. This confirms that ST-2-001, similar to TSAHC, has the efficacy of inhibiting the phosphorylation of multiple signal transduction factors that are dependent on the expression of TM4SF5.

[0462] Therefore, when analyzing the efficacy of the SAR (structure-activity relationship) optimized isoxazole compound in inhibiting phosphorylation of TM4SF5 expression-dependent signal transduction factors and three-dimensional cell survival / proliferation, it was confirmed that ST-2-001 exhibited inhibitory efficacy similar to that of the chalcone-based TM4SF5-specific inhibitor TSAHC, thus confirming the possibility of isoxazole compound as a TM4SF5-specific inhibitor.

[0463] 2.5. Confirmation of the inhibitory effect of isoxazole treatment on the binding of TM4SF5 to various cell membrane receptors and signaling factors ( Figure 6 )

[0464] SNU449 hepatocytes stably transfected with the control expression vector (empty vector, EV) or the TM4SF5 expression vector (TM) were treated with vehicle (DMSO) or 5 μM ST-2-001 for 24 hours under normal serum-containing culture conditions. Cell extracts were then obtained and pulled down using streptavidin agarose resin (Thermo, XA335631). Finally, Western blot analysis of various membrane receptors was performed using the provided antibodies.

[0465] The results showed that, compared with SNU449 control cells that did not express TM4SF5, cells expressing TM4SF5 bound to EGFR, integrin α5, CD133, CD44, mTOR, IL-6Rα, GLUT1, and GLUT4. However, compared with vehicle treatment, treatment with ST-2-001 inhibited the binding of TM4SF5 to the above factors.

[0466] Therefore, when the isoxazole compound optimized by SAR (structure-activity relationship) was analyzed from the perspective of its efficacy in inhibiting the binding of TM4SF5 to membrane receptors and signal transduction factors important for cell survival / proliferation / migration, it was confirmed that ST-2-001 exhibited protein-protein binding inhibition efficacy similar to that of the chalcone-based TM4SF5 specific inhibitor TSAHC, thus confirming the possibility of isoxazole compounds as TM4SF5 specific inhibitors.

[0467] 2.6. Confirm the inhibitory effect of isoxazole on TM4SF5-dependent cell migration. Figure 7 )

[0468] SNU449-EV cells injected with the control vector (empty vector, EV) without TM4SF5 expression and SNU449-TM4SF5 cells stably injected with the TM4SF5 expression vector (TM) were seeded at a density of 40% in 8-well plates pre-coated with type I collagen (10 μg / ml). Three hours after seeding under normal serum-containing culture conditions, cells were treated once with dimethyl sulfoxide (DMSO) and the drug ST-2-001 at concentrations of 2.5, 5.0, or 10.0 μM, respectively. For 17 hours after drug treatment, the same cell location was repeatedly photographed every 20 minutes to track cell migration distance and path (cellular tracking). The original positions of each cell were moved to the dots of concentric circles, and the migration paths of each cell were marked with lines of different colors.

[0469] The results showed that SNU449-TM4SF5 cells exhibited significantly increased migration compared to SNU449-EV cells treated with dimethyl sulfoxide (DMSO) vehicles. Conversely, SNU449-EV cell migration remained unchanged after treatment with ST-2-001, while in SNU449-TM4SF5 cells, ST-2-001 treatment confirmed a concentration-dependent decrease in cell migration.

[0470] Therefore, when the additional isoxazole compound obtained through structure-activity relationship (SAR) was analyzed from the perspective of its efficacy in inhibiting TM4SF5 expression-dependent cell migration, the drug ST-2-001 was confirmed to exhibit concentration-dependent inhibitory efficacy, thus confirming the possibility of isoxazole compound as a specific inhibitor of TM4SF5.

[0471] 2.7. The inhibitory effect of isoxazole on TM4SF5 expression-dependent non-alcoholic steatohepatitis (NASH) was confirmed (Figure 8).

[0472] Twenty-two-week-old normal C57BL / 6 mice were randomly divided into a normal chow diet (NCD) group and a methionine-choline deficient diet (MCD) group to induce non-alcoholic steatohepatitis (NASH), with 3-6 mice in each group. The mice were allowed free access to food for 4 weeks. Simultaneously, the mice were administered vehicle (dimethyl sulfoxide, DMSO) or ST-2-001 twice weekly via intraperitoneal injection (IP) at a dose of 5 mg / kg. After 4 weeks, liver tissue was harvested and subjected to Masson's trichrome staining to visualize the accumulation of type I collagen (the degree of fibrosis). Immunohistochemistry was performed using a given factor antibody. Stained liver tissue sections were randomly scanned using a digital slide scanner (Dualslidescanner, MoticEasyScan, Motic, British Columbia, Canada) to obtain representative images. Additionally, tissue extracts were obtained from selected liver tissue sections, and Western blotting or quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed on the given factors to confirm the mRNA and protein expression levels and phosphorylation degrees of signal transduction factors related to NASH-fibrosis symptom induction and T cell or natural killer cell (NK cell) activity regulation. Furthermore, in addition to animal models, the expression of TM4SF5, lamininγ2, and alpha-fetoprotein (AFP) was examined at the hepatocyte level to verify the correlation between these factors and to confirm whether they are regulated by isoxazole, a specific inhibitor of TM4SF5. In hepatocytes, SNU449-EV and Huh7-KO (knockout) that do not express TM4SF5, and SNU449-TM4SF5 and Huh7-Con that express TM4SF5, were treated with dimethyl sulfoxide (DMSO) or ST-5-002 for 24 hours under normal cell culture conditions. Then, real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed, or cell extracts were obtained and Western blots were performed.

[0473] The results showed that (a) no liver tissue abnormalities were found in animals fed a normal diet (NCD), and no non-alcoholic steatohepatitis (NASH) was observed. Treatment with dimethyl sulfoxide (DMSO) and the drug ST-2-001 had no effect on liver tissue or the expression of staining factors. Masson trichrome staining, which shows liver tissue morphology and collagen deposition, expression of collagen Iα1 (COL1A1) or lamininγ2 (LAMC2), acetyl-CoA carboxylase (ACC), fatty acid synthase (FASN), phosphorylation of signal transduction and transcription activator 3 (STAT3), and the staining degree of F4 / 80, which reflects macrophage activity and distribution, were all unchanged. However, compared with the normal diet (NCD) control group, the methionine-choline deficient diet (MCD) treatment group showed increased collagen I deposition and fibrosis symptoms. Furthermore, the expression of collagen I or laminin γ2, acetyl-CoA carboxylase (ACC), fatty acid synthase (FASN), STAT3 phosphorylation, and F4 / 80 staining were significantly enhanced, indicating significant non-alcoholic steatohepatitis (NASH) and liver fibrosis symptoms induced by the MCD diet. These NASH-fibrosis symptoms were significantly suppressed after treatment with the drug ST-2-001. (b) Western blot analysis of liver tissue extracts showed that the expression of alpha-smooth muscle actin (α-Sma), an important marker of fibrosis, alpha-fetoprotein (Afp), a clinical biomarker of liver cancer, and programmed death-ligand 1 (Pd-l1), known to inhibit the activity of immune cells such as T cells and natural killer cells, was increased in animals treated with the MCD diet compared to those treated with the NCD diet. Under NCD conditions, treatment with ST-2-001 slightly decreased the expression of these factors compared to DMSO treatment. On the other hand, in cases where the MCD diet induced NASH-fibrosis and significantly increased multiple factors, treatment with ST-2-001 decreased α-Sma, Afp, and Pd-l1.(c) Detection of fibrosis-related factors (expression of collagen Iα1, lamininγ2, and α-SMA, phosphorylation of STAT3), lipid synthesis and steatosis-related factors (Sirtuin 1 (SIRT1), fatty acid synthase (FASN), carbohydrate response element-binding protein (chREBP), sterol regulatory element-binding protein 1 (SREBP1), diacylglycerol O) using liver tissue extracts. [The expression and levels of diacylglycerol O-acyltransferase 2 (DGAT2), diacylglycerol O-acyltransferase 1 (DGAT1), acetyl-CoA carboxylase (ACC) and ACC phosphorylation, as well as the expression and levels of inflammation-related cytokines / chemokines CCL2 (C-CMotifChemokineLigand2), CCL5, and CCL20, were all increased in MCD conditions compared to NCD. This increase was reduced and inhibited after treatment with the drug ST-2-001. However, carnitine palmitoyltransferase 1 (CPT1), a factor associated with lipolysis, was increased after drug treatment in MCD diet conditions, indicating that it can inhibit fat accumulation. (d) Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed using liver tissue. Messenger RNA (mRNA) levels of lipid synthesis (Acc, Dgat2, Fasn) and Kupffer cell (Trem2, Tim4, Clec4f) activity in liver tissue macrophages were increased under a methionine-choline deficient (MCD) diet compared to a normal chow diet (NCD), and this increase was inhibited after treatment with the drug ST-2-001. (e.g., quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed after treating SNU449-EV or SNU449-TM4SF5 cells with the vehicle or 2.5 μM ST-2-001 for 24 hours.The levels of messenger ribonucleic acid (mRNA) of inflammation-related cytokines / chemokines CXC motif chemokine ligand (CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL10), CC motif chemokine ligand (CC motif chemokine ligand (CCL20, CCL2, CCL5), tumor necrosis factor alpha (TNF-α), interleukin-8 (IL-8), liver fibrosis (Lmac2, Col1A1), and natural killer cell (NK cell) activity-related factors (VCAM1, AFP, PD-L1, TIGIT, MICA, MICB, CADM1, ULBP1) were higher in SNU449-TM4SF5 cells than in SNU449-EV cells, and these increases were inhibited after treatment with the drug ST-2-001. (hi) On the other hand, in in vitro cell line models, compared with hepatocytes that do not express TM4SF5, cells expressing TM4SF5 showed higher levels of messenger ribonucleic acid (mRNA) and protein expression of lamininγ2 and alpha-fetoprotein (AFP). At the protein level, in addition to lamininγ2 and alpha-fetoprotein (AFP), which are known as biomarkers of liver cancer or are known to be highly expressed in liver cancer, phosphorylation of signal transduction and transcription activator 3 (STAT3) and increased expression of alpha-L-fucosidase 1 (FUCA) and CD34 were also confirmed. However, the increased expression of these factors was inhibited after treatment with ST-5-002.

[0474] Therefore, when analyzing the efficacy of additional isoxazole compounds obtained through structure-activity relationship (SAR) studies from the perspective of inhibiting the occurrence of non-alcoholic steatohepatitis (NASH) induced by TM4SF5 expression-dependent methionine-choline deficiency diet (MCD), it was confirmed that the drug ST-2-001 exhibited inhibitory activity or phenotype associated with NASH, thus confirming the possibility of isoxazole compounds as NASH inhibitors or anti-hepatic drugs that are specific inhibitors of TM4SF5. Furthermore, the expression of lamininγ2 and alpha-fetoprotein (AFP) is also increased by TM4SF5 in the precancerous stage of NASH-fibrosis, and this increase can be inhibited by treatment with isoxazole, a TM4SF5-specific inhibitor. Therefore, it is speculated that the efficacy of isoxazole can inhibit and regulate the progression and deterioration of NASH-fibrosis in the liver disease stage.

[0475] 2.8. The inhibitory effect of isoxazole on the phosphorylation of TM4SF5 expression-dependent signal transduction factors was confirmed (Figure 9).

[0476] (a) Cell extracts were obtained after treating cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) with a solvent (vehicle, DMSO), ST-2-001, or a ST-2-001-based derivative for 24 hours. (b) Cell extracts were obtained after treating SNU449Cp and SNU449T7 cells with DMSO, ST-2-001, ST-3-001, ST-3-006, ST-3-007, ST-3-010, or ST-3-011 at a concentration of 5 μM for 24 hours. (c) Cell extracts were obtained after treating SNU449Cp and SNU449T7 cells with DMSO, ST-2-001, ST-3-006, or ST-3-011 at the indicated concentrations for 24 hours. (ac) After drug treatment, Western blot was performed on the signal transduction factor with increased expression-dependent phosphorylation and activity of TM4SF5 using cell extract.

[0477] The results showed that, compared with SNU449Cp, phosphorylation of FAK, c-Src, STAT3, p27, S6K1, AKT, and STAT5 was increased in SNU449T7 cells (ab), but decreased after treatment with ST-2-001 and ST-3-01~012. Especially in SNU449T7 cells expressing TM4SF5, treatment with ST-3-006, ST-3-007, ST-3-010, or ST-3-011, similar to ST-2-001 (as shown in the red box), resulted in decreased phosphorylation of multiple signal transduction factors; however, in SNU449Cp cells not expressing TM4SF5, as shown in the blue box, phosphorylation of some signal transduction factors increased. (c) Compared with SNU449Cp, SNU449T7 cells showed increased phosphorylation of FAK, c-Src, STAT3, p27, S6K1, and AKT, but these phosphorylations decreased in a concentration-dependent manner after treatment with the drugs [ST-2-001, ST-3-006, and ST-3-011]. However, increased phosphorylation of some signal transduction factors was also observed in SNU449Cp cells that do not express TM4SF5.

[0478] Therefore, the isoxazole compound (ST-3-00X), obtained through further structure-activity relationship (SAR) studies to improve the properties of isoxazole, showed similar inhibitory efficacy to ST-2-001 in the analysis of its ability to inhibit phosphorylation of TM4SF5-dependent signal transduction factors, thus confirming the possibility of isoxazole compounds as specific inhibitors of TM4SF5. However, in cells that do not express TM4SF5, the phosphorylation of some factors (marked by blue boxes) showed an increased tendency.

[0479] 2.9. Confirmation of the inhibitory effect of isoxazole on TM4SF5 expression-dependent three-dimensional cell growth / proliferation (Figure 10).

[0480] In normal cell culture containers, equal numbers of cells not expressing TM4SF5 (SNU449Cp) or cells expressing TM4SF5 (SNU449T7) were cultured in three dimensions, and the proliferation of spheres was observed using an optical microscope. (a) On days 0 and 3 of culture, cells were treated with dimethyl sulfoxide (DMSO, vehicle) or drugs ST-2-001, ST-3-006, ST-3-007, ST-3-010, or ST-3-011 at a concentration of 0.5 or 2.5 μM, and the proliferation of spheres was observed using an optical microscope on day 6. (b) From the start of culture (day 0), cells were treated with DMSO (vehicle) or drugs at a concentration of 0.5 or 2.5 μM on days 3 and 6 of culture, and the proliferation of spheres was observed using an optical microscope on day 10. (c) Starting from the start of culture (day 0), on days 3 and 6 of culture, cells were treated with DMSO (vehicle) or drugs ST-3-006, ST-3-010 or ST-3-011 at a concentration of 0.1 or 1.0 μM. On day 10, the proliferation of cells (sphere) was observed by optical microscopy.

[0481] The results showed that (a, b) SNU449Cp cells did not form spheres, while SNU449T7 cells showed significant sphere proliferation. However, after treatment with ST-2-001, ST-3-006, ST-3-007, ST-3-010, or ST-3-011, the proliferation of three-dimensional cells was inhibited compared to the vehicle-treated group. ST-2-001, ST-3-006, and ST-3-010 were confirmed to have strong inhibitory effects on cell proliferation. (c) Compared to SNU449Cp, SNU449T7 cells showed stronger sphere-forming ability, but the proliferation of three-dimensional cells decreased after treatment with ST-3-006, ST-3-010, and ST-3-011.

[0482] Therefore, the isoxazole compound (ST-3-00X) obtained through further structure-activity relationship (SAR) studies to improve the pharmacological properties of isoxazole (ST-2-001), showed similar inhibitory effects to ST-2-001 in the efficacy analysis of inhibiting TM4SF5 expression-dependent three-dimensional cell survival / proliferation. This confirms the possibility of isoxazole compounds as TM4SF5-specific inhibitors for cancer metastasis inhibition.

[0483] 2.10. Confirmation of the inhibitory effect of isoxazole on TM4SF5-dependent xenograft hepatocellular carcinoma formation (Figure 11).

[0484] In 8-week-old male BALB / c-Nude mice (n=8, Orient, Seongnam, Republic of Korea), under conditions of free access to normal diet, cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) were introduced at a ratio of 1×10⁻⁶ per mouse. 7 Cells were administered via a single subcutaneous injection. Starting 7 days post-injection, ST-2-001, ST-3-006, or ST-3-011 were administered intraperitoneally at a dose of 5 mg / kg body weight every 3 days, for a total of 8 injections. Body weight and tumor volume were measured weekly. On day 31 post-injection, liver tissue was harvested under standard anesthesia, and the size of the hepatocellular carcinoma tissue was photographed. Subsequently, the tissues were randomly assigned to multiple groups for analysis including immunostaining, Western blotting, and quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR).

[0485] The results showed that (a) is a schematic diagram of the subcutaneous xenograft experimental method for TM4SF5-non-expressing and TM4SF5-expressing cell lines. (b) Images of the recovered tumor tissue after the experiment showed that ST-2-001 had the strongest inhibitory effect on hepatocellular carcinoma formation compared with the control group injected with the vehicle, while the inhibitory effects of ST-3-006 and ST-3-011 were relatively weaker than those of ST-2-001. (c) After subcutaneous cell injection, intraperitoneal injection of the drug was performed every 3 days, and body weight and tumor volume were measured weekly. Compared with the vehicle, the tumor volume of each drug treatment group was statistically significantly inhibited. (d) Three days after the last drug injection, a portion of tissue extract was obtained from the hepatocellular carcinoma tissue. Western blot analysis was performed to determine the phosphorylation of carcinogenesis-related signaling factors (FAK, STAT3, c-Src, Akt) and TM4SF5-related factor (p27). Compared with the vehicle-treated control group, the phosphorylation of each factor was significantly inhibited in the drug-treated group. (e) The expression of fibrosis-related factors (collagenI, lamininγ2, α-SMA, STAT3 phosphorylation), inflammation-related cytokines / chemokines (cytokine / chemokine, CCL2, CCL5, or CCL20), and alpha-fetoprotein (AFP), a biomarker for hepatocellular carcinoma, were all reduced in the drug-treated group compared to the vehicle group.

[0486] Therefore, ST-3-006 and ST-3-011, which were obtained through further structure-activity correlation (SAR) studies to improve the properties of isoxazole, showed similar inhibitory effects on liver cancer formation in subcutaneous xenograft-induced liver cancer in TM4SF5-dependent liver cancer cell lines compared to ST-2-001. This confirms the possibility of isoxazole compounds as anti-liver cancer inhibitors that are specific inhibitors of TM4SF5.

[0487] 2.11. The inhibitory effects of isoxazole on TM4SF5 expression-dependent phosphorylation of signal transduction factors and three-dimensional cell growth / proliferation were confirmed (Figure 12).

[0488] Cell extracts were obtained from cells not expressing TM4SF5 (SNU449Cp) and cells expressing TM4SF5 (SNU449T7) 24 hours before and after treatment with specified concentrations of ST-2-001, ST-4-005, ST-5-001, or ST-5-002. Western blotting analysis was performed on various TM4SF5 expression-dependent phosphorylation and activity-increasing signal transduction factors. Simultaneously, equal numbers of SNU449Cp and SNU449T7 cells were cultured in a three-dimensional culture environment and treated with the specified concentrations of the solvent (vehicle) or the aforementioned drugs on days 0, 3, 6, and 9. On day 10, the survival and proliferation of spheres were observed using an optical microscope.

[0489] The results showed that (a) compared with vehicle-treated SNU449Cp cells, vehicle-treated SNU449T7 cells exhibited increased phosphorylation of FAK, STAT3, c-Src, S6K1, Akt, and p27. However, these increases were inhibited by various drugs, with ST-2-001 and ST-4-005 inhibiting phosphorylation of STAT3, S6K1, and FAK under multiple conditions. (bc) When confirming sphere survival / proliferation in a three-dimensional culture environment, SNU449Cp cells did not form spheres, while spheres formed by SNU449T7 cells showed inhibited survival / proliferation after treatment with ST-2-001, ST-4-005, ST-5-001, or ST-5-002. (d) Compared with vehicle-treated SNU449Cp cells, vehicle-treated SNU449T7 cells showed increased phosphorylation of FAK, STAT3, c-Src, S6K1, Akt, and p27. However, this increase was inhibited by various drugs, with ST-2-001, ST-4-005, ST-5-001, or ST-5-002 all inhibiting phosphorylation. Particularly with ST-5-002, when treated with a purer version using the same method, its phosphorylation inhibition efficacy was maintained and further enhanced.

[0490] Therefore, in order to improve the physical properties of isoxazole ST-3-006 and ST-3-011 to make them more solid, further structure-activity relationship (SAR) studies were conducted to obtain isoxazole compounds ST-4-001~ST-4-007. Compared with ST-2-001, in the efficacy analysis of inhibiting phosphorylation of signal transduction factors and three-dimensional cell survival / proliferation in TM4SF5-dependent hepatocellular carcinoma cell lines, drug ST-4-005 showed a similar inhibitory effect to ST-2-001, thus confirming the possibility of isoxazole compounds as TM4SF5-specific inhibitors.

[0491] 2.12. It was confirmed that isoxazole compounds reduced the expression of TM4SF5-dependent ligands related to natural killer function in NK cells and inhibited their binding to TM4SF5 (Figure 13).

[0492] (ad) SNU449 or SNU761 cells that do not originally express TM4SF5 were transfected with an empty vector (EV) or a TM4SF5 vector to induce transient or stable expression. The same number of cells were then prepared in culture containers. After 24 hours, the cells were treated with a specified concentration of DMSO (vehicle) solvent and ST-1-025 or ST-5-002 drug. After 16 hours (overnight, O / N) or 24 hours of drug treatment, cell extracts were obtained for Western blotting. (e) In mouse xenograft experiments, liver tissue was obtained after treatment with DMSO (vehicle) or ST-5-002, and tissue extracts were obtained for Western blotting. (f) In NK92-EV or NK92-TM4SF5 cells, after treatment with DMSO (vehicle) or the drugs ST-2-001 (1 nM), ST-3-005 (10 nM or 1 μM), ST-5-001, or ST-5-002 (100 nM or 1 μM) for 24 hours, the expression of SLAMF7 on the cell surface was analyzed by flow cytometry immunostaining. The degree of SLAMF7 expression was confirmed by adding SLAMF7 antibody to bind to SLAMF7 and then measuring the fluorescence signal of the SLAMF7 antibody-linked cells by flow cytometry. (gj) After immunostaining SNU761-EV or SNU761-TM4SF5 cells, the co-localization (yellow staining) of TM4SF5 (red fluorescence) and SLAMF7 (green fluorescence) on the cell membrane was confirmed by fluorescence microscopy. Another group of cells was not treated in any way (hi), or was treated with DMSO (vehicle) or ST-5-001 (2.5 μM) for 24 hours (j). Cell extracts were obtained, and the Strep-TM4SF5 present in the extract was pulled down using streptavidin agarose resin (Streptavidinagaroseresin, Thermo, XA335631). Western blot was then performed using the corresponding antibodies to detect coexisting SLAMF7, SLAMF6, MICA, MICB, or CD155 (proteins that interact with TIGIT), confirming that the binding of TM4SF5 to the above molecules was inhibited by isoxazole treatment.

[0493] The results showed that (a) compared with SNU449-EV cells that did not express TM4SF5, the expression of stimulatory ligands MICA / B, SLAMF6, and SLAMF7, which activate NK cell natural killer function, was reduced in SNU449-TM4SF5 cells that expressed TM4SF5. (c) Unlike SNU449-EV cells, in SNU449-TM4SF5 cells, compared with the reduced expression in untreated cells, the expression of the above stimulatory ligands increased again after 24 hours of treatment with the drug ST-1-025 at a specified concentration. (d) Compared with SNU761-EV cells, the expression of SLAMF7 was also reduced in SNU761-TM4SF5 cells when treated with the solvent DMSO (vehicle). However, in SNU761-EV cells treated with ST-5-002, SLAMF7 expression decreased, while in SNU761-TM4SF5 cells, the previously decreased SLAMF7 expression level was either lessened or maintained at a higher level after treatment. (e) In animal liver tissue, ST-5-002 treatment increased the expression of SLAMF6, an activator of NK cell natural killer function, while decreasing the expression of TIGIT, an inhibitor of NK cell natural killer function. (f) Compared to untreated NK92-EV cells, SLAMF7 expression was decreased on the cell surface in NK92-TM4SF5 cells by measuring the median fluorescence intensity (Median FI), but its level increased again after each drug treatment. However, in NK92-EV cells, the changes induced by drug treatment were extremely slight. (g) Co-localization of TM4SF5 and SLAMF7 was confirmed by fluorescence microscopy, showing that they co-localize in the cell membrane region, thus confirming their binding ability. (hj) When TM4SF5 was pulled down using cell extract, SLAMF7, SLAMF6, MICA, MICB, or CD155 (TIGIT) were also pulled down in the presence of TM4SF5, confirming that TM4SF5 can bind to these molecules. Simultaneously, the binding of TM4SF5 to SLAMF7 was inhibited after treatment with ST-5-001 (j). This binding was also inhibited by treatment with isoxazole, a TM4SF5-specific inhibitor. Therefore, it is ultimately hypothesized that there is a correlation between this and the decreased expression of the aforementioned factors.

[0494] Therefore, when analyzing the effects of isoxazole treatment on the expression patterns of membrane proteins or related factors regulating NK cell activity in TM4SF5-dependent hepatocellular carcinoma cells and liver tissue, ST-5-002, which was a further structure-activity correlation (SAR) study of drugs ST-1-025 and ST-3-005, increased the expression of NK cell activating ligands / receptors SLAMF6, SLAMF7, MICA, MICB, and NKG2D at levels reduced by TM4SF5 expression. This suggests that isoxazole, as a TM4SF5-specific inhibitor, has the potential to act as an NK cell immune checkpoint inhibitor.

[0495] 2.13. In the indirect interaction environment between NK92 cells and hepatocytes, isoxazole compounds were confirmed to reduce the expression of TM4SF5-dependent NK cell natural killer-related ligands and inhibit their binding to TM4SF5. Figure 13b )

[0496] Human NK92 cells were infected with retroviruses that could induce the expression of pBabe-HA-EV or pBabe-HA-TM4SF5 to obtain stable NK92 cell lines. To construct an indirect interaction environment between NK92 cells and hepatocytes, conditioned media (CM) for NK cells was used to treat hepatocytes, or vice versa, to obtain cell extracts for analysis under indirect interaction conditions. (b, left) Stable NK92 cell lines were cultured under normal conditions for 2 days to obtain conditioned media (CM). On the other hand, in Huh7 cells, TM4SF5 knockout cell lines (Huh7KO) were treated with CM diluted to 20% of the Huh7KO culture medium when the expression of the control expression vector (empty vector, EV) or the TM4SF5 expression vector (TM) reached 70-80% confluence. Cell extracts were obtained 24 hours later, and Western blot was performed using the specified antibody. (b, right) CM cells obtained after culturing Huh7KO-EV or Huh7KO-TM4SF5(TM) cell lines for 2 days were diluted 20% in NK92 culture medium and used to treat NK92-EV or NK92-TM4SF5 cells. NK92 cell extracts were obtained 24 hours later and Western blot was performed.

[0497] The results showed that (b) under SLAMF7 and MICA / B conditions, the expression of SLAMF7, SLAMF6, NKG2D, and perforin was trending lower in the Huh7KO-EV cell line treated with NK92-EV or NK92-TM4SF5(TM) cells in CM, especially in the NK92-TM4SF5(TM) cell line (left). On the other hand, compared with NK92-EV cells treated with Huh7KO-EV or Huh7KO-TM4SF5 cell line CM, the expression of SLAMF7, SLAMF6, NKG2D, and perforin was lower in NK92-EV cells treated with the same CM (right).

[0498] Therefore, (b) when NK92 cells interact indirectly with hepatic (cancer) epithelial cells through CM treatment, the killing efficacy of NK92 cells may be reduced when each cell expresses TM4SF5 compared to when TM4SF5 is not expressed; especially when both cell types express TM4SF5, the killing efficacy of NK92 cells is further reduced.

[0499] 2.14. The importance of N-glycosylation of two proteins in the process of decreased SLAMF7 expression related to TM4SF5 expression-dependent NK cell natural killer function and its binding to TM4SF5 (Figure 14).

[0500] In SNU761 hepatocytes, expression was induced by introducing control vectors (Strep-EV), Strep-TM4SF5WT, or Gly- (N-linked glycosylation deletion N138A / N155Q mutant) expression vectors, or by simultaneously introducing FLAG-SLAMF7WT, △ECD1-225 (mutant with deletion of the extracellular domain of amino acids 1-225), △TM226-247 (mutant with deletion of the transmembrane domain of amino acids 226-247), 1NQ (N204Q), 2NQ (N172 / N176Q), or 3NQ (N172 / 176 / 204Q) expression vectors and co-culturing for 48 hours. After obtaining whole cell lysates, the cells were pulled down using streptavidin-agarose (20353, Thermo Fisher Scientific). Pull-down samples were subjected to Western blot along with cell extracts. (d) SNU761 cell lines were seeded onto coverslips coated with fibronectin (10 μg / ml, 35600, BDBiosciences) and cultured for 16 hours to allow adhesion. Subsequently, the HA-TM4SF5 expression vector and the FLAG-SLAMF7WT or FLAG-SLAMF7-1NQ or 3NQ (1NQ; N204Q, 3NQ; N172 / 176 / 204Q) N-linked glycosylation mutant expression vectors were introduced and cultured for 48 hours to induce expression. Cells were fixed with ice-cold 99% methanol for 15 minutes, then blocked with 1% BSA solution. Immunofluorescence staining was then performed using anti-HA (blue), anti-SLAMF7 (green), and anti-LAMP1 (red) antibodies, respectively, and observed using a Nikon Eclipse Ti microscope with a C2 confocal system. Representative images are shown under each experimental condition.

[0501] The results showed that (a) compared with the control EV, SLAMF7 was pulled down in the Strep-TM4SF5 pulldown sample, confirming that TM4SF5WT can bind to SLAMF7. However, the TM4SF5 N-linked glycosylation deletion mutant (Gly-) did not bind to SLAMF7. (b) On the other hand, ΔECD1-225SLAMF7 lacking the extracellular domain could still bind, but ΔTM226-247SLAMF7 lacking the transmembrane domain (amino acids 226-247) did not bind to TM4SF5. (c) When the N-linked glycosylated amino acid residues of SLAMF7 were mutated, the expression level was reduced in the WT case, but the expression level of SLAMF7 was not reduced in the 1NQ, 2NQ or 3NQ cases, and its binding to TM4SF5WT was reduced. (d) SLAMF7WT and TM4SF5WT showed colocalization in the perinuclear endosomal membrane region, but this colocalization was not significant in the SLAMF7N-linked glycosylation mutants (1NQ and 3NQ). On the other hand, 3NQ, unlike WT or 1NQ, exhibited the characteristic of forming isolated circular structures and showed that it was more localized in the intracellular liquid-liquid phase separation region.

[0502] Therefore, (ac) suggests that the binding of TM4SF5 to SLAMF7 depends on N-linked glycosylation at the N138 / N155 site of TM4SF5 and its surrounding structural factors, while N-linked glycosylation of SLAMF7 and its transmembrane domain also play important roles. (d) In hepatocellular carcinoma cells, TM4SF5, SLAMF7, and LAMP1 are co-localized in the endosomal membrane or lysosomal regions, suggesting that TM4SF5 may mediate the degradation of SLAMF7.

[0503] 2.15. Confirmation of the effects of isoxazole compounds on the reduction, degradation, and intracellular localization regulation of TM4SF5-dependent NK cell natural killer-related ligands (Figure 15).

[0504] (a) SNU761 cells expressing HA-EV or HA-TM4SF5 and FLAG-SLAMF7 were stored at 4°C and then cultured at 37°C for a specified time. Cell extracts were then obtained and Western blotted using the antibodies shown. (bc) SNU761 cells expressing HA-TM4SF5 and FLAG-SLAMF7 were immunostained with HA, FLAG, and LAMP1 or ZO-1 antibodies, respectively. The colocalization coefficient was calculated using Pearson's correlation (b). Each data point represents cell counts from three independent experiments; representative images are shown in the figure (c). (d) SNU761 cells expressing HA-EV / TM4SF5 and FLAG-SLAMF7 were treated with or without ST-5-002 and chloroquine (CQ, 10 μM) for 24 hours. Cell extracts were then obtained and Western blotted using the antibodies shown. (ef) SNU761 cells expressing TM4SF5-Strep and FLAG-SLAMF7 were treated with ST-5-002 (e) or ST-3-001 (f) for 24 hours, and cell extracts were obtained using Brij58 lysis buffer. Whole-cell lysis buffer was then used for streptavidin pull-down and immunoprecipitation. (gh) SNU761 cells expressing HA-TM4SF5 and FLAG-SLAMF7 were treated with ST-5-001 or ST-5-002 (2.5 μM, 24 h). Cells were then fixed with cold methanol and immunostained with the indicated antibodies. Representative images are shown in the figure (g). Colocalization coefficients were calculated using Pearson's correlation (h). Each data point represents cell counts from three independent experiments.

[0505] The results showed that (a) when SNU761 cells expressing TM4SF5 or not were placed at 4℃ and then transferred to 37℃, SLAMF7 expression increased over time in the case of no TM4SF5 expression, while SLAMF7 expression decreased instead of increasing in the case of TM4SF5 expression. (bc) In the control group without TM4SF5 expression, SLAMF7 was mainly localized and highly expressed on the plasma membrane (PM); however, with TM4SF5 expression, the expression / localization of SLAMF7 on the PM decreased, while its localization on the LAMP1-stained lysosomal membrane increased. (d) SNU761 cells were introduced with FLAG-SLAMF7 and HA-TM4SF5 or control HA expression vectors, and treated with ST-5-002 at a specified concentration for 24 hours, with or without simultaneous administration of chloroquine (CQ). After obtaining cell extracts, the expression patterns of SLAMF7 and the autophagy marker LC3B were detected. The results showed that the decrease in SLAMF7 caused by TM4SF5 expression tended to recover after ST-5-002 treatment; especially when CQ treatment was administered simultaneously, the decrease in SLAMF7 expression was not significant. (ef) The binding of TM4SF5 to SLAMF7 decreased with ST-5-002 treatment, and the previously decreased SLAMF7 expression in TM4SF5-expressing conditions (whole-cell lysate, WCL) increased again after drug treatment (e). However, when treated with the control drug ST-3-001, the binding of TM4SF5 to SLAMF7 did not decrease but instead tended to increase; and in WCL, SLAMF7 expression only decreased, without the recovery observed after ST-3-001 treatment (f). (gh) FLAG-SLAMF7 and HA-TM4SF5 or control HA expression vectors were introduced into SNU761 cells, and the cells were treated with dimethyl sulfoxide (DMSO), ST-5-001, or ST-5-002, respectively. Immunofluorescence staining was then performed on SLAMF7-FLAG (green), LAMP1 (red), and HA-TM4SF5 (blue), and the positional changes or degree of colocalization of FLAG-SLAMF7 and HA-TM4SF5 were quantitatively analyzed. Compared with DMSO treatment, the strong colocalization of SLAMF7 on the lysosomal membrane was significantly reduced after drug treatment, while its expression / localization level on the plasma membrane (PM) increased.

[0506] Therefore, (ac) with the binding of TM4SF5 to SLAMF7 and the localization and migration of TM4SF5 to the lysosomal membrane, the expression level of SLAMF7 decreases, and this phenomenon can be blocked by chloroquine (CQ), thus confirming that SLAMF7 is degraded in lysosomes. At this point, unlike the control drug ST-3-001, the TM4SF5-specific inhibitor ST-5-002 inhibits the degradation of SLAMF7 by suppressing this TM4SF5-mediated phenomenon. On the other hand, upon treatment with ST-5-001 or ST-5-002, the binding of SLAMF7 to TM4SF5 is dissociated, and the SLAMF7 is subsequently translocated from the lysosomal membrane to the plasma membrane (PM), thus no longer undergoing degradation.

[0507] 2.16. TM4SF5 expression leads to decreased natural killer function of NK cells (Figure 16).

[0508] Stable NK92 cell lines were established by infecting NK92 cells with retroviruses that induce the expression of pBabe-HA-EV or pBabe-HA-TM4SF5. Additionally, the SLAMF7 expression vector was introduced into Huh7KO-EV or Huh7KO-TM4SF5 cell lines to overexpress the cells (O / E). (ab) NK92-EV or NK92-TM4SF5 cells (Effector cells, E) and Huh7KO-EV or Huh7KO-TM4SF5 cell lines (Target cells, T) were mixed at the indicated E:T ratio in 96-well plates, with three replicates per group, and cultured for 4 hours. Subsequently, the cytotoxicity of NK92 cells was measured using a lactate dehydrogenase (LDH) cytotoxicity detection kit (Roche) according to its protocol. (c) Natural killer function / efficacy was determined using NK92(E) cells and Huh7KO-EV-SLAMF7(O / E) or Huh7KO-TM4SF5-SLAMF7(O / E) cells. (d) Perforin production was analyzed by flow cytometry in NK92-EV or NK92-TM4SF5 cells after staining with anti-Perforin antibody. (e.g., 5 × 10⁻⁶ SNU449T7 cells expressing TM4SF5 were used.) 5Subcutaneous injection of NK92-EV or NK92-TM4SF5 cells (5 × 10⁶ cells / mice) was administered to 6-week-old male NOD-SCID mice, starting one week later and once weekly for a total of 5 weeks. At week 11, NK92-EV or NK92-TM4SF5 cells (5 × 10⁶ cells / mice) were administered intravenously. 6 (cells / mice). Mice were sacrificed 24 hours after the fifth and final NK92 cell injection, and the tumors formed in the liver were analyzed and immunohistochemical staining was performed.

[0509] The results showed that (ab) NK92 cells exhibited lower natural killer (NMR) efficacy against Huh7KO-TM4SF5 cells than Huh7KO-EV cells. The same phenomenon was observed in NK92-TM4SF5 cells. NMR efficacy was lowest when NK92-TM4SF5 interacted with Huh7KO-TM4SF5. (c) However, when hepatocellular carcinoma cells overexpressed SLAMF7, the NMR efficacy of NK92 cells increased. (d) Perforin expression / production was decreased in NK92-TM4SF5 cells compared to NK92-EV cells. (eg) In a tumor model established by subcutaneous injection of hepatocellular carcinoma cells expressing TM4SF5, tumor volume and weight were higher when NK92-TM4SF5 cells were injected compared to NK92-EV cells. Furthermore, after injection of NK92-EV or NK92-TM4SF5 cell lines, since NOD-SCID mice are an NK cell-deficient model, immunohistochemical staining of SLAMF7 in their liver tissue showed similar results.

[0510] Therefore, the killing efficacy of (ad)NK92 cells against liver cancer cells is lower when NK92 cells or liver cancer (epithelial) cells express TM4SF5 than when they do not, suggesting that TM4SF5 expression in both liver cancer cells and NK cells may inhibit the natural killer function mediated by NK cell SLAMF7. Furthermore, in a tumor animal model established by subcutaneous injection of hepatocytes expressing TM4SF5, injection of NK92-TM4SF5 cells induced tumorigenesis more significantly than intravenous injection of NK92-EV cells, indicating that NK cells expressing TM4SF5 have reduced anti-tumor natural killer efficacy.

[0511] 2.17. Confirmation of the TM4SF5-dependent inhibition of PD-L1 expression and binding by isoxazole compounds (Figure 17)

[0512] (ab) Seed the same number of SNU449-EV or SNU449-TM4SF5 cells in culture containers and culture overnight (O / N). After replacing with fresh normal culture medium, treat vehicle, CCL2, CCL5, CCL20, TNFα, or IFNγ at a concentration of 15 ng / ml for 24 hours, respectively. Obtain cell extracts and perform Western blot analysis using the indicated antibodies; or pull down TM4SF5-strep using streptavidin agarose resin and then perform Western blot analysis on coexisting PD-L1 using its antibody to confirm the binding of TM4SF5 to PD-L1. (cd) In SNU449 cells stably expressing EV or TM4SF5, further introduce PD-L1-HAcDNA. One day later, cell extracts were obtained after treatment with DMSO, TSAHC (chalcone-based positive control drug), ST-5-001, or ST-5-002 at 2.5 μM for 24 hours. Strep-TM4SF5 was pulled down from the cell extract using strep-agarosebead, followed by Western blotting with an antibody against the protein. Alternatively, TM4SF5 (red fluorescence) and PD-L1 (green fluorescence) were detected by immunostaining, and DNA staining was performed using DAPI. Fluorescence microscopy was then used to confirm the intracellular localization and expression levels.

[0513] The results showed that (a) when treated with DMSO as the solvent control (vehicle control), PD-L1 expression was increased in SNU449-TM4SF5 cells compared to SNU449-EV. However, when further treated with multiple cytokines / chemokines, the increase in PD-L1 in SNU449-EV was smaller, but the increase in PD-L1 in SNU449-TM4SF5 cells was more significant after treatment with CCL5, CCL20, TNFα, or IFNγ. (b) Strep-EV, HA-EV, Strep-TM4SF5 (TM5), HA-PD-L1, Strep-PD-L1, or HA-TM4SF5 (TM5) were transfected into SNU449 cells, either individually or co-transfected. Cell extracts were obtained after 48 hours, and Strep-TM4SF5 or Strep-PD-L1 was pulled down. Strep-TM4SF5 and Strep-PD-L1 can be pulled down individually, and in each experiment, PD-L1 and TM4SF5 can be pulled down together, confirming that TM4SF5 binds to PD-L1. Therefore, the binding of TM4SF5 to PD-L1 is confirmed. (c) Compared to the DMSO treatment control, similar to the inhibition by TSAHC treatment, treatment with ST-5-001 or ST-5-002 reduced and inhibited the binding of TM4SF5 to PD-L1. (d) Immunostaining and fluorescence observation showed that under the DMSO control condition, PD-L1 expression was high in TM4SF5-expressing cells, and colocalization was observed in the cell membrane region; while after isoxazole treatment, PD-L1 expression was reduced in TM4SF5-expressing cells, and the degree of colocalization was slightly decreased.

[0514] SLAMF7 is considered a membrane protein that induces immune activity, while PD-L1 inhibits the immune activity of NK cells and T cells through inhibition of activation. Although SLAMF7 is considered a membrane protein that induces immune activity, PD-L1 inhibits the immune activity of NK cells and T cells through inhibition of activation. Therefore, this study investigated whether the expression pattern of PD-L1 (known to be present in hepatocytes, representative parenchymal cells; and non-parenchymal cells, such as endothelial cells, fibroblasts, and hepatocellular stellate cells; and immune cells, such as T cells, B cells, NK cells, and macrophages) at the liver tissue level is related to TM4SF5 expression or whether it binds to TM4SF5. Furthermore, the binding of PD-L1 to TM4SF5 can be inhibited by treatment with isoxazole, a TM4SF5-specific inhibitor. This phenomenon may be related to the regulation of PD-L1 expression or its intracellular localization / distribution in hepatocytes. Therefore, isoxazole compounds can regulate TM4SF5 signaling function and its protein-protein interaction capabilities related to PD-L1 expression regulation, suggesting that isoxazole compounds, as TM4SF5-specific inhibitors, have the potential to act as inhibitors of NK cells and T cells' immune checkpoints.

[0515] 2.18. Inhibition of TM4SF5-dependent PD-1 expression and T cell activity by isoxazole compounds (Figure 18)

[0516] (a) Human Jurkat T cells were treated with PMA (10 ng / ml) and INO (1 μg / ml) for 24 hours to enhance their activity. An untreated control group was also included. On the other hand, PMA / INO treatment confirmed a gradual increase in Granzyme B production (especially intensified bands with larger N-linked glycosylation morphology and molecular weight). Regardless of whether the activity induced by PMA / INO treatment occurred before or simultaneously with DMSO or ST-5-002 treatment, the activity induced by PMA / INO was further enhanced after ST-5-001 or ST-5-002 treatment compared to PMA / INO treatment alone. (b) Human Jurkat T cells were treated with either no PMA (25 ng / ml) and INO (1 μg / ml) or with 24-hour treatment followed by IL-21 treatment at a concentration of 50 ng / ml for the last 6 hours. Simultaneous treatment with PMA / INO was followed by treatment with ST-5-002 at a concentration of 2.5 μM or without treatment. At this time, the expression levels of GranzymeB and PD-1, as well as the phosphorylation levels of AKT at the Ser473 site and ERK at the Thr202 / Tyr204 site, were enhanced by PMA / INO treatment. Further treatment with IL-21 or ST-5-002 alone under PMA / INO treatment further increased the expression of GranzymeB and PD-1; when ST-5-002 and IL-21 were added simultaneously, the level of GranzymeB increased further.

[0517] Therefore, this indicates that when human Jurkat T cells are activated by PMA / INO treatment, further treatment with the TM4SF5-specific inhibitor ST-5-002 can further enhance T cell activity at the GranzymeB expression level. That is, isoxazole compounds can enhance the T cell proliferation / survival signal transduction function and cell-killing ability required for increased PD-1 and GranzymeB expression during T cell activity, suggesting that isoxazole compounds, as TM4SF5-specific inhibitors, have the potential to act as T cell immune checkpoint inhibitors.

[0518] 2.19. Confirmation of the binding of isoxazole compounds to TM4SF5 and the inhibition of isoxazole treatment on the cholesterol binding ability of TM4SF5 and PD-L1 (Figure 19).

[0519] (a) In the HEK293FT cell line, which was confirmed not to express TM4SF5, control vectors, TM4SF1, TM4SF5WT, and TM4SF5 R113Q, C118 / 145A, H127A, and N138A mutant expression vectors were introduced to induce expression for 48 hours. (b) In the Huh7KO cell line established by knocking out TM4SF5 in Huh7 cells, stable infection was achieved using retroviruses encoding pBabe-EV or pBabe-TM4SF5-HA. (c) In the SNU761 cell line, which did not express TM4SF5, Strep-EV, Strep-TM4SF5WT, or N138A mutant expression vectors were introduced to induce expression. (d) In Huh7 cells, Strep-EV, Strep-PD-L1WT, 3NQ (N192 / 200 / 219Q), and 4NQ (N35 / 192 / 200 / 219Q) N-linked glycosylation mutant expression vectors were introduced to induce expression. (e) In Huh7KO cells, Strep-EV and Strep-TM4SF5 expression vectors were introduced to induce expression for 48 hours. (ae) After obtaining cell extracts, extracts containing 0.2, 0.25, or 1.0 mg of protein were taken under various experimental conditions, and TM4SF5-strep, TM4SF5-HA, or PD-L1-strep were pulled down using streptavidinagaroseresin or anti-HA antibody. Subsequently, in each pull-down bead, with or without 400 μM unlabeled (cold) ST-5-002, ¹ 4 Treatment with C-labeled ST-5-002 (10, 25, or different concentrations as shown, μM) for 1 hour (ab). Alternatively, treatment with [1,2-³H]-cholesterol (50 μM) alone, or co-treatment with ST-3-001 (negative control compound), ST-5-001, or ST-5-002 (2.5 μM each) for 1 hour (ce). The values ​​of the radioisotopes were repeatedly determined using a TriCarbscintillation counter (PerkinElmer, Waltham, MA) for each condition.

[0520] The results showed that (a) compared with the control group and TM4SF1, Strep-TM4SF5 obtained in HEK293FT was able to [¹] 4C-labeled ST-5-002 binding. Specifically, the R113 and N138 amino acid residues of TM4SF5 were confirmed to play an important role in this binding process. On the other hand, when reacting with different concentrations of 14C-labeled ST-5-002, its EC50 (i.e., the concentration of 14C-labeled ST-5-002 required to bind to 50% of TM4SF5) was 8.874 μM. (b) The binding of HA-TM4SF5 obtained in Huh7KO-HA-TM4SF5 to 14C-labeled ST-5-002 was significantly reduced when unlabeled (cold) ST-5-002 was added simultaneously. Furthermore, when reacting with different concentrations of 14C-labeled ST-5-002, its EC50 value for binding to TM4SF5 was 849.6 nM. (c) Both wild-type and N138A mutant TM4SF5 were able to bind effectively to cholesterol. On the other hand, the binding of TM4SF5 to cholesterol was not affected by the control drug ST-3-001, but was inhibited under ST-5-001 and ST-5-002 treatment. (d) Similar to TM4SF5, PD-L1WT also binds to cholesterol, especially the N-linked glycosylation mutant and the phosphorylated mutant Y112F, whose cholesterol binding is inhibited. (e) It was confirmed that the degree of TM4SF5 binding to cholesterol gradually decreased with increasing concentrations of ST-5-001 or ST-5-002. The results showed that the degree of TM4SF5 binding to cholesterol decreased by 50% under the conditions of 6.145 μM ST-5-001 and 786.6 nM ST-5-002.

[0521] Therefore, the TM4SF5-specific inhibitors isoxazole ST-5-001 and ST-5-002 can bind to TM4SF5, with an EC50 of 8.874 μM for Strep-TM4SF5 and 849.6 nM for HA-TM4SF5, exhibiting EC50 values ​​ranging from approximately 0.85 to 8.8 μM depending on cell origin and tag type. On the other hand, TM4SF5 and PD-L1, known to be involved in tumorigenesis, can also bind to cholesterol, and ST-5-001 and ST-5-002 have been confirmed to inhibit this binding. However, the specific significance of cholesterol binding to TM4SF5 and PD-L1 in the TM4SF5-dependent regulation of T cell and NK cell cytotoxic activity remains unclear, but the fact that isoxazole compounds can inhibit this binding suggests that it may have an additional mechanism of action in anticancer strategies.

[0522] 2.20. Confirmed that isoxazole compounds inhibited hepatocellular carcinoma formation and the expression of hepatocellular carcinoma markers in a liver-orthotopic xenograft model using TM4SF5-expressing cell lines (Figure 20).

[0523] (ad) Directly inject 5 × 10⁵ cells into the liver of 6-week-old male BALB / c-Nude mice (n=9) that lacked T cells and B cells but whose NK cell function could still be activated. 5 SNU449T7 cells were used to construct an orthotopic liver xenograft model. Starting one week after cell injection, ST-5-002 was administered intraperitoneally twice weekly at a dose of 5 mg / kg (a). After six administrations over three weeks, animals were sacrificed at week four after cell injection, and liver tissue was harvested and images were taken (b). Body weight was measured weekly during the administration period. On the other hand, although multiple tumor foci were observed in the liver tissue, some tumor masses were quite large. Measuring the volume of smaller tumor masses was time-consuming, so the volume of the largest tumor mass in each liver tissue was measured. After excluding the maximum and minimum values, the tumor volume calculated for n=7 liver tissue samples is shown in Figure (c). (d) Partial liver tissue was taken, and the expression levels, distribution, and location of each protein factor, as well as the degree of damage to the liver cancer tissue, were confirmed by immunohistochemistry or hematoxylin-eosin (H&E) staining.

[0524] The results showed that: (a) is a schematic diagram of the experimental method for orthotopic xenograft of SNU449T7 cell line expressing TM4SF5 into the liver. (b) After the experiment, when observing the images of the recovered tumor tissue, the treatment with ST-5-002 significantly inhibited the formation of liver cancer compared with the tumor tissue of the control group injected with vehicle. (c) From cell injection, body weight was measured weekly, and liver cancer tissue was obtained on day 28 after cell injection. The size of the largest tumor mass in each liver tissue was measured to calculate the tumor volume. The results confirmed that the tumor volume was significantly reduced with drug treatment compared with vehicle treatment. (d) Immunohistochemical or H&E staining of some liver tissues for the indicated protein factors showed that, compared with vehicle treatment, treatment with ST-5-002 inhibited tumor formation in liver tissues. At the same time, the expression of cell proliferation marker Ki67, liver cancer marker AFP, F4 / 80 reflecting the distribution of macrophages in liver tissues, inflammation-related factors CCL2 and CCL20, as well as lamininγ2 associated with fibrosis and liver cancer, were all significantly reduced.

[0525] Therefore, to confirm the inhibitory efficacy of isoxazole compounds optimized via the structure-activity relationship (SAR) process of ST-1-025→ST-2-001→ST-3-006 / 011→ST-4-005→ST-5-001 or ST-5-002 against TM4SF5-dependent hepatocellular carcinoma formation, this study validated the efficacy in an animal model of hepatocellular carcinoma established by directly transplanting TM4SF5-expressing hepatocellular carcinoma cells into the liver. The results showed that ST-5-002 could inhibit hepatocellular carcinoma formation, thus confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors as anti-hepatocellular carcinoma inhibitors.

[0526] 2.21. The inhibitory effect of isoxazole on hepatocellular carcinoma formation and the expression of hepatocellular carcinoma markers in a PDX model expressing TM4SF5 was confirmed (Figure 21).

[0527] (ad) In the right thigh region of 6-week-old male NOD / SCID mice (n=8) lacking T, B, and NK immune cells, a section of hepatocellular carcinoma tissue (HCCcube, 1 mm³) confirming TM4SF5 expression was implanted to construct a TM4SF5-expressing HCC-PDX model. Starting from day 8 after tissue implantation, the vehicle, ST-5-001, or ST-5-002 were administered intraperitoneally twice weekly at a dose of 5 mg / kg on the indicated dates (a). After a total of 6 injections, the animals were sacrificed on day 28 after tumor tissue implantation, and liver tissue was obtained and images of the liver were taken (b). Starting from day 8 after tissue implantation, body weight and tumor volume were measured and recorded on the day of each administration (c). On the other hand, a portion of liver tissue was taken, and the expression level, distribution, and location of each factor, as well as the degree of damage to the hepatocellular carcinoma tissue, were confirmed by immunohistochemistry or hematoxylin-eosin (H&E) staining for the indicated protein factors (d).

[0528] The results showed that: (a) This is a schematic diagram of the PDX experimental method for constructing a liver cancer model by implanting sections of liver cancer tissue from patients confirmed to express TM4SF5. (b) After the experiment, when observing the images of the recovered tumor tissue, the treatment with ST-5-002 significantly inhibited liver cancer formation compared to the tumor tissue of the control group injected with the vehicle. (c) Weekly body weight measurements after tissue implantation showed that body weight was not affected regardless of whether the drug was administered; at the same time, the tumor volume in each drug-treated group was significantly reduced compared to the vehicle-treated group. (d) Immunohistochemical or H&E staining of the indicated protein factors was performed on a portion of liver tissue. The results showed that, compared with vehicle treatment, treatment with ST-5-001 or ST-5-002 inhibited tumor formation. Simultaneously, the expression of Ki67 (indicating cell proliferation), AFP (a liver cancer marker), F4 / 80 (reflecting the distribution of macrophages within liver tissue), inflammation-related CCL2 and CCL5, and lamininγ2 (associated with fibrosis and liver cancer) were all significantly reduced. (e) TM4SF5 expression showed little difference between drug treatment and non-parenchymal cells, with higher expression levels in both the vehicle and drug-treated groups. Regarding PD-L1 staining, based on cell size, morphology, and staining pattern, PD-L1 expression was higher in non-parenchymal cells and immune cells, as well as in parenchymal cells such as hepatocytes, during vehicle treatment, while it was reduced during drug treatment. On the other hand, regarding SLAMF7, when treated with vehicles, SLAMF7 expression was higher in non-cancerous areas surrounding the cancerous site than in the cancerous site; while when treated with drugs, SLAMF7 staining showed that although the cancerous masses were small, they exhibited a degree of infiltration into the cancerous site.

[0529] Therefore, to analyze the inhibitory efficacy of isoxazole compounds obtained via the structure-activity relationship (SAR) process of ST-1-025→ST-2-001→ST-3-006 / 011→ST-4-005→ST-5-001 or ST-5-002 against TM4SF5-dependent hepatocellular carcinoma formation, a hepatocellular carcinoma model was constructed by transplanting patient-derived hepatocellular carcinoma tissue. This model was established using NOD / SCID mice with suppressed T, B, and NK immune cell functions. In the hepatocellular carcinoma model constructed by directly transplanting patient-derived hepatocellular carcinoma tissue expressing TM4SF5, ST-5-001 or ST-5-002 showed significant inhibitory efficacy against hepatocellular carcinoma formation. The reason is that PD-L1 is expressed not only in hepatocytes, the origin of liver cancer, but also in various other cell types that make up liver tissue. Before drug treatment, its expression remains at a high level, thereby inhibiting the killing function of T cells and NK cells, potentially leading to immune escape. After drug treatment, its expression decreases, potentially increasing the activity of T / NK cells. In other words, by inhibiting the distribution and number of PD-L1-expressing hepatocytes, as well as non-parenchymal cells and immune cells, the possibility of isoxazole, a TM4SF5-specific inhibitor, achieving anti-liver cancer inhibition through immune checkpoint inhibition is confirmed. On the other hand, SLAMF7 is reduced in cancerous sites, but its overall expression increases or staining is observed within cancerous sites during drug treatment. This means that SLAMF7 expression in hepatocytes is upregulated by drugs, thereby inducing the activity of NK cells and other immune cells, which may be the fundamental mechanism for achieving anti-cancer effects. However, the T, B, and NK cells used in this experiment were absent or had weak function. Therefore, the anti-cancer effect under drug treatment may not be entirely due to the activity of the above-mentioned immune cells. Instead, it is speculated that the drug inhibits the signal transduction activity and protein-protein binding of TM4SF5, thereby inhibiting cancer cell formation and the survival and proliferation of cancer cells.

[0530] 2.22. Confirmed the role of isoxazole compounds in hepatocellular carcinoma formation in a liver-orthotopic xenograft model of TM4SF5-expressing cell lines, as well as the regulation of ligand expression related to NK cell natural killer function and NK cell infiltration within cancerous tissue (Figure 22).

[0531] (ab) As shown in Figure 20, in 6-week-old male BALB / c-Nude mice (n=9) lacking T cells and B cells but whose NK cell function could still be activated, 5 × 10⁵ cells were directly injected into the liver of each mouse.5 SNU449 T7 Cells were used to construct an orthotopic liver xenograft model. One week after cell injection, ST-5-002 was administered intraperitoneally twice weekly at a dose of 5 mg / kg. (bd) After the experiment, a portion of the obtained liver tissue was harvested, and immunohistochemistry was used to confirm the expression levels, distribution, and localization of SLAMF7, SLAMF6, NKG2D, PD-L1, and PD-1 factors, as well as the extent of hepatocellular carcinoma, targeting the indicated protein factors.

[0532] The results showed that: (a) is a schematic diagram of the orthotopic xenograft experiment using TM4SF5 cells expressing SNU449T7. (b) Immunohistochemical analysis of the recovered liver tissue after the experiment showed that, under vehicle treatment, SLAMF7 expression was higher in non-tumor sites and relatively lower in tumor sites. On the other hand, under ST-5-002 treatment, SLAMF7 was uniformly highly or poorly expressed in areas where tumors failed to form normally; and in cases where small tumors had formed, cells expressing high levels of SLAMF7 were observed infiltrating and distributing within the tumor at its boundaries. It is speculated that the distribution (infiltration) of SLAMF7-expressing cells within the tumor induced by this drug treatment may induce the activity of NK cell natural killer activity within the tumor. (c) On the other hand, when staining SLAMF6 or NKG2D, in the control group (vehicle treatment), their expression was higher in non-tumor sites than in tumor sites; while in the ST-5-002 treatment, their expression was generally diffuse, or in sites with smaller tumors, the staining degree of SLAMF6 and NKG2D within the tumor site was further increased. (d) On the other hand, in the vehicle treatment control group, PD-1 stained cells (including NK cells) were only visible in a limited range or area (dotted circles) in the tumor site; while in mouse liver cancer tissue treated with the drug ST-5-002, the distribution of PD-1 expressing cells in the cancer-free area was generally uniform, and in the small but present boundary areas between tumors and non-tumors, as well as within the tumor site, the infiltration of PD-1 expressing cells was no longer restricted, showing a scattered distribution rather than being limited to the staining degree of specific areas. (e) When PD-L1 was stained in hepatocellular carcinoma tissue in situ, it was found that PD-L1-expressing cells were confined to a limited area (dotted red circles) within the cancer tissue; however, when treated with the drug ST-5-002, PD-L1-expressing cells (red arrowheads) were found to be scattered at a lower level within the tumor when observed at sites where the tumor failed to form normally or at the boundary of small but formed tumors.In other words, these results indicate that in the absence of drug-induced carcinogenesis, carcinogenesis occurs due to the action of hepatocytes expressing TM4SF5, accompanied by the inhibition of NK cell natural killing effects. However, when drug treatment is applied to inhibit TM4SF5 function, SLAMF7-expressing cells can more easily infiltrate cancer sites, thereby inducing NK cell activity to achieve cancer suppression. At the same time, cells expressing PD-L1 and PD-1 are distributed at low levels both in the whole tissue and within smaller cancer sites, suggesting a reduced significance of immune escape.

[0533] Therefore, the experimental results indicate that ST-5-002 showed significant inhibitory efficacy against hepatocellular carcinoma formation in a hepatocellular carcinoma model obtained by directly transplanting TM4SF5-expressing cell-derived hepatocellular carcinoma tissue into the liver (Figure 20). Specifically, these results suggest that carcinogenesis occurs in the absence of drug treatment due to the action of TM4SF5-expressing hepatocytes, accompanied by inhibition of NK cell natural killing effects (inhibition or inactivation of ligand / receptor expression). However, when drug treatment is applied to inhibit TM4SF5 function, cells expressing SLAMF7, SLAMF6, and NKG2D infiltrate into the cancerous site, thereby inducing NK cell activity to suppress cancer. Simultaneously, although cells expressing PD-L1 and PD-1 are distributed in smaller numbers within the cancerous site, it can be inferred that the significance of immune escape is reduced.

[0534] 2.23. The inhibitory effect of isoxazole on DEN-induced hepatocellular carcinoma formation and the regulation of ligand expression related to NK cell natural killer function were confirmed in TM4SF5 gene-modified animals (Figure 23).

[0535] In an animal model induced by diethylnitrosamine (DEN), 2-week-old animals were fed for 46 weeks after a single intraperitoneal injection (IPinjection) of DEN to induce liver cancer formation. Two-week-old male C57BL / 6 wildtype mice, Alb-TGTm4sf5-Flag mice (genetically modified animals constructed by linking Tm4sf5-Flag to the hepatocyte-specific albumin gene promoter region, resulting in Tm4sf5-Flag overexpression only in hepatocytes), or Tm4sf5- / - knockout (KO) mice were administered a single intraperitoneal injection of DEN (25 mg / kg body weight). After 40 weeks, the ST-2-001 treatment group (n=5) received intraperitoneal injections twice weekly for 6 weeks at a concentration of 5 mg / kg body weight (40% DMSO). Animals were then sacrificed, and liver tissue was harvested for analysis and confirmation. Immunohistochemistry was performed on some tissue samples targeting the indicated factor, while quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to determine the mRNA level of the indicated factor in another portion of the tissue.

[0536] The results showed that: (a) is a schematic diagram of the administration of DEN to induce a liver cancer model in animals. (b) DEN was administered to Alb-TGTm4sf5-Flag or Tm4sf5- / -KO mice, with some Alb-TGTm4sf5-Flag mice treated twice weekly with ST-2-001 at a concentration of 5 mg / kg for the last 6 weeks. Confirmatory analysis of the obtained liver tissue showed that cancer formation was significantly enhanced in DEN-treated Alb-TGTm4sf5-Flag mice; while cancer formation was weak or absent in KO mice or Alb-TGTm4sf5-Flag mice treated with both DEN and ST-2-001. When hepatocellular carcinoma tissue was stained with hematoxylin and eosin (H&E staining) or immunohistochemically analyzed for TM4SF5, Ki67, and factors that regulate NK cell natural killing function (active factors SLAMF7 and NKG2D, and inhibitory factor TIGIT), Tm4SF5 expression was high in both non-tumor and tumor sites. In tumor sites, Ki67 and TIGIT expression was higher than in adjacent non-tumor sites. However, SLAMF7 and NKG2D expression was higher in non-tumor sites than in tumor sites. (c) When qRT-PCR was performed on selected tissues to confirm the mRNA expression levels of ligand / receptor factors that regulate NK cell natural killing function, the expression of NK cell active receptor factors such as SLAMF7, NKG2D, CRTAM, DNAM-1, and CD27 was relatively high in DEN-treated KO mice, while Alb-TG... Tm4sf5-Flag The decrease in mice was observed, but this decrease was partially reversed after treatment with the TM4SF5-specific inhibitor ST-2-001. This phenomenon indicates that TM4SF5-expressing hepatocellular carcinoma induced by DEN treatment inactivates NK cells at the cancer site by inhibiting the expression of active ligands / receptors such as SLAMF7 and NKG2D, accompanied by an increase in TIGIT expression, thereby suppressing the natural killing efficacy of NK cells and leading to immune escape.

[0537] Therefore, in the C57BL / 6 hepatocellular carcinoma model induced by long-term (46 weeks) liver damage through DEN administration to young mice, decreased NK cell activity and subsequent cancer development were facilitated by reduced expression of ligand factors that enhance NK cell activity and produce anti-cancer effects within the tumor. However, in mice treated with isoxazole (ST-2-001) or in mice lacking the TM4SF5 gene, the expression of these NK cell ligands was uniformly distributed overall and higher than in untreated tumor sites in the liver tissue. This suggests that isoxazole may possess the potential to inhibit hepatocellular carcinoma by enhancing NK cell activity and its uniformly distributed immune checkpoint inhibitory effects.

[0538] 2.24. Confirmed the inhibitory effect of isoxazole on hepatocellular carcinoma formation and the regulation of cancer cell ligand expression related to NK cell natural killer function in a subcutaneous xenograft hepatocellular carcinoma model in severely immunodeficient animals (NOD-SCID mice) (Figure 24).

[0539] SNU449T7 cells were loaded at a rate of 5 × 10⁻⁶. 5 A number of NOD / CB17-Prkdc samples were subcutaneously injected into 6-week-old males. scid The thigh region of / J mice (NOD-SCID mice lacking or functionally deficient T cells, B cells, NK cells, etc., n=10) was used. Subsequently, during week 1, vehicles or ST-5-002 were administered intravenously twice weekly at a concentration of 2.5 mg / kg body weight (mpk). Three days after the eighth injection, the animals were sacrificed, and the cancerous tissue was recovered and imaged. Immunohistochemistry, Western blot, and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses were performed.

[0540] The results showed that: (a) This is a schematic diagram of the subcutaneous xenograft liver cancer model constructed in animals with severe immunodeficiency (NOD-SCID) and the evaluation of the anticancer efficacy of the drug. (b) When comparing the size of the tumor after isolation, the tumor size was confirmed to be smaller when treated with ST-5-002 alone compared to the vehicle-treated group. (c) When comparing the size of cancer tissue in the vehicle-treated control group and the drug-treated group, the drug treatment showed statistically significant inhibitory efficacy on cancer formation in terms of tumor volume and weight. (d) During hematoxylin-eosin staining (H&E staining) and TM4SF5 immunostaining, in the vehicle-treated group, not only was cancer formation observed, but the cell arrangement was also disordered, and the characteristics of invasive fibrotic / cirrhotic scar formation were observed; while in the ST-5-002-treated group, although the expression of TM4SF5 did not change significantly, the cellular composition within the tissue showed a more normal and orderly morphology. On the other hand, the expression of AFP and lamininγ2, which are known to be highly expressed in liver cancer, was higher in vehicle-treated cases but significantly lower in drug-treated cases. The staining intensity of PD-L1 was lower in the drug-treated group compared to the vehicle-treated group. For SLAMF7, in drug-treated cases, the staining intensity in small but already formed cancerous sites showed a more pronounced and enhanced trend compared to surrounding sites, while this phenomenon was weaker in vehicle-treated cases. Furthermore, the staining intensity of the macrophage marker F4 / 80 and the expression of inflammation-related chemokines CCL5 and CCL20 were lower in the drug-treated group compared to the control group.

[0541] Therefore, since a subcutaneous xenograft hepatocellular carcinoma model of TM4SF5-expressing cell lines was constructed in NOD-SCID mice lacking immune cells, it is speculated that even if the drug does not directly act on immune cells, it can achieve an anti-cancer effect by inhibiting the signal transduction activity and survival / proliferation function of TM4SF5 present in hepatocellular carcinoma cells, as well as inhibiting its protein-protein binding with membrane proteins and membrane receptors used for the above-mentioned cellular functions, while reducing the expression of PD-L1, AFP, and lamininγ2 in cancer cells, and regulating the increase of SLAMF7 expression level.

[0542] On the other hand, the PCR primer sequence information of the genes used in this invention can be found as follows.

[0543] Table 2

[0544]

[0545]

[0546] The present invention will be described in detail below through embodiments to facilitate understanding. However, the following embodiments are merely illustrative of the invention, and the scope of the invention is not limited to the following embodiments. The embodiments of the present invention are provided to explain the invention more completely to those skilled in the art.

Claims

1. A compound selected from those represented by Chemical Formula 1 below, or a pharmaceutically acceptable salt, hydrate, or solvate thereof: [Chemical Formula 1] In the chemical formula 1, X1 is either O or N; X2 is either C or N; X3 is either C or N; It can be a single bond or a double bond; R1 is hydrogen, RaNH-, or RaO-; Ra is hydrogen, C1-5 alkyl, RbSO2- or RbCO-; Each Rb is independently hydrogen, C1-5 alkyl, C2-5 alkenyl, or unsubstituted or C6-10 aryl with C1-5 alkyl substituted. R2 is hydrogen, halogen, C1-5 alkyl, halo-C1-6 alkyl, RcNH- or RcO-; Rc is hydrogen, C1-5 alkyl, RdSO2- or RdCO-; Each Rd is independently hydrogen, C1-5 alkyl, or unsubstituted or C6-10 aryl with C1-5 alkyl substituted; n is an integer from 1 to 2.

2. The compound according to claim 1, The compound represented by chemical formula 1 is any one of the compounds represented by chemical formulas 2 to 4 below: [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] In the chemical formulas 2 to 4, X1, X3, R1, Ra, Rb, R2, Rc, Rd, and n are as defined in claim 1.

3. The compound according to claim 1, characterized in that, The compound represented by chemical formula 1 is selected from the group consisting of the following compounds: 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline; 4-(5-(3-methoxyphenyl)isoxazole-3-yl)aniline; 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline; 4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)aniline; 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline; 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline; 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline; 4-(5-(4-propoxyphenyl)isoxazole-3-yl)aniline; 3-(5-(4-methoxyphenyl)isoxazole-3-yl)aniline; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)methanesulfonamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide; N-(4-(5-(3-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide; N-(4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(3,4-dimethoxyphenyl)isoxazole-3-yl)phenyl)acetamide; N-(4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazole-3-yl)phenyl)acetamide; N-(4-(5-(4-fluorophenyl)isoxazole-3-yl)phenyl)acetamide; N-(4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)acetamide; N-(3-(5-(4-methoxyphenyl)isoxazole-3-yl)phenyl)acetamide; N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide; N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide; 4-(3-(4-acetamidophenyl)isoxazole-5-yl)phenyl-4-methylbenzenesulfonate; N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide; N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)acetamide; N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide; N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide; N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; and N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazole-3-yl)phenyl)acetamide.

4. A pharmaceutical composition for the prevention or treatment of liver diseases, comprising, as an active ingredient, a compound or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3.

5. The pharmaceutical composition for the prevention or treatment of liver disease according to claim 4, characterized in that, The liver diseases mentioned include liver cancer, chronic liver injury, non-alcoholic or alcoholic liver disease or fatty liver, hepatitis, liver fibrosis or cirrhosis.

6. The pharmaceutical composition according to claim 4, characterized in that, The pharmaceutical composition is used to treat liver disease by inhibiting the expression, protein-protein binding, or signal transduction activity of TM4SF5 protein, or by activating the killing efficacy of T cells and NK immune cells or regulating their distribution to inhibit immune checkpoint function.

7. A pharmaceutical preparation comprising the pharmaceutical composition of claim 4.

8. The pharmaceutical preparation according to claim 7, characterized in that, The pharmaceutical preparations are in the form of patches, ointments, inhalers, nasal drops, tablets, pills, powders, capsules, syrups, or emulsions.

9. The pharmaceutical preparation according to claim 7, characterized in that, The pharmaceutical preparation also includes at least one pharmaceutically acceptable carrier, adjuvant, and excipient.

10. A method for inhibiting immune checkpoint function, used to inhibit the expression, protein-protein binding, signal transduction activity, or activation of the killing efficacy or regulation of the distribution of T and NK immune cells in a sample or cells, thereby inhibiting immune checkpoint function, comprising the following steps: administering to the sample a pharmaceutically effective amount of the compound according to any one of claims 1 to 3.

11. A method for preventing or treating liver disease in a sample, comprising the following steps: The sample is administered a pharmaceutically effective amount of the compound according to any one of claims 1 to 3.

12. The method according to claim 11, characterized in that, The liver diseases mentioned include liver cancer, chronic liver injury, non-alcoholic or alcoholic liver disease or fatty liver, hepatitis, liver fibrosis or cirrhosis.

13. The use of the compound of any one of claims 1 to 3 or a pharmaceutically acceptable salt thereof for the prevention or treatment of liver disease.

14. The use according to claim 13, characterized in that, The liver diseases mentioned include liver cancer, chronic liver injury, non-alcoholic or alcoholic liver disease or fatty liver, hepatitis, liver fibrosis or cirrhosis.

Images