Snps associated with equine osteochondrosis and uses thereof

Abstract

The application discloses SNP sites related to equine osteochondrosis and application thereof, and belongs to the technical field of equine molecular genetic breeding and animal disease prevention and control. Specifically relates to 15 SNP sites (including rs1141631352, rs396285604, etc.) significantly related to equine osteochondrosis. The sites are verified as independent genetic signals by GWAS, and can be used to construct a multi-gene risk score (PRS) model to realize early risk assessment, diagnosis and disease-resistant breeding of equine osteochondrosis. In the prior art, the diagnosis of equine osteochondrosis relies on imaging, and breeding relies on phenotype selection, which has the defects of late diagnosis and low efficiency. By detecting the genotypes of the SNP sites, the application can stratify the risk of one-month-old foals, the AUC of the PRS model reaches 0.848, has the beneficial effects of high prediction accuracy, improved breeding efficiency and reduced economic loss, and is suitable for practical application and industrialization popularization of horse farms.

Description

Technical Field

[0001] This invention relates to the fields of equine molecular genetics breeding and animal disease prevention and control, specifically to SNP markers related to equine rickets and their applications, particularly the application of these loci in early risk assessment of equine rickets and in equine disease resistance breeding. Background Technology

[0002] Tarsal osteochondrosis is a common developmental disorder of the hock joint in horses. Its main pathological features include abnormal differentiation of the hock joint cartilage matrix and cystic changes in the subchondral bone, ultimately leading to lameness and severely affecting motor function. According to a study by Lykkjen et al. (2013), the incidence of this disease is as high as 20%-30% in certain populations of equestrian horses (such as standard horses and warmbloods). Its pathogenesis is regulated by the interaction of genetics and environment. Genetically, its heritability is as high as 50%, and the offspring of affected stallions are twice as likely to be affected as those of healthy stallions. Among environmental factors, high-energy feeding, copper deficiency, calcium-phosphorus imbalance, and irregular exercise are key risk factors. Diagnosis relies on X-rays, ultrasound, and arthroscopy (the gold standard). Treatment is divided into conservative methods (rest, dietary adjustments, NSAIDs, etc., suitable for mild cases without lameness) and surgery (arthroscopic removal of fragments, suitable for cases with fragments or severe cases). This disease affects the horse's movement and use. Approximately 16.9% of non-racehorses with this disease cannot return to use after surgery, and approximately 27.4% of racehorses with this disease cannot return to use after surgery, resulting in significant economic losses.

[0003] In the field of equine breeding, traditional disease-resistant breeding relies on "phenotypic selection," which involves selecting stallions without a history of rickets for breeding. However, this method has certain drawbacks: on the one hand, equine rickets are affected by multiple factors, and some stallions carrying risk alleles, while not developing the disease themselves, can pass on the risk genes to their offspring, leading to fluctuations in the incidence rate of the offspring population; on the other hand, phenotypic diagnosis is affected by the time window and symptom presentation. Horses are usually diagnosed before the sale of yearling racehorses and when 2-4 year old sport horses begin training. However, some cases have no obvious clinical manifestations and can only be detected through imaging, increasing the difficulty and time required for diagnosis, resulting in low selection efficiency.

[0004] Molecular marker-assisted selection (MAS) technology offers a potential solution to these problems. Among them, single nucleotide polymorphism (SNP) markers have been widely used in livestock and poultry breeding for economic traits due to their advantages such as large number, low mutation rate, and convenient detection (Goddard and Hayes, 2009). Genome-wide association analysis (GWAS) is the core technology for screening disease-related SNPs, but there are currently few GWAS studies on equine rickets. Related studies have reported some loci associated with equine rickets, but they are not comprehensive or accurate enough (McCoy et al., 2015). Summary of the Invention

[0005] To address the shortcomings of existing technologies, such as difficulty in early diagnosis of equine rickets and low breeding efficiency, this invention provides a set of SNP loci associated with equine rickets and their applications. This set of loci has been verified by GWAS to be significantly associated with equine rickets, and most loci are independent genetic signals, enabling early risk assessment and efficient breeding.

[0006] This invention provides the following technical solution:

[0007] In a first aspect, the present invention provides a set of biomarkers related to equine rickets, characterized in that the biomarkers are composed of the following SNPs, wherein the SNPs include rs1141631352, rs396285604, rs396862005, rs1150142467, rs1143310818, rs1149024354, rs1137900938, rs3430922134, rs1137497607, rs1140299868, rs3432836019, rs1146350696, rs1142239490, rs395546126 and rs1136176676.

[0008] Further, the locations and alleles of the SNPs are as follows: rs1141631352 is located at Chr1: 38866658 bp, with alleles A / G, where A is the risk allele; rs396285604 is located at Chr2: 94699 bp, with alleles C / T, where C is the risk allele; rs396862005 is located at Chr2: 77379236 bp, with alleles G / A, where G is the risk allele; rs1150142467 is located at Chr3: 28905996 bp, with alleles T / C, where T is the risk allele; rs1143310818 is located at Chr3: 109528322 bp. At bp, the allele is C / T, where C is the risk allele; rs1149024354 is located at Chr3:117751585 bp, the allele is T / C, where T is the protective allele; rs1137900938 is located at Chr4:34524421 bp, the allele is T / C, where T is the risk allele; rs3430922134 is located at Chr6:75378823 bp, the allele is C / T, where C is the risk allele; rs1137497607 is located at Chr7:88530740 bp, the allele is T / C, where T is the risk allele; rs1140299868 is located at Chr8:40478963 bp. At bp, the allele is G / A, where G is the protective allele; rs3432836019 is located at Chr11:42057832 bp, the allele is C / T, where C is the risk allele; rs1146350696 is located at Chr18:13854039 bp, the allele is A / C, where A is the protective allele; rs1142239490 is located at Chr20:32416178 bp, the allele is A / G, where A is the protective allele; rs395546126 is located at Chr20:48703992 bp, the allele is A / G, where A is the risk allele; rs1136176676 is located at Chr27:26184131 bp, the allele is A / G, where A is the risk allele.

[0009] Further, the SNP is characterized by the sequences shown in SEQ ID NO.1 to SEQ ID NO.15, where SEQ ID NO.1 corresponds to rs1141631352, SEQ ID NO.2 corresponds to rs396285604, SEQ ID NO.3 corresponds to rs396862005, SEQ ID NO.4 corresponds to rs1150142467, SEQ ID NO.5 corresponds to rs1143310818, SEQ ID NO.6 corresponds to rs1149024354, SEQ ID NO.7 corresponds to rs1137900938, SEQ ID NO.8 corresponds to rs3430922134, SEQ ID NO.9 corresponds to rs1137497607, SEQ ID NO.10 corresponds to rs1140299868, SEQ ID NO.11 corresponds to rs3432836019, SEQ ID NO.12 corresponds to rs1146350696, and SEQ ID NO. SEQ ID NO.13 corresponds to rs1142239490, SEQ ID NO.14 corresponds to rs395546126, and SEQ ID NO.15 corresponds to rs1136176676.

[0010] In a second aspect, the present invention provides the application of the set of biomarkers related to equine rickets described in the first aspect in the preparation of equine rickets risk assessment products.

[0011] Thirdly, the present invention provides the application of a set of biomarkers related to equine rickets in the preparation of diagnostic products for equine rickets.

[0012] Fourthly, this invention provides the application of a set of biomarkers associated with equine rickets in the preparation of early warning products for equine rickets.

[0013] Fifthly, the present invention provides a reagent for detecting the markers described in the first aspect, characterized in that the reagent comprises primers and / or probes for specifically amplifying the sequences shown in SEQ ID NO.1 to SEQ ID NO.15.

[0014] In a sixth aspect, a diagnostic kit for equine rickets is provided, characterized by the reagent described in the fifth aspect, and a calculation module or instruction manual for calculating PRS.

[0015] Furthermore, the method for calculating the PRS value is as follows:

[0016] PRS calculation formula: PRS = Σ(βi × Gi),

[0017] Where βi is the effect value of the i-th SNP, taking the ln(OR) value;

[0018] Gi encodes the genotype of this locus, where 0 = not carrying the risk / protective allele, 1 = heterozygous carrying one risk / protective allele, 2 = homozygous carrying two risk / protective alleles;

[0019] Furthermore, the risk classification is as follows: If PRS ≥ 0.1, it is determined as a high-risk individual and intervention measures need to be implemented; if PRS ≤ -0.04, it is determined as a low-risk individual; if -0.04 < PRS < 0.1, it is determined as a medium-risk individual; preferably, the intervention measure for high-risk individuals is to adjust the feeding density to ≤ 2 horses / pen and supplement 300 - 800 mg, preferably 500 mg of glucosamine per horse per day. Medium-risk individuals are recommended to reduce the feeding density to ≤ 3 horses / pen, and low-risk individuals can be raised conventionally;

[0020] Furthermore, the kit is used for the early diagnosis, risk assessment or breeding screening of equine osteochondrosis; preferably, the early diagnosis is for foals at 1 month old.

[0021] In the seventh aspect, there is provided the use of the reagent described in the fifth aspect or the kit described in the sixth aspect in the following aspects:

[0022] (1) Preparing a diagnostic product for equine osteochondrosis;

[0023] (2) Preparing a risk assessment product for equine osteochondrosis;

[0024] (3) Preparing a breeding product for equine anti-osteochondrosis.

[0025] Furthermore, the diagnosis is early diagnosis; preferably, the early diagnosis is for foals at 1 month old.

[0026] Advantages of the present invention

[0027] The present invention provides 15 SNP loci related to equine osteochondrosis and their applications. Compared with the prior art, it has the following beneficial effects:

[0028] Early risk assessment: Risk stratification can be carried out for foals at 1 month old through the PRS model (AUC = 0.848), earlier than traditional imaging diagnosis. High prediction accuracy: The model has excellent sensitivity and specificity, supports early intervention, and reduces the severity of the disease. Improvement of breeding efficiency: Overcoming the defects of phenotypic selection, accurately screening disease-resistant breeding horses through genotype detection, and avoiding the accumulation of risk genes. Signal independent and reliable: 15 loci are verified by GWAS, distributed on multiple chromosomes, with strong complementarity, improving the stability of the assessment. Practical application verification: In the case of the马场 (should be a specific name, please correct if incorrect), the lesions of high-risk individuals can be controlled after intervention, and low-risk individuals develop normally. Reduction of economic losses: Reducing the need for surgery and horse elimination, saving costs, and improving the efficiency of the horse industry. Convenient detection: Supporting multiplex PCR sequencing, with low cost, suitable for large-scale screening and industrialization.

[0029] In summary, this invention promotes molecular diagnosis and precision breeding of equine rickets, and has significant scientific and economic value. Attached Figure Description

[0030] Figure 1 ROC curve for predicting the risk of equine rickets using SNP combinations: the horizontal axis is 1-specificity (False Positive Rate), and the vertical axis is sensitivity (True Positive Rate).

[0031] Figure 2 The Manhattan plot (top) and COJO conditional analysis plot (bottom) of the GWAS results for equine rickets are shown below: the horizontal axis represents the 31 chromosomes of the horse (Chr1-Chr31), and the vertical axis represents -log10(p) (association significance). The red horizontal line in the top plot is the significance threshold (-log10(9.00e-6)=5.05). The dots in the bottom plot are SNP sites. The red squares in the top plot are the 15 significant sites screened by this invention, showing that these sites all exceed the significance threshold.

[0032] Figure 3 The QQ plot of GWAS results for equine rickets: the horizontal axis is the expected -log10(p) (the distribution of p-values ​​under the null hypothesis), the vertical axis is the observed -log10(p), the red diagonal line is the null hypothesis line, and the blue dots are the actual observed values. It shows that the significant sites (upper right corner) deviate from the null hypothesis line, proving the existence of a real association signal and no obvious false positives.

[0033] Figure 4 The difference in PRS scores between diseased and healthy individuals in the original data is shown. Using the effect sizes and genotypes of 15 SNP loci identified in this invention, PRS scores for diseased and healthy individuals were estimated. Box plots showed that the PRS scores of healthy individuals were significantly lower than those of diseased individuals. Individual disease status is highly correlated with PRS score. Detailed Implementation

[0034] The following detailed embodiments further illustrate the concept and technical effects of the present invention to fully understand its purpose, features, and effects. Unless otherwise specified, all methods described are conventional methods. Unless otherwise specified, all materials are available from publicly available commercial sources. The illustrative embodiments and descriptions of the present invention are used to explain the invention and do not constitute an undue limitation thereof. It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0035] Example 1: Screening and validation of SNP loci associated with equine rickets

[0036] 1. Experimental materials: The sample consisted of 479 North American standard horses (Equus caballus) published by the University of Minnesota. Among them, 148 were cases of equine chondrodysplasia (cartilage defects or subchondral bone cysts in the tarsal joints) diagnosed by X-ray DR and / or surgery, and 331 were control individuals confirmed by X-ray DR to have no chondrodysplasia lesions.

[0037] 2. Genotyping and Data Quality Control:

[0038] Genotyping: Three types of chips were used for detection: Illumina SNP50 chip (n=94), Illumina SNP70 chip (n=88), and AffyMetrix 670K chip (n=297).

[0039] Data filling and quality control: The SNP50 / SNP70 chip data was filled to 670K sites using Beagle 5.4 software, and then filled using glimpse2 software in conjunction with the GHRP panel. Sites with INFO values ​​> 0.8 (filling accuracy) were retained, and finally 23.4M high-quality SNPs were obtained for GWAS analysis.

[0040] 3. GWAS analysis:

[0041] Analysis tools: SAIGE software was used to construct a zero model (logistic mixture model, --traitType=binary) based on the full genome relation matrix (full GRM).

[0042] Association testing: Saddle point approximation was used to address case-control imbalance and single-variable association testing was performed.

[0043] Significance threshold: p < 9.00e-6 (FDR < 0.05) was set as the genomic significance level to screen for significantly associated SNP sites;

[0044] Independent signal identification: Conditional analysis was performed on significant sites using COJO software. The conditional p-value (pJ) and linkage disequilibrium coefficient (LD_r) for each site were calculated. Independent sites with pJ < 9.00e-6 and LD_r ≈ 0 were retained, resulting in 15 sites. The GWAS and COJO analysis results are as follows: Figure 2 As shown, the top figure presents the GWAS results, with the red dashed line marking the significance threshold and the red squares marking the marker sites obtained for the independence test. The bottom figure shows the significance and effect values ​​obtained from the COJO analysis of 15 sites. The y-axis corresponds to significance, and the color represents the effect value. Red represents risk sites, and purple represents protective sites. The darker the color, the stronger the effect. Figure 3This is the QQ plot of the GWAS results. The horizontal axis represents the expected -log10(p) (the distribution of p-values ​​under the null hypothesis), and the vertical axis represents the observed -log10(p). The red diagonal line is the null hypothesis line, and the blue dots are the actual observed values. It shows that the significant sites (upper right corner) deviate from the null hypothesis line, proving the existence of a real association signal and no obvious false positives.

[0045] Figure 4 The correlation between PRS and disease phenotype was shown using effect sizes and genotype estimates at 15 loci in the original dataset. The results showed that the PRS scores of normal horses and diseased horses differed significantly.

[0046] The 15 SNP sites are as follows:

[0047] rs1141631352, rs396285604, rs396862005, rs1150142467, rs1143310818, rs1149024354, rs1137900938, rs34309 22134, rs1137497607, rs1140299868, rs3432836019, rs1146350696, rs1142239490, rs395546126, rs1136176676.

[0048] in:

[0049] rs1141631352, located at Chr1:38866658 bp, has alleles A / G, where A is the risk allele;

[0050] rs396285604, located at Chr2:94699 bp, has an allele of C / T, where C is the risk allele;

[0051] rs396862005, located at Chr2:77379236 bp, has an allele of G / A, where G is the risk allele;

[0052] rs1150142467, located at Chr3:28905996 bp, has an allele of T / C, where T is the risk allele;

[0053] rs1143310818, located at Chr3:109528322 bp, has an allele of C / T, where C is the risk allele;

[0054] rs1149024354, located at Chr3:117751585 bp, has an allele of T / C, where T is the protective allele;

[0055] rs1137900938, located at Chr4:34524421 bp, has an allele of T / C, where T is the risk allele;

[0056] rs3430922134, located at Chr6:75378823 bp, has an allele of C / T, where C is the risk allele;

[0057] rs1137497607, located at Chr7:88530740 bp, has an allele of T / C, where T is the risk allele;

[0058] rs1140299868, located at Chr8:40478963 bp, has an allele of G / A, where G is the protective allele;

[0059] rs3432836019, located at Chr11:42057832 bp, has an allele of C / T, where C is the risk allele;

[0060] rs1146350696, located at Chr18:13854039 bp, has alleles A / C, where A is the protective allele;

[0061] rs1142239490, located at Chr20:32416178 bp, has alleles A / G, where A is the protective allele;

[0062] rs395546126, located at Chr20:48703992 bp, has an allele of A / G, where A is the risk allele;

[0063] rs1136176676, located at Chr27:26184131 bp, has an allele of A / G, where A is the risk allele.

[0064] The above SNP sites are characterized by the following sequences:

[0065] SEQ ID NO.1: rs1141631352

[0066] Ggcactgaccaaggtgaaacaaagagaggaagagtgctatggaaatcacagcaaggttatcctcccactagcaaaggcactcctccttcaatggataaca[A / G]aaggctgactatgcatattagtcccaatctattagctcacataagcactgtacatcctataaaccacgtatctaatgctatattatcctttaaggcatct

[0067] SEQ ID NO.2: rs396285604

[0068] Attcaccaagttgcaacttttgtgacgatattggaatgggtgaaggatggaggacattttagccgctttaaaaatatataattttttttcataaaacagg[C / T]atgtattcattttagaattaaaaaaaagattttagttttgattgccgtgccagctatgttgatttaaggaagtaagtctcagtccaactgcaccgtaaag

[0069] SEQ ID NO.3: rs396862005

[0070] Gatagacacattgttagtctcttcttggctccatttcaaatcttaatagaggggccggctccgtggccgagtggttaagttcgcgcgctcggctgcggcg[G / A]cgcagggttcggatcctgggcgcggacatggcaccactcctcaggccacgttgaggcggtgtcccacatatcacaactagaaggatctgcaactaagata

[0071] SEQ ID NO.4: rs1150142467

[0072] Cctccaccaggcttctcccttcctcattcattttctccctcaaggagcttggcagcccccaggccactgctttagcactctgtgttggatagttttcaat[T / C]atcttgtggcctgtgaattctctgggttagaagttgcaggccacgctggtgaacagcttccataaggagcaaagacatgagaaaacccttcctcacgtgc

[0073] SEQ ID NO.5: rs1143310818

[0074] Catactgaaactgaccttagtattccttgcaatgtgcacaattctggcaaaggattcatgcaaagcatcctgatatattttatttctttttaaaaaaatg[C / T]tcattgtgactcacagaattgatttcatgacctaccactgtgtcacacctaatatgaaaaacattgatatagagacattttcctctgttgtgctggtagc

[0075] SEQ ID NO.6: rs1149024354

[0076] Gtgggatctaaagaagccgactcagaggaacagagtagcgggtggtgagccggggccgggggtggggaggcggggagaagccggcgggaaagcaccgacg[T / C]gctcttgtaagacaggtaagttctggggatctgatgtgcactgcgtggtgactaaagataacgggaccgtattatatacttgaaagatgccaagacagta

[0077] SEQ ID NO.7: rs1137900938

[0078] Ttatttgacagtttcttaaaaacataattgcacctaccataccacccagccattctacacctaagtgtttacataagagaaatgaatacataggtctata[T / C]caagacttttacatgaatgtcatagcagctgtgtttgtagtaactctgaactggaaacccaaaatgttcaataggagaatggataaacaaattatggtat

[0079] SEQ ID NO.8: rs3430922134

[0080] Aacagttccccacccttcattgctgctcctcagagtcacatgctttcaacttttagctgtttcttctggtatttacttctctatttctaaataatatac[C / T]tttagttcttgacattaactttagatgttcttgatttacttcctaatagagtaaatgagaatttagcttttttacaccactttcctgaccatttcctttat

[0081] SEQ ID NO.9: rs1137497607

[0082] Gactcaaaacaaccaaaacaactttaagaacaaagttggaggattaataatacctgatttcaagatttattataaagctacagtaatgaaaacagcgtgg[T / C]attggcataaagatagacaaatagatcaatggaacagaacagagtccagaaatagagtcacatgtatacatctggacaactgatttttgaaaaacgtgca

[0083] SEQ ID NO.10: rs1140299868

[0084] Caatagaagtaaaaaaaaaaagtaaagatgaagataaattagaagcatcaacatgagccattctgtccccaaagaggctgattacattttggccacagga[G / A]tattcaagatggcctgataaattggaaccgtttgaatctttaaagacctaaagactctggtggtgctcaaaaagaataaaaaatatataacattgggaag

[0085] SEQ ID NO.11: rs3432836019

[0086] Agcccccccgtcccctggtcccagacaggccacgcccaggactctgcctctgcagtaacaggggctccctctgctgcagccccaatgcacctgcagatct[C / T]tgcgaggccgctccttctgccattggggtctcaagggcacggtggcctcctgggagagctgtcccgtctaagacagtgccgcccctgccccggggctcac

[0087] SEQ ID NO.12: rs1146350696

[0088] Caaggagcaaactacaaagtatattaccgacactcctgaaacccgcctcctgactccttccagtcagtatttctgcccaaagataaacactttctgactt[A / C]tatttccacagattaagttttcctgtatgtattcctttgggtctgattttcttcatttgatgttatgtttttgatatttatccacgttgttgtgagtagc

[0089] SEQ ID NO.13: rs1142239490

[0090] Gtgtagaagtcgatgccttcaaaaagtgaatcaatttccaagttggcctgggtgctggatgacagggtcctcttggccctctcgcaggcggtgcgcagcc[A / G]cctcacagcccgcttgttctgactgatgtccttcttgtgtttcctcttgaactcttccacaaagtggctcacaagcctgttgtcaaagtcctctccaccc

[0091] SEQ ID NO.14: rs395546126

[0092] Ccaaaaatgcatccagaatttaaaagcaaaaataatgacatcaaaaatagagcactagaaaaggtgtttagaaataagtcaacacaacaaatattccctg[A / G]gcatcaagtattgttctacagggtgctgggtgccttagggaacacacgagaaaagtcagccatgactccacagagcttgtataacctgactaggtgataa

[0093] SEQ ID NO.15: rs1136176676

[0094] Tcctacagccctgaatgtgtcacaccacatacacagcagtaggcatttttttcaatgctttgactacatgcttacctactagctggaaagaataacatc[A / G]attattgaggccctgaattacatctctgttatgcttatcccaagttcataataaaaatagctaacatttatatggtgcttcctaagtgtcatgtaccac

[0095] 4. Result Verification:

[0096] To verify the predictive performance of the SNP combination of this invention, a 5-fold cross-validation strategy was adopted. The 479 samples were randomly divided into 5 parts, which were used as the test set in turn.

[0097] Construction of the polygenic risk score (PRS) model: The effect values ​​of 15 SNPs were estimated using the training set data to construct the PRS model.

[0098] Performance assessment: Individual PRS values ​​were calculated and compared with actual disease status. Results showed that this group of SNP loci performed excellently in distinguishing between diseased and healthy horses, with an area under the receiver operating characteristic (AUC) of 0.848 (95% CI: 0.810–0.885).

[0099] Threshold setting: The optimal risk threshold is determined based on the principle of maximizing the Youden Index. Based on this threshold, the model can effectively identify high-risk individuals and exclude low-risk individuals, exhibiting good sensitivity and specificity (e.g., ...). Figure 1 (As shown).

[0100] Figure 1 The results showed that the area under the curve (AUC) was 0.848 (95% CI: 0.810–0.885), indicating that the model has good predictive performance.

[0101] Example 2: Practical Application of Risk Assessment for Equine Osteochondritis

[0102] 1. Sample information: Three 1-month-old Thoroughbred foals (numbered A01, A02, and A03) from a horse farm were selected, and their jugular vein blood was collected to extract DNA.

[0103] 2. Detection process: Multiplex PCR amplification was performed using 15 pairs of primers. The products were sequenced by Sanger sequencing. The results for key loci are as follows (the remaining loci are wild-type):

[0104] Foal A01: carries the common risk locus rs395546126 homozygous (A / A), rs396862005 heterozygous (G / A), and the protective locus rs1149024354 heterozygous (C / T).

[0105] Foal A02: Carries the protective locus rs1146350696 heterozygous (A / C) and the common risk locus rs395546126 heterozygous (A / G).

[0106] Foal A03: Carries risky heterozygous rs395546126 (A / G) and rs396862005 heterozygous (G / A) sites, as well as protective heterozygous rs1142239490 (A / G) sites.

[0107] 3. Risk Assessment and Recommendations:

[0108] Calculate PRS: Calculate according to the formula:

[0109] PRS = Σ(βi × Gi),

[0110] Where βi is the effect value of the i-th SNP site, taken as ln(OR);

[0111] Gi represents the genotype code for that locus, where 0 = no risk / protective allele, 1 = heterozygous carrying one risk / protective allele, and 2 = homozygous carrying two risk / protective alleles.

[0112] A01: PRS = 0.48 (High risk, >0.1);

[0113] A02: PRS = -0.46 (low risk, <-0.04);

[0114] A03: PRS = 0.00 (Medium risk, between -0.04 and 0.1).

[0115] Recommendations for handling:

[0116] A01 is classified as high-risk. It is recommended to immediately isolate the animal in captivity, restrict strenuous exercise, add a chondroprotectant (such as glucosamine) to its feed, and conduct X-ray screenings at 3 months and 6 months of age.

[0117] A02 was determined to be low-risk. It was raised and bred using standard methods.

[0118] A03 is classified as a medium-risk case. It is recommended to reduce stocking density, ensure moderate exercise, and monitor joint development.

[0119] Follow-up: At 12 months of age, X-ray examination revealed that A01 had mild schizophrenia of the right tarsal joint trochlear ridge at 6 months of age, which healed after timely intervention and conservative treatment; A02 and A03 both had normal bilateral tarsal joint development. This case confirms the effectiveness of the method of this invention in early warning.

Claims

1. A set of reagents for detecting biomarkers associated with equine rickets, characterized in that, The reagents are primers or probes, and the markers are composed of the following SNPs: rs1141631352, rs396285604, rs396862005, rs1150142467, rs1143310818, rs1149024354, rs1137900938, rs3430922134, rs1137497607, rs1140299868, rs3432836019, rs1146350696, rs1142239490, rs395546126, and rs1136176676.

2. The reagent for detecting biomarkers related to equine rickets according to claim 1, characterized in that, The locations and alleles of the SNPs are as follows: rs1141631352 is located at Chr1: 38866658 bp, with alleles A / G, where A is the risk allele; rs396285604 is located at Chr2: 94699 bp, with alleles C / T, where C is the risk allele; rs396862005 is located at Chr2: 77379236 bp, with alleles G / A, where G is the risk allele; rs1150142467 is located at Chr3: 28905996 bp, with alleles T / C, where T is the risk allele; rs1143310818 is located at Chr3: 109528322 bp. At bp, the allele is C / T, where C is the risk allele; rs1149024354 is located at Chr3:117751585 bp, the allele is T / C, where T is the protective allele; rs1137900938 is located at Chr4:34524421 bp, the allele is T / C, where T is the risk allele; rs3430922134 is located at Chr6:75378823 bp, the allele is C / T, where C is the risk allele; rs1137497607 is located at Chr7:88530740 bp, the allele is T / C, where T is the risk allele; rs1140299868 is located at Chr8:40478963 bp. At bp, the allele is G / A, where G is the protective allele; rs3432836019 is located at Chr11:42057832 bp, the allele is C / T, where C is the risk allele; rs1146350696 is located at Chr18:13854039 bp, the allele is A / C, where A is the protective allele; rs1142239490 is located at Chr20:32416178 bp, the allele is A / G, where A is the protective allele; rs395546126 is located at Chr20:48703992 bp, the allele is A / G, where A is the risk allele; rs1136176676 is located at Chr27:26184131 bp, the allele is A / G, where A is the risk allele.

3. The reagent for detecting biomarkers associated with equine rickets according to claim 1 or 2, characterized in that, The SNPs are characterized by the sequences shown in SEQ ID NO.1 to SEQ ID NO.15, where SEQ ID NO.1 corresponds to rs1141631352, SEQ ID NO.2 corresponds to rs396285604, SEQ ID NO.3 corresponds to rs396862005, SEQ ID NO.4 corresponds to rs1150142467, SEQ ID NO.5 corresponds to rs1143310818, SEQ ID NO.6 corresponds to rs1149024354, SEQ ID NO.7 corresponds to rs1137900938, SEQ ID NO.8 corresponds to rs3430922134, SEQ ID NO.9 corresponds to rs1137497607, SEQ ID NO.10 corresponds to rs1140299868, SEQ ID NO.11 corresponds to rs3432836019, SEQ ID NO.12 corresponds to rs1146350696, SEQ ID NO.13 corresponds to rs1142239490, SEQ ID NO.14 corresponds to rs395546126, and SEQ ID NO.15 corresponds to rs1136176676.

4. Use of a reagent set for detecting markers related to equine osteochondrosis according to any one of claims 1 to 3 in the following aspects: (1) Preparation of an equine osteochondrosis risk assessment product; (2) Preparation of a product for breeding against equine osteochondrosis; (3) Preparation of an early warning product for equine osteochondrosis.

5. A reagent for the marker according to any one of claims 1 to 3, the reagent comprising primers and / or probes that specifically amplify the sequences shown in SEQ ID NO.1 to SEQ ID NO.

15.

6. A diagnostic kit for equine rickets, characterized in that, Comprising the reagent according to claim 5, and a calculation module or instruction manual for calculating the PRS.

7. Use of the reagent according to claim 5 or the kit according to claim 6 in the following aspects: (1) Preparation of an equine osteochondrosis risk assessment product; (2) Preparation of a product for breeding against equine osteochondrosis; (3) Preparation of an early warning product for equine osteochondrosis.

8. The application according to claim 4 or claim 7, characterized in that, Detecting the genotype of the marker according to any one of claims 1 to 3 in a horse sample, and calculating the polygenic risk score PRS based on the genotype to evaluate the risk of equine osteochondrosis; (1) PRS calculation formula: PRS = Σ(βi × Gi), where βi is the effect value of the i-th SNP, taking the ln(OR) value; Gi is the genotype coding of the locus, 0 = not carrying a risk / protective allele, 1 = heterozygous carrying one risk / protective allele, 2 = homozygous carrying two risk / protective alleles; (2) Risk classification: If PRS≥0.1, it is determined as a high-risk individual and intervention measures need to be implemented; if PRS≤-0.04, it is determined as a low-risk individual; if -0.04 < PRS < 0.1, it is determined as a medium-risk individual.

9. The application according to claim 8, characterized in that, Further comprising performing multiplex PCR amplification and sequencing on a sample of the horse.

10. The application according to claim 9, characterized in that, The sequencing described therein refers to Sanger sequencing, second-generation sequencing, or third-generation sequencing.

Images