SNP (Single Nucleotide Polymorphism) molecular marker capable of influencing linear motion / far-end mass droplet character of pig sperm and application of SNP molecular marker
By identifying and applying SNP molecular markers of A>G mutations in the pig genome, the linear motility and distal droplet characteristics of pig sperm were optimized, solving the problem of low reproductive performance in breeding pigs and achieving efficient breeding progress and improved economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGXI UNIV
- Filing Date
- 2026-01-27
- Publication Date
- 2026-04-24
AI Technical Summary
Existing technologies are insufficient to effectively improve the linear motility and distal droplet characteristics of boar sperm, thus affecting the reproductive performance and breeding efficiency of breeding pigs.
By identifying and applying the SNP molecular marker of the A>G mutation located at 31908556 bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version, the dominant allele A is selected, and its frequency is increased generation by generation to improve the semen quality of breeding pigs.
Significantly improves the quality of boar semen, enhances reproductive performance, increases breeding efficiency and economic benefits, and enables rapid and convenient molecular marker-assisted breeding.
Smart Images

Figure CN121915166A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biotechnology and genetic breeding, and in particular to an SNP molecular marker that affects the linear motility / distal droplet trait of porcine sperm and its application. Background Technology
[0002] In recent years, with the improvement of residents' living standards, my country's demand for meat consumption has been continuously increasing. Statistics show that my country's total pork production accounts for 50.16% of global pork production, and pork consumption accounts for 60% of total meat consumption, ranking first in the world. However, my country's breeding pigs have low reproductive capacity and slow growth rate. As a result, my country cannot achieve self-sufficiency in meat and has long relied on imports. To improve this situation, the breeding process of breeding pigs is particularly important. The genetic effects of boars are crucial to improving the efficiency and breeding effectiveness of the pig industry. Semen quality, as a key indicator for assessing the genetic potential of boars, can be effectively improved by identifying key genes affecting semen quality and applying them to genetic improvement. This will effectively promote the improvement of boar production efficiency and reproductive capacity, thereby driving the sustainable development of my country's pig industry, ultimately achieving self-sufficiency in meat production, and enhancing the competitiveness of my country's livestock industry and the national economic level.
[0003] In the past, researchers identified candidate genes influencing semen quality traits through genome-wide association studies (GWAS). In recent years, with the accumulation of large-scale GWAS data on pig traits and the public availability of transcriptome databases including those containing testicular tissue, research on the genetic basis of semen quality traits has gradually moved from single-genome analysis to multi-omics integrated analysis. Researchers have developed transcriptome methods such as GWAS genome analysis, TWAS, and co-localization to further investigate the complex genetic mechanisms of semen quality and identify molecular markers most likely to influence phenotypic variations in semen quality. Ultimately, by screening and applying these molecular markers, breeders can implement precise selection in boar populations, significantly improving breeding efficiency, accelerating the genetic progress of boar semen quality, greatly enhancing the breed characteristics of Chinese pigs, and promoting the rapid development of my country's pig industry, thus laying a solid foundation for the independent control of meat production in my country.
[0004] The reproductive performance and semen quality of boars directly affect the conception rate and litter size of sows. Therefore, raising healthy boars and improving their semen quality and reproductive rate is an important measure to increase the productivity and economic benefits of breeding pig farms, and is a primary goal of boar station management. Sperm linear motility (the percentage of sperm that can move in a straight line in semen) is one of the important indicators for evaluating semen quality. In addition, unusable boar semen due to protoplasmic droplets is also a problem currently plaguing boar stations. Studies have shown that immature sperm may contain protoplasmic droplets, which are remnants of protoplasm from the sperm maturation process. During sperm maturation and migration, protoplasmic droplets move from the sperm neck to the middle. Sperm ejaculated after shedding protoplasmic droplets are considered immature if they are present. Therefore, the shedding of protoplasmic droplets is one of the main steps and markers in the sperm maturation process. Only sperm that successfully shed protoplasmic droplets are mature sperm and have the ability to fertilize. Protoplasmic droplets are mainly distributed at the proximal and distal ends of the sperm tail, referred to as proximal protoplasmic droplets (also called proximal droplets) and distal protoplasmic droplets (also called distal droplets). As sperm matures, protoplasmic droplets slowly migrate from the proximal end to the distal end until they detach. Therefore, detecting the distal droplet ratio (the percentage of sperm containing distal droplets in semen) is more meaningful for evaluating sperm quality. Thus, there is an urgent need to discover a new SNP molecular marker associated with sperm linear motility and / or distal droplet traits for selective breeding of sperm linear motility and / or distal droplet traits, and further for use in boar breeding to improve boar reproductive performance. Summary of the Invention
[0005] The purpose of this invention is to provide an SNP molecular marker that affects the linear motility / distal droplet characteristics of boar sperm, and to apply it to boar genetic breeding to improve breeding efficiency and accelerate the genetic progress of boar semen quality improvement.
[0006] According to a first aspect of the present invention, a SNP molecular marker affecting the linear sperm motility / distal droplet trait in pigs is provided. This SNP molecular marker is an A>G mutation located at position 31908556 bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 (hereinafter referred to as the g.306A>G molecular marker). Therefore, by selecting pigs using this molecular marker, the dominant allele A of this SNP molecular marker can be preferentially selected, increasing the frequency of the dominant allele A generation by generation, improving the semen quality of breeding pigs, and synergistically selecting superior breeding pigs with both linear sperm motility and distal droplet traits. This accelerates the progress of pig genetic improvement and effectively improves the economic benefits of pig breeding.
[0007] According to a second aspect of the present invention, an application of an SNP molecular marker in the selection of porcine sperm linear motility and / or distal droplet traits is provided. This SNP molecular marker is an A>G mutation located at position 31908556 bp on chromosome 10 of the porcine genome Ensembl Sscrofa 11.1 version. Therefore, through this application, the dominant allele A of this SNP molecular marker can be selected, increasing the frequency of the dominant allele A generation by generation, improving the semen quality of breeding pigs, and synergistically selecting superior breeding pigs with both sperm linear motility and distal droplet traits, thereby accelerating the progress of pig genetic improvement and effectively improving the economic benefits of pig breeding.
[0008] According to a third aspect of the present invention, a method for improving the quality of boar semen is provided, the method comprising the following steps: 1) Detect SNP molecular markers (g.306A>G molecular marker) in replacement boars. This SNP molecular marker is an A>G mutation located at position 31908556bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version; 2) Individuals with the AA or AG alleles detected in step 1) are selected as breeding boars, while individuals with the GG genotype are culled. This effectively increases sperm linear motility and reduces distal droplets in the semen, thereby significantly improving the semen quality of the breeding boars. Therefore, this method can efficiently and conveniently improve boar semen quality, enhance the reproductive performance of the herd, and increase the economic benefits of the breeding farm.
[0009] According to a fourth aspect of the present invention, there is an application of SNP molecular markers in the breeding of boar breeds with high semen quality, wherein high semen quality refers to high sperm linear motility and / or low distal sperm droplet count, the application comprising the following steps: 1) Detect SNP molecular markers (g.306A>G molecular marker) in replacement boars. This SNP molecular marker is an A>G mutation located at position 31908556bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version; 2) Select individuals with AA or AG alleles obtained in step 1) as breeding boars and mate them; 3) Test the SNP molecular markers (g.306A>G molecular markers) of the boars born from mating in step 2). Retain individuals with the AA and AG genotypes, cull individuals with the GG genotype, and then breed them again. Through successive generations of selection, a boar breed with high semen quality can be cultivated. Therefore, by using this application to cultivate a boar breed with high semen quality, the reproductive performance of breeding pig farms can be greatly improved, increasing economic benefits and market competitiveness.
[0010] According to a fifth aspect of the present invention, there is an application of SNP molecular markers in improving boar semen quality, the application comprising the following steps: 1) Detect SNP molecular markers (g.306A>G molecular marker) in replacement boars. This SNP molecular marker is an A>G mutation located at position 31908556bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version; 2) Select individuals with AA or AG alleles obtained in step 1) as breeding boars and mate them; 3) Detect the SNP molecular markers (g.306A>G molecular marker) in the boars born after mating in step 2). Retain individuals with the AA and AG genotypes, and then breed and select boars with the AA and AG genotypes again, retaining the AA and AG genotypes in the offspring while culling those with the GG genotype. This process gradually increases the frequency of the dominant allele A, thereby improving sperm motility and reducing distal droplets in the boar semen, ultimately improving and enhancing the semen quality of the offspring boar population. Therefore, this application can improve the semen quality of boars in breeding farms, increasing reproductive performance and economic benefits.
[0011] According to a sixth aspect of the present invention, an application of an SNP molecular marker for evaluating / screening boar sperm linear motility / distal droplet traits is provided, wherein the SNP molecular marker is an A>G mutation located at position 31908556 bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version. Therefore, the linear motility / distal droplet traits of boar sperm can be evaluated and screened rapidly, conveniently, and efficiently.
[0012] According to a seventh aspect of the present invention, a nucleotide sequence containing an SNP molecular marker associated with the linear motility / distal droplet trait of porcine sperm is provided. This sequence contains the nucleotide sequence shown in SEQ ID No:1, where M at position 306 bp in the sequence shown in SEQ ID No:1 represents an A>G base mutation. Therefore, primers or probes can be designed using this nucleotide sequence to detect the genotype of the corresponding SNP molecular marker, and then further selection of porcine sperm for the linear motility / distal droplet trait can be performed based on the detection results; or primers can be designed using this nucleotide sequence to prepare a corresponding detection kit for direct detection of the SNP molecular marker, and then selection of porcine sperm for the linear motility / distal droplet trait can be performed based on the detected genotype.
[0013] According to an eighth aspect of the present invention, a nucleotide sequence is provided for use in the preparation of a product for detecting the linear motility / distal droplet trait of porcine sperm, the nucleotide sequence containing the nucleotide sequence shown in SEQ ID No:1, wherein the M at position 306 bp in the sequence shown in SEQ ID No:1 represents an A>G base mutation. Thus, the genotype of the SNP molecular marker can be rapidly detected using this product, and then further selection of porcine sperm for the linear motility / distal droplet trait can be performed based on the detection results.
[0014] According to a ninth aspect of the present invention, primers are provided for identifying SNP molecular markers affecting the linear motility / distal droplet characteristics of porcine sperm, the nucleotide sequences of which are shown in SEQ ID No:2 and SEQ ID No:3. Thus, using this primer pair, an efficient and accurate marker-assisted breeding technique can be established, enabling rapid and accurate selection of semen quality and accelerating the breeding process.
[0015] According to a tenth aspect of the present invention, a primer is provided for the identification / detection of linear motility / distal droplet traits in boar sperm or for the selection of boar sperm linear motility / distal droplet traits, the nucleotide sequence of which is shown in SEQ ID No:2 and SEQ ID No:3. Thus, this application enables the establishment of an efficient and accurate molecular marker-assisted breeding technology, allowing for rapid and accurate selection of semen quality and accelerating the breeding process.
[0016] The beneficial effects of this invention are: (1) This invention studies and identifies the g.306A>G molecular marker located on chromosome 10 of pigs, which is related to linear sperm motility and / or distal droplet. It verifies the effects of this marker on linear sperm motility and distal droplet traits, ultimately establishing an efficient and accurate marker-assisted breeding technology. This technology is applied to the genetic improvement of boar semen quality, thereby improving the reproductive performance of offspring pigs, increasing enterprise economic profits, and enhancing core competitiveness. By selecting the dominant allele A of this SNP, the frequency of the dominant allele A can be increased generation by generation, improving the semen quality of breeding pigs. This synergistic selection of superior breeding pigs exhibiting the above two traits accelerates the progress of pig genetic improvement, effectively enhancing the economic benefits of pig breeding.
[0017] (2) This invention provides a nucleotide sequence containing SNP molecular markers associated with the linear motility / distal droplet trait of porcine sperm. Primers or probes can be designed using this nucleotide sequence to detect the genotype of the corresponding SNP molecular marker, and then the porcine sperm linear motility / distal droplet trait can be further selected based on the detection results; or primers can be designed using this nucleotide sequence to prepare corresponding detection kits for direct detection of SNP molecular markers, and then the porcine sperm linear motility / distal droplet trait can be selected based on the detected genotype. This allows for the establishment of an efficient and accurate molecular marker-assisted breeding technology, enabling rapid and accurate selection of semen quality and accelerating the breeding process.
[0018] (3) This invention provides a primer pair for identifying SNP molecular markers on chromosome 10 of pigs that are associated with linear sperm motility and distal droplets. Through this primer pair, an efficient and accurate molecular marker-assisted breeding technology can be established to quickly and accurately select sperm quality and accelerate the breeding process. Attached Figure Description
[0019] Figure 1 Manhattan plots of genome-wide association analysis (GWAS) related to sperm linear motility and distal droplets on chromosome 10 in Duroc pigs: where the horizontal axis represents the chromosome number of the pig and the vertical axis represents the -logP value. Figure A is the Manhattan plot of GWAS related to sperm linear motility, and Figure B is the Manhattan plot of GWAS related to sperm distal droplets. Detailed Implementation
[0020] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.
[0021] Example 1: Screening of molecular markers and association analysis with porcine semen traits (1) Laboratory animals The experimental pig herd used in this invention consisted of 3,604 purebred Duroc boars from the breeding pig division of Guangxi Yangxiang Group Co., Ltd. All Duroc boars from this herd were selected for this experiment. The pigs had free access to feed and water, and the feeding methods and conditions remained consistent throughout the entire process, following conventional methods.
[0022] (2) Performance data collection Semen was collected from Duroc boars in the experimental animals. After collection using automated semen collection technology in the pigpen, the semen was promptly transported to the laboratory for analysis using an electronic balance and a computer-aided electronic analysis system (CASA IVOS II). The characteristics and methods for measurement are as follows: Sperm linear motility rate: the percentage of sperm that move in a straight line forward. Sperm distal droplet ratio: if a protoplasmic droplet (a type of cytoplasmic droplet) is located more than 4µm from the base of the sperm head, it is defined as a distal droplet; the distal droplet ratio is the percentage of sperm containing distal droplets.
[0023] (3) Sample collection The collected Duroc pig ear tissue was soaked in a 75% ethanol solution and stored at -20°C for later use.
[0024] (4) Pig genome 80K SNP genotyping Ear tissue was collected from each of the 3604 Duroc pigs selected from the aforementioned resource population. Whole-genome DNA was extracted using the standard phenol-chloroform method. The concentration and OD ratio (OD260 / 280, OD260 / 230) of each sample were accurately determined using a NanoDrop 2000 / 2000C nucleic acid and protein analyzer. DNA samples that passed the NanoDrop 2000 / 2000C nucleic acid and protein analyzer test were diluted to approximately 50 ng / μL. 6 μL of the extracted DNA sample was then mixed with 2 μL of loading buffer and loaded onto a 1% (w / v) agarose gel. Electrophoresis was performed at 150V for 25 min. The DNA integrity was observed and photographed using a UV spectrophotometer and gel imaging device.
[0025] DNA samples were sent to Wuhan Shadow Gene Technology Co., Ltd., where the pig whole genome 80K functional locus gene chip (Shadow Gene) was used for genotyping of qualified DNA samples. PLINK was used to perform quality control on the 80K chip scanning genotyping data of all samples, removing individuals with a detection rate below 90%, a family Mendelian error rate above 0.1, a minimum allele frequency below 0.05, and a Hardy-Weinberg equilibrium significance level above [missing value]. SNPs.
[0026] (5) Genotype filling Genotype imputation primarily utilizes a reference haplotype library from a reference population. Software is then used to imput 80K SNPs microarray data into whole-genome sequencing data based on this reference haplotype library. This study employed Beagle software in conjunction with the PGRP reference panel for genotype imputation.
[0027] (6) Genome-wide association study (GWAS) Because semen quality phenotypic data includes multiple ejaculation records collected from each individual at different time points, GWAS analysis was performed using the repetitive force model in GMAT software to interpret this structure. The threshold value was set as the significance level for the association with sperm quality traits. This analytical framework is based on the following model:
[0028] Where: Y is the phenotypic vector; b is the fixed effects vector, which includes population structure effects, sampling year, and sampling season; It is a vector of coefficients of a random regression polynomial, representing the additive genetic effect, where It is a label-based relational matrix. For Kronecker product, It is the covariance matrix of the coefficients in the additive polygenic effect random regression. It is an individual-specific, persistent environmental effect, where I is the identity matrix. It is the variance-covariance matrix of the random regression coefficients of persistent environmental effects; It is the residual effect, where R is a diagonal matrix with different values at different time points.
[0029] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that in Duroc, there are sites on chromosome 10 that significantly affect sperm linear motility and distal droplet size, with the strongest association being the G.306A>G molecular marker. P The values are respectively , The SNP molecular marker is an A>G mutation located at position 31908556 bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version, hereinafter referred to as "g.306A>G molecular marker".
[0030] (7) Colocation analysis To identify potential regulatory genes and their shared causal variations with phenotypes, Bayesian colocalization analysis was performed using the R package "coloc". First, summary statistics of expressed quantitative trait loci (eQTLs) were obtained from the PigGTEx database. Single nucleotide polymorphisms (SNPs) within ±1 Mb of independent variation in conditional analysis were used as the colocalization SNP set. Bayesian colocalization analysis was performed by integrating the genetic information of these SNPs, including relevant data from GWAS and eQTL summary statistics. A posterior probability (PP4) greater than 0.8 was used as the threshold for moderate to strong colocalization evidence.
[0031] (8) Association analysis between different genotypes and sperm linear motility and distal droplet phenotype As shown in Table 1, the g.306A>G molecular marker was significantly correlated with sperm linear motility (P<0.001), indicating that this molecular marker significantly affects sperm linear motility in pigs. By assisted selection at this SNP site in pigs, the semen quality of the population can be improved, thereby accelerating the breeding process.
[0032] Table 1. Correlation analysis of SNP sites g.306A>G of molecular markers with linear sperm motility.
[0033]
[0034] Note: The sperm linear motility rate in the table refers to the percentage of sperm in semen that can move in a straight line.
[0035] As shown in Table 2, the g.306A>G molecular marker was significantly correlated with the distal sperm droplet trait (P<0.001), indicating that this molecular marker significantly affects the distal sperm droplet trait in pigs. By assisted selection at this SNP site in pigs, the semen quality of this population can be improved, thereby accelerating the breeding process.
[0036] Table 2. Correlation analysis of SNP sites g.306A>G of molecular markers with distal sperm droplets.
[0037]
[0038] Note: The distal droplet ratio in the table refers to the percentage of sperm containing distal droplets in the semen.
[0039] Furthermore, as shown in Tables 1 and 2, AA and AG genotypes exhibit more linear sperm motility than GG genotypes, and AA and AG genotypes have fewer distal sperm droplets than GG genotypes, with these two traits showing synergistic changes. For the linear sperm motility trait, the average phenotype of AA individuals is 2.04% higher than that of GG individuals; for the distal sperm droplet trait, the average phenotype of AA individuals is 0.54% lower than that of GG individuals. Therefore, A is the dominant allele, and the AA genotype is the dominant genotype. Gradually retaining AA and AG genotype pigs and culling GG genotype pigs in breeding, to progressively increase the frequency of the dominant allele A at this locus, can significantly improve the linear sperm motility rate, reduce the distal sperm droplet, and improve the semen quality of breeding pigs, bringing greater economic benefits to breeding enterprises.
[0040] Example 2: Amplification and sequencing of the target DNA sequence using the g.306A>G molecular marker. The g.306A>G molecular marker, as described in Ensembl (http: / / asia.ensembl.org / index.html) (Sscrofa11.1), is located at position 31908556 bp on chromosome 10 of the pig genome in the Ensembl Sscrofa11.1 version, where an A>G base mutation occurs.
[0041] (1) Primer design Primers were designed based on the location of the g.306A>G molecular marker in the porcine genome and using the primer design software PrimerPremier 6.0. The designed primer sequences are shown below: P001-F (SEQ ID No:2): 5'-TGTAGGTCAGAGACACGGCT-3', P002-R (SEQ ID No: 3): 5'-TGCATTGCCCCAAGTCTCAG-3'.
[0042] This primer allows for the efficient, rapid, and convenient detection, screening, identification, and evaluation of SNP molecular markers (g.306A>G molecular markers) associated with linear motility / distal droplet traits in porcine sperm, and can be further used for breeding of porcine sperm with linear motility / distal droplet traits.
[0043] (2) PCR amplification To a 10 μL reaction mixture, add 1 μL of DNA template, 3.4 μL of double-distilled water, 5 μL of 2×Tag PCR StanMixwithLoading Dye, and 0.3 μL each of primers P001-F and P002-R. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min, followed by 35 cycles of 94℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 45 s, with a final extension at 72℃ for 5 min.
[0044] (3) DNA sequencing DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, with two separate sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown in SEQ ID No:1, where the mutation occurs at base position 306. M(A>G) This indicates an A>G base mutation: TGTAGGTCAGAGACACGGCTCAGATCCTGCTGTGGCTGTAGTGTAGGCTGGTGGCTACAGCTCTGATTCTACCCCTAGCCTCGGACCCTCCATATGCCATGGATGCAGCCCTAAAAAGATTAAAAAAAAAATATATATATATATATGGAGTTCCCATTGTGGTGCAGCAGAAACAAATCCGACTAGGAACCATGAGGTTGCGGGTTTGATCCCTGGCCTCACTCAGTGCCATGAGCTGTGGTATAGGTCGTAGACATGGCTTGGATCTGGCATTGCTGTGGCTGTGGCGTAGCCTGGCAGCTGCG M(A>G)CTCCAATTGGACCCTGAACCTGGGAGCCTCCATATGCTGCTGGTGTGGGCCTAAAAAGCAAAAAAGCAAAAAAAAAAAAAAAAAGGTAAAATTAAAAGTATATATATATAATAATAAGTGATAGAAACAAGAAAAAGTTAATATATTGTTATTATTGTTATTATATCTGTTATTATATATAACATTATATTATATTGTTATATCTGTGTAGGTGTTTGTAATA CAAGCTCTTCTCTATTCTGAAATATGAAACTATTTTTTTCTCTTGCAAAAATCTGACAAATGATTTCTCAAGAAATTTTTCATTTAGAAAAGTCTTTATCCTACTGTATAGCACAAGGAACTATATCCAATCTCTTGTGACAGAACATGATGGAAGATAATATGAGAAGAAGAATATATATATATATATATATGCATATTATATATATGACTGGGTCACCTTGC TGTACAGTGAAATTGACACATTATAAATCAAAACAATAATTTAGAAAAATTTTTGAAGTATTCTATTTTTTAATTTTGATACCTAAAAATACTTACATAAGGAGTTCCCTGGTGGCTCAGCATGTTAACGATCCAGCATTGTCACTGCTATTGCTGGGCCCACAGCTGTGACGTGGGCTCAATCCCTGGCCCAGGAACTTCCACGTGCCATGGGCATGACCAA AAAAAATTACTTAAATGAAAGCAGCAGAAATACTTGAGCTTTTTTTGAACTCTGATCATGGAAATCTGATTTATATTAACACCTTTTTAAAATAATTCTCATGATCAGAACATTATGTGAAAATCTAGATAAGGCTAAATTTGTTTAGATACTTAGCGCTCACAGTACTTAACCAAGTAGAAGTCAGGAGCATAGAAGACAGAGTCCTTTCTCTATTTAGGAAA CTGAGACTTGGGGC AATGCA Note: In the sequence shown in SEQ ID No:1, base M at position 306 is the mutation site, indicating an A>G base mutation, and is shown in bold and underlined (in parentheses).A>G (These are mutated bases, allele mutations). The bold underlines at the beginning and end of this sequence indicate the positions of the designed primer sequences.
[0045] Using the nucleotide sequences containing SNP molecular markers associated with the linear motility / distal droplet trait of porcine sperm, primers or probes can be designed to detect the genotype of the corresponding SNP molecular marker. Based on the detection results, further selection of porcine sperm for the linear motility / distal droplet trait can be performed. Alternatively, primers can be designed using this nucleotide sequence to create corresponding detection kits for direct detection of SNP molecular markers, followed by selection of porcine sperm for the linear motility / distal droplet trait based on the detected genotype. Primers or probes designed based on the nucleotide sequence shown in SEQ ID No:1, or directly used to create corresponding detection kits, can efficiently, quickly, and conveniently detect / screen / identify / evaluate SNP molecular markers associated with the linear motility / distal droplet trait of porcine sperm, and further be used for selection of porcine sperm for the linear motility / distal droplet trait.
[0046] Example 3: Analysis of the molecular marker effect of g.306 A>G As shown in Tables 1 and 2, for sperm linear motility and distal droplet, the dominant allele (AA) of the g.306 A>G molecular marker significantly increased the sperm linear motility rate by 2.04% and decreased the distal droplet ratio by 0.54% compared to the GG phenotype, respectively. Therefore, by using molecular marker-assisted selection to retain the AA and AG genotypes in the population and gradually culling pigs with the GG genotype, the allele frequency of allele A can be significantly increased, thereby improving the sperm linear motility rate and reducing the distal droplet ratio in breeding boars. This improves the reproductive performance of boars and drives up pork sales, bringing significant economic benefits to enterprises.
[0047] Furthermore, by detecting the mutation site at position 306 in the SEQ ID NO:1 sequence, a preliminary association analysis was conducted between its genotype and the linear motility and distal droplet characteristics of porcine sperm, providing a new molecular marker for marker-assisted selection in pigs.
[0048] Example 4: A method for improving the quality of boar semen 1) Genotyping of replacement boars using the g.306 A>G molecular marker; 2) Select individuals with the AA or AG alleles detected in step 1) as breeding boars and cull individuals with the GG genotype. This can effectively improve the linear sperm motility rate and reduce distal droplets, thereby effectively improving the semen quality of the breeding boars.
[0049] Example 5: Application of g.306A>G molecular marker in breeding boar breeds with high semen quality 1) Genotyping of replacement boars using the g.306 A>G molecular marker; 2) Select individuals with AA or AG alleles obtained in step 1) as breeding boars and mate them; 3) Test the genotype of the g.306 A>G molecular marker in the boars born from mating in step 2). Keep individuals with AA and AG genotypes and eliminate individuals with GG genotype. Then breed them. Through successive generations of screening, the linear motility rate of sperm in semen can be increased and / or the distal droplet of sperm can be reduced, so as to cultivate a boar breed with high semen quality.
[0050] Example 6: Application of g.306A>G molecular marker in improving boar semen quality 1) Genotyping of replacement boars using the g.306 A>G molecular marker; 2) Select individuals with AA or AG alleles obtained in step 1) as breeding boars and mate them; 3) Detect the genotype of the g.306 A>G molecular marker in the boars born after mating in step 2). Retain individuals with AA and AG genotypes, and breed and select boars with AA and AG genotypes again. Retain individuals with AA and AG genotypes in the offspring boars and eliminate individuals with GG genotypes. This is to increase the frequency of the dominant allele A in each generation, thereby increasing the linear sperm motility rate and reducing distal droplets in the boar semen, and thus improving and enhancing the semen quality of the offspring boar population.
[0051] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. SNP molecular markers affecting linear motility / distal droplet characteristics of porcine sperm, among which, The SNP molecular marker is the A>G mutation located at position 31908556 bp on chromosome 10 of the pig genome Ensembl Sscrofa 11.1 version.
2. The application of the SNP molecular markers described in claim 1 in the selection of linear motility and / or distal droplet traits in porcine sperm.
3. A method for improving the quality of boar semen, wherein, The method includes the following steps: 1) Detection of the SNP molecular markers as described in claim 1 in replacement boars; 2) Select individuals with the AA or AG alleles detected in step 1) as breeding boars and cull individuals with the GG genotype. This can effectively improve the linear sperm motility rate and reduce distal droplets in the semen, thereby effectively improving the semen quality of the breeding boars.
4. The application of the SNP molecular marker as described in claim 1 in the breeding of boar breeds with high semen quality, wherein, High semen quality refers to high sperm linear motility and / or low distal sperm droplet count. The application includes the following steps: 1) Detection of the SNP molecular markers as described in claim 1 in replacement boars; 2) Select individuals with AA or AG alleles obtained in step 1) as breeding boars and mate them; 3) Test the boars born from mating in step 2) for the SNP molecular markers as described in claim 1, retain individuals with AA and AG genotypes, eliminate individuals with GG genotypes, and then breed them. Through successive generations of screening, a boar breed with high semen quality can be cultivated.
5. The application of the SNP molecular marker as described in claim 1 in improving boar semen quality, wherein, The application includes the following steps: 1) Detection of the SNP molecular markers as described in claim 1 in replacement boars; 2) Select individuals with AA or AG alleles obtained in step 1) as breeding boars and mate them; 3) Test the boars born after mating in step 2) for the SNP molecular markers as described in claim 1, retain individuals with AA and AG genotypes, and breed and select boars with AA and AG genotypes again, retaining individuals with AA and AG genotypes in the offspring boars and eliminating individuals with GG genotype, so as to increase the frequency of the dominant allele A in each generation, thereby increasing the linear motility rate of sperm in boar semen and reducing distal droplets, thereby improving and improving the semen quality of the offspring boar population.
6. The application of the SNP molecular markers described in claim 1 in evaluating / screening boar sperm linear motility / distal droplet traits.
7. Nucleotide sequences containing SNP molecular markers associated with linear motility / distal droplet traits in porcine sperm, wherein, The sequence contains the nucleotide sequence shown in SEQ ID No:1, where M at position 306bp in the sequence shown in SEQ ID No:1 represents an A>G base mutation.
8. The use of the nucleotide sequence of claim 7 in the preparation of a product for detecting linear motility / distal droplet characteristics of porcine sperm.
9. A primer for identifying SNP molecular markers affecting linear motility / distal droplet characteristics of porcine sperm, wherein, The nucleotide sequences of the primers are shown in SEQ ID No:2 and SEQ ID No:
3.
10. The application of the primers described in claim 9 in the identification / detection of linear motility / distal droplet traits in boar sperm or in the selection of boar sperm linear motility / distal droplet traits.