Yellow flammulina velutipes strain as well as identification method and application thereof

Abstract

The invention relates to a yellow flammulina velutipes C53 with a preservation number of GDMCC No.67334. The yellow flammulina velutipes C53 has the advantages of high yield, short growth cycle, more edible parts of stipes, difficulty in browning of stipe bases, long preservation time and stable inheritance, and is used for cultivation and breeding of flammulina velutipes. The invention also relates to an identification method of the flammulina velutipes C53, which comprises the following steps: by taking the DNA of the flammulina velutipes mycelium to be detected as a template, carrying out PCR (Polymerase Chain Reaction) amplification by adopting the primer combination 1 and / or the primer combination 2, and detecting whether an amplification product has a band with a specific size so as to identify the C53. The screening method is simple to operate, and detection can be performed only by using mycelia; the detection time is only 2-3 hours, so that the breeding efficiency is improved, and the cost is greatly saved.

Description

A strain of *Flammulina velutipes*, its identification method, and its application. Technical Field

[0001] This invention relates to the field of biology, specifically to a strain of *Flammulina velutipes*, its identification method, and its applications. Background Technology

[0002] Enoki mushrooms (Flammulina filiformis) have a delicious flavor and are rich in nutrients, including essential proteins, amino acids, vitamins, unsaturated fatty acids, and dietary fiber. In addition to nutrients, enoki mushrooms also contain bioactive compounds beneficial to human health. Various bioactive components have been identified and extracted from their fruiting bodies, including fungal polysaccharides, fungal immunomodulatory proteins, lectins, flavonoids, terpenes, glycosides, and phenolic compounds. These compounds have specific functions in anti-tumor activity, lowering blood pressure, lowering cholesterol, anti-oxidation, reducing fatigue, and delaying aging. They also have some therapeutic effects on liver diseases and allergic respiratory diseases. Enoki mushrooms are cultivated in many countries and regions worldwide, accounting for more than 10% of the world's cultivated edible fungi production. They have become one of the most popular and widely consumed edible fungi in the world. China is the world's largest producer of enoki mushrooms, achieving large-scale factory cultivation with an annual output exceeding 2 million tons.

[0003] Enoki mushrooms include two main varieties: yellow and white. Yellow enoki mushrooms are a traditional cultivated variety in my country, with production mainly concentrated in the Sichuan and Chongqing regions. Besides fresh sales, they also supply over 90% of the raw materials for processed enoki mushroom products in my country. In recent years, the production of yellow enoki mushrooms has shown a significant upward trend, and its production model has gradually shifted from agricultural cultivation to factory-style cultivation. Currently, large-scale cultivation of yellow enoki mushrooms suffers from drawbacks such as easy browning at the base of the stem, poor storage and transportation tolerance, and short shelf life. During processing, the browned parts need to be trimmed or treated with decolorizing agents, increasing costs. Therefore, there is an urgent need to breed varieties with stem bases less prone to browning. Furthermore, given the difficulty in distinguishing enoki mushroom strains by appearance, the market is flooded with counterfeit new varieties, necessitating a rapid and accurate method for variety identification. Summary of the Invention

[0004] The purpose of this invention is to provide a yellow enoki mushroom, named enoki mushroom C53 (Flammulina filiformis), with accession number GDMCC No. 67334.

[0005] Another object of the present invention is to provide specific primer combinations, which are either primer combination 1 or primer combination 2 or a combination thereof.

[0006] In a preferred embodiment of the present invention, the primer combination 1 includes an upstream primer F with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0007] In a preferred embodiment of the present invention, the primer combination 2 includes an upstream primer F with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.6.

[0008] Another object of the present invention is to provide the application of the present invention’s yellow enoki mushroom and / or specific primer combination in the cultivation and breeding of enoki mushroom.

[0009] Another objective of this invention is to provide a method for identifying Flammulina filiformis C53, which has the accession number GDMCC No. 67334. The method specifically includes the following steps: using the DNA of the mycelium of Flammulina filiformis to be tested as a template, performing PCR amplification using primer combination 1 and / or primer combination 2, detecting whether a band of a specific size appears in the amplification product, and identifying C53 based on the band type.

[0010] In a preferred embodiment of the present invention, the extracted mycelial DNA of *Flammulina velutipes* is used as a template, and PCR amplification is performed using primer combination 1 targeting the InDel site on chromosome 7 (location: 2307519-2307651). The amplification product is analyzed by agarose gel electrophoresis. If a specific band appears at 132 bp, it is C53 positive; otherwise, it is negative.

[0011] In a preferred embodiment of the present invention, the nucleotide sequence of the 7th stain is SEQ IN NO.1.

[0012] In a preferred embodiment of the present invention, the extracted mycelial DNA of the mushroom *Flammulina velutipes* is used as a template, and PCR amplification is performed using primer combination 2 targeting the InDel site on chromosome 4 (location: 664641-664758). The amplification product is analyzed by agarose gel electrophoresis. If a specific band appears, it is C53 positive; otherwise, it is negative.

[0013] In a preferred embodiment of the present invention, the extracted mycelial DNA of *Flammulina velutipes* is used as a template, and PCR amplification is performed using primer combination 2 targeting the InDel site on chromosome 4 (location: 664641-664758). The amplification product is analyzed by agarose gel electrophoresis. If a specific band appears at 117 bp, it is C53 positive; otherwise, it is negative.

[0014] In a preferred embodiment of the present invention, the nucleotide sequence of chromosome 4 is SEQ IN NO.2.

[0015] In a preferred embodiment of the present invention, the extracted mycelial DNA of *Flammulina velutipes* is used as a template, and PCR amplification is performed using a combination of primer combination 1 and primer combination 2 targeting the InDel sites on chromosome 7 (locations: 2307519-2307651) and chromosome 4 (locations: 664641-664758). The amplification products are analyzed by agarose gel electrophoresis. If specific bands appear simultaneously at 132 bp and 117 bp, the result is C53 positive; otherwise, it is negative.

[0016] In a preferred embodiment of the present invention, the PCR amplification process comprises, for every 20.0 μL of amplification reaction system, 10 μL of high-fidelity enzyme premix, 8 μL of RNase-free double-distilled water, 0.5 μL each of upstream and downstream primers, and 1 μL of DNA template.

[0017] In a preferred embodiment of the present invention, the PCR amplification program is as follows: pre-denaturation at 96°C for 5 minutes; denaturation at 96°C for 30 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 15 seconds, for a total of 30 cycles; final extension at 72°C for 5 minutes.

[0018] Unless otherwise stated, when this invention relates to percentages between liquids, the percentage is volume / volume percentage; when this invention relates to percentages between liquids and solids, the percentage is volume / weight percentage; when this invention relates to percentages between solids and liquids, the percentage is weight / volume percentage; the remainder is weight / weight percentage.

[0019] Compared with the prior art, the beneficial technical effects of the present invention include:

[0020] 1. The yellow enoki mushroom C53 scientifically screened by this invention has high yield, short growth cycle, less browning at the base of the stipe, high edible portion of the stipe, long shelf life, and stable genetic inheritance. It has high commercial value for enoki mushroom cultivation and breeding.

[0021] 2. This invention provides specific primer combinations 1 and 2 for screening, which are highly specific for PCR diagnosis of strain C53. The two primer combinations can be used individually or simultaneously. This screening method is simple to operate, requiring no fruiting bodies after fruiting; only mycelium is needed for detection. The detection time is only 2-3 hours (significantly shorter than the 1-2 weeks of traditional mycelial antagonism tests), improving breeding efficiency while significantly saving costs.

[0022] 3. This invention is simple to operate, low in cost, and suitable for large-scale production.

[0023] Preservation of biological materials

[0024] The yellow enoki mushroom described in this invention is named enoki mushroom C53 (Flammulina filiformis), and was deposited on November 21, 2025, with accession number GDMCC NO:67334. The depository is Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province. Attached Figure Description

[0025] Figure 1. Fruiting body of Flammulina velutipes strain C53;

[0026] Figure 2. DNA extraction from *Flammulina velutipes* strains;

[0027] Figure 3 shows the electrophoresis results of the PCR products of primer combination 1;

[0028] Figure 4 shows the electrophoresis results of the PCR products of primer combination 2. Detailed Implementation

[0029] The present invention will be described below with reference to the embodiments. However, the present invention is not limited to the embodiments.

[0030] The sequences involved in the embodiments are shown in Table 1.

[0031] Table 1

[0032] Numbering sequence SEQ INNO.1CATCGTGAATGCAGTCGTCGTGACAGTTGGTTCGAAATATTGGCCCAGTTCCATGAATCGTTAGTGCCTGTCACTCTCTGAGGGTGGCATTCTGGTGTGGTGCCACGGTGGTACCACACCGTGTGTAGACGTSEQ INNO.2CATCGTGAATGCAGTCGTCGSEQ INNO.3ACGTCTACACACGGTGTGGTSEQ INNO.4ACATGTATCGCGTTTGCAGCCCTGATGCAAAAGGATAGTCGCTTTTCGAAGGGGCTACGCGCGACCGGGATAGGTGGCTGCATTTGCACGAATTGAGAGCTCGTTGAGGCAGTTCTGSEQ INNO.5ACATGTATCGCGTTTGCAGCSEQ INNO.6CAGAACTGCCTCAACGAGCT surface

[0033] Example 1: Screening of the *Flammulina velutipes* strain of the present invention

[0034] Using the yellow enoki mushroom Chuanjin 10 as the parent, hybridization was conducted with other yellow enoki mushrooms to screen for high-yielding hybrid strains with less browning at the base of the stipe. Further tissue isolation was performed on fruiting bodies, and the resulting yellow enoki mushroom strain was obtained by culturing on PDA medium. This yellow enoki mushroom was identified and named *Flammulina filiformis* C53. It was deposited on November 21, 2025, with accession number GDMCC NO:67334, at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0035] Example 2: Industrialized bag cultivation of enoki mushrooms according to the present invention

[0036] The *Flammulina velutipes* strain C53 from Example 1 was inoculated onto PDA medium and cultured at 25°C for 7 days. Ten mycelial blocks (2cm x 2cm) were cut and directly inoculated onto the cultivation substrate, with 30 bags inoculated from each block. The PDA medium formula was: 10g potato, 20g glucose, 15g agar, and distilled water to a final volume of 1L. The medium was sterilized at 121°C for 30 minutes. The cultivation substrate formula was: 69g cottonseed hulls, 20g rice bran, 10g wheat bran, 1g lime, and 140g water. Each cultivation bag (23cm x 38cm) contained 2000g of cultivation substrate.

[0037] The cultivation conditions are as follows: during the mycelial growth stage, the temperature is 25℃, in the dark, and the relative humidity is around 70%. After the mycelium has fully colonized the bottle, the mycelium is scratched and moved to a low-temperature fruiting room, where the temperature is around 15℃, the relative humidity is around 95%, and the carbon dioxide concentration is around 3000 ppm. After a large number of primordia have formed, the temperature is adjusted to 7℃, the carbon dioxide concentration is around 8000 ppm, and the light intensity is about 50 lux. When the fruiting bodies grow to 3-4 cm, they are covered with plastic bags with openings at both ends, and the top is tied off, leaving an opening of 1-2 inch. The fruiting bodies are ready for harvest when they reach a length of about 17 cm.

[0038] The first flush of mushrooms has a growth period of about 50 days, with an average yield of 531g / bag. The fruiting body has a pale yellow cap and a nearly white, medium-thick stipe, with over 90% of the stipe being edible (Figure 1). The stipe is not prone to browning and can be stored at 4℃ for up to 7 days, effectively extending the post-harvest storage time and increasing its commercial value.

[0039] The C53 strain exhibits uniform behavior and stable genetic traits in the field, making it a suitable breeding resource. Using the C53 strain as breeding material and hybridizing it with other enoki mushrooms can yield enoki mushrooms that are less prone to basal browning.

[0040] Example 3: DNA extraction from *Flammulina velutipes* according to the present invention

[0041] The *Flammulina velutipes* strain C53 from Example 1 and each of the *Flammulina velutipes* strains in Tables 2-3 were inoculated onto PDA medium and cultured at 25°C for 7 days to obtain mycelium. 100 mg of each *Flammulina velutipes* mycelium was taken and DNA was extracted from each strain using a fungal DNA extraction kit (MolPure® Fungal DNA Kit, 18812ES50, purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), as shown in Figure 2.

[0042] Table 2. Sources of wild enoki mushroom strains

[0043] Number Collection Location 1 Gongshan Dulong and Nu Autonomous County, Yunnan Province 2 2 Tongzhou District, Beijing 2 Xifeng County, Guiyang City 2 3 Fusong County, Baishan City, Jilin Province 3 Tongzhou District, Beijing 2 4 Dianjiang County, Chongqing 4 Keqiao District, Shaoxing City, Zhejiang Province 2 5 Keqiao District, Shaoxing City, Zhejiang Province 5 Tongzhou District, Beijing 2 6 Beibei District, Chongqing 6 Tongzhou District, Beijing 2 7 Xuanwu District, Nanjing City, Jiangsu Province 7 Baota District, Yan'an City, Shaanxi Province 2 8 Wuhan City, Hubei Province 8 Fujian Fuzhou Agricultural and Forestry University 2 9 Yuhua District, Shijiazhuang City, Hebei Province 9 Shihezi City, Xinjiang Uygur Autonomous Region 3 0 Yongxin County, Ji'an City, Jiangxi Province 10 Keshiketeng Banner, Chifeng City 3 1 Qianxi City, Guizhou Province 1 1 Beibei District, Chongqing 3 2 Shanzhou District, Sanmenxia City, Henan Province 1 2 Hebei 33 Zunhua City, Tangshan City, Guizhou Province; 13 Baiyun District, Guiyang City, Guizhou Province; 34 Zhengding County, Shijiazhuang City, Hebei Province; 14 Baota District, Yan'an City, Shaanxi Province; 35 Yadong County, Shigatse City, Tibet Autonomous Region; 15 Keshiketeng Banner, Chifeng City, Inner Mongolia Autonomous Region; 36 Langfang City, Hebei Province; 16 Keqiao District, Shaoxing City, Zhejiang Province; 37 Xixia County, Nanyang City, Henan Province; 17 Jilin Agricultural University, Changchun City, Jilin Province; 38 Huazhong Agricultural University, Wuhan City, Hubei Province; 18 Xixia County, Nanyang City, Henan Province; 39 Baoxing County, Ya'an City, Sichuan Province; 19 Yuhong District, Shenyang City, Liaoning Province; 40 Zhengding County, Shijiazhuang City, Hebei Province; 20 Shimian County, Ya'an City, Sichuan Province; 41 Xiangcheng City, Zhoukou City, Henan Province; 21 Lushui City, Yunnan Province; 42 Zunhua City, Tangshan City, Hebei Province. surface

[0044] Table 3. Sources of commercially purchased Enoki mushroom strains

[0045] The strains of *Flammulina velutipes* are listed below, with the following strain numbers and purchasing companies: XQ-1 Guangdong Xiangqin Biotechnology Co., Ltd.; NWJ13 Fujian Wancheng Biotechnology Group Co., Ltd. (Fujian); GHT1 Fujian Ganghengtai Biotechnology Co., Ltd.; WH2 Tianshui Zhongxing Fungi Industry Technology Co., Ltd. (Yunmeng, Hubei); WH3 Shanghai Xuerong Biotechnology Co., Ltd. (Huaian, Jiangsu); GD1 Guangdong Daimi Biotechnology Co., Ltd.; HL1 Jiangsu Hualv Biotechnology Co., Ltd.; FK1 Shanghai Fengke Biotechnology Co., Ltd.; WC1 Fujian Wancheng Biotechnology Group Co., Ltd. (Nanjing); YD1 Shanghai Yongda Fungi Industry Co., Ltd.; XR1 Shanghai Xuerong Biotechnology Co., Ltd. (Chengdu, Sichuan); ZX1 Tianshui Zhongxing Fungi Industry Technology Co., Ltd. (Yangling, Shaanxi). surface

[0046] Example 4 Identification of the enoki mushroom strain C53 of the present invention

[0047] Primer set 1 (SEQ IN NO.2 and SEQ IN NO.3) was designed at the InDel site of chromosome 7 chr7: 2307519-2307651 (SEQ IN NO.1) on the C53 genome of the enoki mushroom strain C53 in Example 1. PCR amplification and 3% agarose gel electrophoresis were performed using DNA extracted from all strains in Example 3 as templates.

[0048] The high-fidelity enzyme premix (2× Hieff Canace® Plus PCR Master MixWith Dye, 10154ES08) used in the PCR experiments was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. RNase-free double-distilled water (B541018-0010) was purchased from Sangon Biotech (Shanghai) Co., Ltd. Primers used in the experiments were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The PCR reaction system (20 μL) consisted of: 10 μL high-fidelity enzyme premix, 8 μL RNase-free double-distilled water, 0.5 μL each of forward and reverse primers, and 1 μL DNA template. The PCR reaction program was: 96℃ pre-denaturation for 5 minutes; 96℃ denaturation for 30 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 15 seconds, for a total of 30 cycles; final extension at 72℃ for 5 minutes.

[0049] Extracted DNA was detected using 1% agarose gel electrophoresis. Agarose powder and nucleic acid dye were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and TAE buffer was purchased from Sangon Biotech (Shanghai) Co., Ltd. 1% agarose gel preparation: Weigh 0.5 g of agarose powder into an Erlenmeyer flask, add 50 mL of 1×TAE buffer, heat in a microwave oven until the solution is clear, add 5 μL of nucleic acid dye, mix well, and pour onto a gel plate. PCR products were analyzed using 3% agarose gel electrophoresis: Weigh 1.5 g of agarose powder into an Erlenmeyer flask, add 50 mL of 1×TAE buffer, heat in a microwave oven until the solution is clear, add 5 μL of nucleic acid dye, mix well, and pour onto a gel plate.

[0050] The results are shown in Figure 3. Only the *Flammulina velutipes* strain C53 was able to amplify a band of 132 bp; strains 9 and 24 also amplified bands, but the bands in the electrophoresis images were positioned higher and their lengths were greater than 132 bp; the other strains could not amplify bands, thus *Flammulina velutipes* strain C53 could be accurately identified.

[0051] Example 5 Identification of the *Flammulina velutipes* strain C53 of the present invention

[0052] Primer set 2 (SEQ IN NO.5 and SEQ IN NO.6) was designed at the InDel site of chromosome 4 chr4: 664641-664758 (SEQ IN NO.4) on the C53 genome of the *Flammulina velutipes* strain C53 in Example 1. PCR amplification and 3% agarose gel electrophoresis were performed using DNA extracted from all strains in Example 3 as templates.

[0053] The high-fidelity enzyme premix (2× Hieff Canace® Plus PCR Master MixWith Dye, 10154ES08) used in the PCR experiments was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. RNase-free double-distilled water (B541018-0010) was purchased from Sangon Biotech (Shanghai) Co., Ltd. Primers used in the experiments were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The PCR reaction system (20 μL) consisted of: 10 μL high-fidelity enzyme premix, 8 μL RNase-free double-distilled water, 0.5 μL each of forward and reverse primers, and 1 μL DNA template. The PCR reaction program was: 96℃ pre-denaturation for 5 minutes; 96℃ denaturation for 30 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 15 seconds, for a total of 30 cycles; final extension at 72℃ for 5 minutes.

[0054] Extracted DNA was detected using 1% agarose gel electrophoresis. Agarose powder and nucleic acid dye were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., and TAE buffer was purchased from Sangon Biotech (Shanghai) Co., Ltd. 1% agarose gel preparation: Weigh 0.5 g of agarose powder into an Erlenmeyer flask, add 50 mL of 1×TAE buffer, heat in a microwave oven until the solution is clear, add 5 μL of nucleic acid dye, mix well, and pour onto a gel plate. PCR products were analyzed using 3% agarose gel electrophoresis: Weigh 1.5 g of agarose powder into an Erlenmeyer flask, add 50 mL of 1×TAE buffer, heat in a microwave oven until the solution is clear, add 5 μL of nucleic acid dye, mix well, and pour onto a gel plate.

[0055] The results are shown in Figure 4. Only the *Flammulina velutipes* strain C53 was able to amplify a band of 117 bp; the other strains could not amplify the corresponding band, thus accurately identifying the *Flammulina velutipes* strain C53.

[0056] The above description of specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications based on the present invention, and as long as they do not depart from the spirit of the present invention, they should all fall within the scope of protection of the claims of the present invention.

Claims

1. A yellow enoki mushroom, named enoki mushroom C53 (Flammulina filiformis), with accession number GDMCCNo.67334.

2. A specific primer combination, wherein the primer combination is any one of primer combination 1 and primer combination 2 or a combination thereof, wherein primer combination 1 comprises an upstream primer F with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.3; and primer combination 2 comprises an upstream primer F with a nucleotide sequence as shown in SEQ ID NO.5 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.

6.

3. The application of the *Flammulina velutipes* C53 as described in claim 1 and / or the specific primer combination as described in claim 2 in the breeding of *Flammulina velutipes*.

4. A method for identifying Flammulina filiformis C53, with accession number GDMCC No. 67334, specifically includes the following steps: using the DNA of the mycelium of Flammulina filiformis to be tested as a template, performing PCR amplification using primer combination 1 and / or primer combination 2, detecting whether a band of a specific size appears in the amplification product, and identifying C53 according to the band type.

5. The method as described in claim 4, using the extracted mycelial DNA of the target *Flammulina velutipes* as a template, PCR amplification is performed using primer combination 1 targeting the InDel site on chromosome 7; the amplification product is analyzed by agarose gel electrophoresis, and if a specific band appears at 132 bp, it is C53 positive, otherwise it is negative, and the nucleotide sequence of chromosome 7 is SEQ ID NO.

1.

6. The method as described in claim 4, using the extracted mycelial DNA of the target enoki mushroom as a template, PCR amplification is performed using primer combination 2 targeting the InDel site on chromosome 4; the amplification product is analyzed by agarose gel electrophoresis, and if a specific band appears, it is C53 positive, otherwise it is negative.

7. The method as described in claim 4, using the extracted mycelial DNA of *Flammulina velutipes* as a template, PCR amplification is performed using primer combination 2 targeting the InDel site on chromosome 4; the amplification product is analyzed by agarose gel electrophoresis, and if a specific band appears at 117bp, it is C53 positive, otherwise it is negative, and the nucleotide sequence of chromosome 4 is SEQ ID NO.

3.

8. The method as described in claim 4, using the extracted mycelial DNA of *Flammulina velutipes* as a template, PCR amplification is performed on the InDel site on chromosome 7 using primer combination 1, and then PCR amplification is performed on the InDel site on chromosome 4 using primer combination 2; the amplification products are analyzed by agarose gel electrophoresis, and if specific bands appear at both 132 bp and 117 bp, it is C53 positive, otherwise it is negative.

9. The method according to any one of claims 4-8, wherein in the PCR amplification, each 20.0 μL amplification reaction system comprises: 10 μL of high-fidelity enzyme premix, 8 μL of RNase-free double-distilled water, 0.5 μL each of upstream and downstream primers, and 1 μL of DNA template.

10. The method according to any one of claims 4-8, wherein the PCR amplification program is as follows: pre-denaturation at 96°C for 5 minutes; denaturation at 96°C for 30 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 15 seconds, for a total of 30 cycles; final extension at 72°C for 5 minutes.

Images