SiRNA, kit, method for reducing the invasiveness of aphelenchus, and application thereof

Abstract

This invention provides an siRNA, kit, method, and application for reducing the invasive ability of Ichthyophthirius multifiliis (Ich), belonging to the field of molecular biology. The sense strand of the siRNA described in this invention is shown in SEQ ID NO.5, and the antisense strand is shown in SEQ ID NO.6. This siRNA can silence the expression of the cysteine ​​protease gene in Ich. Transfection of Ich by soaking Ich parasites in 30-100 nM siRNA for 12 h significantly reduces their invasive ability to the host. Experiments have confirmed that the Ich infection rate in goldfish transfected with this siRNA is significantly lower than that in the control group. This invention also provides a kit containing this siRNA and a method for applying it, which can be used to reduce the invasive ability of Ich and protect the Ich host, providing an efficient and reliable molecular tool for the prevention and control of Ich infection, with broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically to the prevention and control of parasitic diseases in aquatic animals, and particularly to an siRNA, kit, method, and application for reducing the invasive ability of Ichthyophthirius multifiliis. Background Technology

[0002] Ichthyophthirius multifiliis is a globally distributed parasitic protozoan that parasitizes the skin, gills, and other tissues of various freshwater fish, causing ichthyophthiriasis. This leads to skin damage, abnormal mucus secretion, respiratory distress, and even death in the host, seriously jeopardizing the healthy development of aquaculture. The skin and mucus serve as the first line of defense for the host's immune system and are the main barriers preventing Ichthyophthirius multifiliis predators from invading the host. When breaching this barrier, the predator must minimize damage to host tissues and evade the host's innate immune response. Its invasion process is not a simple mechanical penetration but also relies on related enzymes secreted by the parasite itself.

[0003] Knox (1994) proposed that the interaction between parasites and hosts often depends on the parasite's own enzymes, including acetylcholinesterase, polyamines, carbohydrate metabolism enzymes, proteases, superoxide dismutase, and glutathione S-transferase. These enzymes play a crucial role in parasite invasion, migration, and immune evasion. Related studies have also confirmed that the invasion of *Ichthyophthirius multifiliis* predators involves related enzymes secreted by the parasite (Hines & Spira, 1974; Matthews & Matthews, 1984; Ewing et al., 1985). These enzymes, as pathogenic factors of *Ichthyophthirius multifiliis*, are key target molecules for the development of antiparasitic drugs and vaccines, possessing significant research value and application prospects.

[0004] With the development of molecular biology techniques, our research team analyzed single-cell transcriptome data from *Ichthyophthirius multifiliis* and discovered that cysteine ​​protease-related genes are expressed in all four developmental stages of *Ichthyophthirius multifiliis*. Among them, the cysteine ​​protease *icp1* gene was annotated into the exosome pathway, suggesting that this gene may be involved in the release of *Ichthyophthirius multifiliis* secretions. Combined with previous studies, these secretions likely play a crucial role in *Ichthyophthirius multifiliis* invasion of the host. However, the specific function of the *Ichthyophthirius multifiliis* *icp1* gene remains unclear, and its mechanism of action in the infection process is still unknown. This lack of research not only limits our in-depth understanding of the pathogenic mechanism of *Ichthyophthirius multifiliis* but also hinders the development of anti-*Ichthyophthirius multifiliis drugs and vaccines targeting this gene.

[0005] RNA interference (RNAi) technology is a powerful tool for rapid analysis of gene function. It has been successfully applied in various protozoa, including Paramecium, Stelleria scabra, Echinochloa crus-galli, Trypanosoma brevicornu, Coelophysis, Toxoplasma gondii, Plasmodium, Cryptosporidium microsporum, and Entamoeba histolytica. By downregulating the expression of specific genes, this technology can be used to observe phenotypic changes and development of parasites, thereby revealing the function and pathogenic mechanism of specific genes in parasite biology.

[0006] Therefore, based on the gaps in existing technologies and research needs, it is urgent to conduct functional studies on the ICP1 gene of Ichthyophthirius multifiliis to clarify its role in the infection process of Ichthyophthirius multifiliis and provide new target molecules and theoretical basis for the development of anti-Ichthyophthirius multifiliis drugs and vaccines. Summary of the Invention

[0007] In view of this, the present invention provides an siRNA, kit, method and application for reducing the invasive ability of Ichthyophthirius multifiliis, providing new target molecules and theoretical basis for the development of anti-Ichthyophthirius multifiliis drugs and vaccines.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides an siRNA that reduces the invasive ability of Ichthyophthirius multifiliis, wherein the sense strand of the siRNA is shown in SEQ ID NO. 5 and the antisense strand is shown in SEQ ID NO. 6.

[0010] Preferably, the siRNA is used to silence the expression of the cysteine ​​protease gene in Ichthyophthirius multifiliis, thereby reducing the ability of Ichthyophthirius multifiliis to invade the host.

[0011] The present invention also provides a kit for reducing the invasive ability of Ichthyophthirius multifiliis, the kit comprising the siRNA described above.

[0012] The present invention also provides the use of the siRNA in at least one of the following:

[0013] (1) Application in reducing the invasive ability of Ichthyophthirius multifiliis;

[0014] (2) Application in protecting the host of Ichthyophthirius multifiliis;

[0015] (3) In the preparation and / or in the preparation of kits or products that reduce the ability of Ichthyophthirius multifiliis to invade;

[0016] (4) Application in the preparation of biological agents for the prevention and control of Ichthyophthirius multifiliis disease.

[0017] The present invention also provides the use of the kit in at least one of the following:

[0018] (1) Application in reducing the invasive ability of Ichthyophthirius multifiliis;

[0019] (2) Application in protecting the host of Ichthyophthirius multifiliis;

[0020] (3) Application in the prevention and control of Ichthyophthirius multifiliis infection in aquaculture.

[0021] Preferably, the host includes a freshwater fish, and the freshwater fish includes a goldfish.

[0022] The present invention also provides a method for reducing the invasive ability of Ichthyophthirius multifiliis, wherein the siRNA is used to soak and transfect Ichthyophthirius multifiliis.

[0023] Preferably, the concentrations of the sense and antisense strands of the siRNA are 30-100 nM, and the soaking and transfection time is 12 h.

[0024] By adopting the above technical solution, the present invention has the following beneficial effects: The sense strand of the siRNA described in this invention is shown in SEQ ID NO.5, and the antisense strand is shown in SEQ ID NO.6. This siRNA can silence the expression of the cysteine ​​protease gene in *Ichthyophthirius multifiliis*. Transfecting *Ichthyophthirius multifiliis* with siRNA at a concentration of 30-100 nM for 12 h can significantly reduce its invasive ability to the host. Experiments have shown that only 187 goldfish transfected with this siRNA were infected with *Ichthyophthirius multifiliis*, significantly lower than the control group. This invention also provides a kit containing this siRNA and a method for applying it, which can be used to reduce the invasive ability of *Ichthyophthirius multifiliis*, protect the *Ichthyophthirius multifiliis* host, and provide an efficient and reliable molecular tool for the prevention and control of *Ichthyophthirius multifiliis* infection, with broad application prospects. Attached Figure Description

[0025] Figure 1 Statistical graph showing the interference of different siRNAs on ICP1 in the predator body of Ichthyophthirius multifiliis after 12 h of treatment.

[0026] Figure 2 A statistical graph showing the interference of siRNA-1039 on ICP1 of Ichthyophthirius multifiliis at different concentrations.

[0027] Figure 3 A statistical graph showing the interference of siRNA-1039 on ICP1 of Ichthyophthirius multifiliis at different transfection times.

[0028] Figure 4 This is a fluorescent labeling image of siRNA-1039 transfected predator.

[0029] Figure 5The images show the movement trajectories of Ichthyophthirius multifiliis predators. In the images, A represents the movement trajectory of a predator that has just hatched without any treatment (0 h); B represents the movement trajectory of a predator that has hatched for 12 h without any treatment; C represents the movement trajectory of a predator that has been soaked in siRNA-NC for 12 h; and D represents the movement trajectory of a predator that has been soaked in siRNA-1039 for 12 h.

[0030] Figure 6 The mean movement speed of Ichthyophthirius multifiliis predators under different treatments. Note: Different superscripts indicate significant differences between the two groups (p < 0.05).

[0031] Figure 7 The total number of Ichthyophthirius multifiliis (white spot disease) infecting the goldfish fins and gills is shown on the graph. Note: The 12h group refers to the group where no predators were treated; the 12h-NC group refers to the group where predators were soaked in siRNA-NC; and the 12h-1039 group refers to the group where predators were soaked in siRNA-1039. The vertical axis represents the total number of Ichthyophthirius multifiliis (white spot disease) infecting the goldfish fins (dorsal, pectoral, pelvic, and caudal fins) and gills after challenge in each group. Detailed Implementation

[0032] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0033] Example 1

[0034] 1. Insect collection

[0035] Mature trophozoites were gently scraped from goldfish infected with Ichthyophthirius multifiliis (white spot disease). The trophozoites were rinsed three times with sterile water to remove goldfish mucus and other contaminants. The rinsed trophozoites were then placed in a petri dish containing 10% Medium 199 (M199, Sigma) and incubated at 23°C for 17 h. After all the Ichthyophthirius multifiliis predators had hatched, the trophozoites were collected in a 50 mL centrifuge tube, mixed thoroughly by pipetting, and 50 μL of the trophozoite solution was dropped onto a planktonic counting plate. An appropriate amount of 1% formaldehyde solution was added to inactivate the Ichthyophthirius multifiliis predators. After standing for 1 min, the number of Ichthyophthirius multifiliis predators was counted, and the total number of predators was calculated as the average of five counts.

[0036] 2. Design and synthesis of siRNA for Ichthyophthirius multifiliis ICP1

[0037] Based on the ICP1 coding region sequence (accession number PQ296157 in the NCBI database), three siRNAs (siRNA-413, siRNA-929, and siRNA-1039) targeting and interfering with ICP1, and a negative control (siRNA-NC) were designed. The siRNAs were synthesized by Hunan Aikerui Biotechnology Co., Ltd., and the specific sequence information is shown in Table 1.

[0038] Table 1. siRNA sequence of Ichthyophthirius multifiliis ICP1

[0039]

[0040] 3. Immersion method for introducing siRNA

[0041] The above-mentioned siRNA was introduced into the Ichthyophthirius multifiliis predator using the immersion method. The experiment included four groups: siRNA-413 interference group, siRNA-929 interference group, siRNA-1039 interference group, and siRNA-NC negative control group, with three replicates in each group. The specific steps are as follows:

[0042] (1) Add RNase-free water as required by the instructions to prepare a 20 μM storage solution of the synthesized dry siRNA powder and store it at -20 ℃ for later use;

[0043] (2) Add the collected Ichthyophthirius multifiliis predators to a 12-well plate, 1 mL of insect solution per well, containing approximately 10,000 Ichthyophthirius multifiliis predators;

[0044] (3) Add 50 μL of 10% M199 culture medium and 3 μL of Lipofectamine to a 1.5 mL sterile EP tube. TM 3000 transfection reagent (Invitrogen), mix well by pipetting and let stand at room temperature for 5 min, as tube 1;

[0045] (4) Add 50 μL of 10% M199 medium to a 1.5 mL sterile EP tube, and then add siRNA-413, siRNA-929, siRNA-1039 and siRNA-NC to each tube respectively. Mix well by pipetting and let stand at room temperature for 5 min to make tube 2.

[0046] (5) Add the solution from tube 1 to tube 2, gently mix with a pipette, and incubate at room temperature for 15 min to prepare the transfection complex.

[0047] (6) Add the mixture from step (5) to a 12-well plate and gently shake the plate to ensure the mixture is evenly distributed in the wells. The total volume of each well is 1.1 mL, and the final concentration of siRNA is 100 nM.

[0048] (7) Place the 12-well plate containing the predator of Ichthyophthirius multifiliis into a constant temperature incubator and incubate at 25 °C for 12 h. Then collect the predator of Ichthyophthirius multifiliis and extract RNA.

[0049] 4. RNA extraction and cDNA synthesis

[0050] Total RNA was extracted using the TRIzol method, and the cDNA synthesis kit used was PrimeScript.TM The experimental procedures of the RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, #RR047A) were strictly followed according to the kit instructions.

[0051] 5. Real-time PCR detection of changes in ICP1 gene transcription levels

[0052] Primers for quantitative PCR were designed near the ICP1 interference site, using the GAPDH gene of Ichthyophthirius multifiliis (NCBI accession number BQ134931) as an internal reference. Primer sequences are shown in Table 2. The total quantitative PCR reaction volume was 20 μL, including 10 µL of 2×SYBR Green Real-time PCR master mix (QPk-201) (TOYOBO), 1 µL of forward primer, 1 µL of reverse primer, 1 µL of cDNA, and 7 µL of RNase-free dH2O. The reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 56℃ annealing for 30 s; 72℃ extension for 30 s, for 40 cycles. Melting curves were then inserted to analyze primer specificity, and 2... −∆∆CT The relative expression levels of each gene were calculated. Each sample was tested three times.

[0053] Table 2 qPCR primer sequences 413F CTGAACAAATCGCTGAACTCC SEQ ID NO.7 413R GCGAAAGCCCAGCATGAAC SEQ ID NO.8 929F ATCACGCTGTAACACTCATTGGA SEQ ID NO.9 929R CCTCTACAAGCATTACCGATACC SEQ ID NO.10 1039F TCCAGGTATCGGTAATGCTTGTAGA SEQ ID NO.11 1039R AATTCATATCAACCAATAACCTAAAC SEQ ID NO.12 GAPDH-F CGGAAACAATGTCCACCTTACTC SEQ ID NO.13 GAPDH-R AGCACCTCCTTTGATATGACCAG SEQ ID NO.14

[0054] like Figure 1 As shown, of the three siRNA interference sites (413, 929, and 1039), sites 413 and 1039 successfully interfered with the expression of the ICP1 gene. Specifically, siRNA-413 had a knockdown efficiency of 37%, while siRNA-1039 had a knockdown efficiency of 65%. Clearly, siRNA-1039 showed better knockdown performance; therefore, only siRNA-1039 was used for subsequent experimental condition screening.

[0055] Example 2. Optimization of siRNA action conditions

[0056] 1. Screening of siRNA concentrations

[0057] 30 nM, 50 nM and 100 nM of siRNA-1039 were added as experimental groups, and siRNA-NC of the corresponding concentration was used as the control group. Each group contained about 10,000 Ichthyophthirius multifiliis predators. After soaking the insects in the solution according to the method in Example 1, qPCR detection was performed. The qPCR operation method was the same as in Example 1.

[0058] The results are as follows Figure 2 As shown, soaking Ichthyophthirius multifiliis predators at three concentrations of siRNA-1039 for 12 h effectively interfered with ICP1 gene expression. Specifically, soaking with 30 nM siRNA resulted in a 44% ICP1 knockdown efficiency; soaking with 50 nM siRNA resulted in a 20% ICP1 knockdown efficiency; and soaking with 100 nM siRNA resulted in a 50% ICP1 knockdown efficiency. Considering that the ICP1 knockdown efficiencies were similar after soaking at 30 nM and 100 nM concentrations, 30 nM was initially selected for transfection time optimization to reduce potential cytotoxicity.

[0059] 2. Screening of siRNA action time

[0060] Following the method in Example 1, Ichthyophthirius multifiliis predators were soaked in 30 nM and 100 nM siRNA-1039, respectively. The predators were collected at 6, 9, and 12 h after interference, and RNA was extracted for qPCR detection. The qPCR operation method was the same as in Example 1.

[0061] The results showed that soaking Ichthyophthirius multifiliis predators at a concentration of 30 nM failed to interfere with ICP1 gene expression at 4 h and 8 h; at 12 h, ICP1 gene expression was downregulated, but the knockdown efficiency of this soaking experiment was only 19%. Figure 3 (A in the text). Optimizing transfection time with a 100 nM concentration resulted in a 33% downregulation of ICP1 gene expression at 12 h ( ). Figure 3 (B in the text). Although both showed significant downregulation of gene expression only after 12 h, the knockdown efficiency of ICP1 was higher after soaking at a concentration of 100 nM than that at 30 nM. Therefore, the ICP1 interference site was finally determined to be siRNA-1039, the interference concentration was set at 100 nM, the transfection time was set at 12 h, and the transfection temperature was set at 25 ℃.

[0062] 3. Transfection status was detected using fluorescently labeled siRNA-1039.

[0063] The experimental group was treated with 100 nM Cy3 probe-modified siRNA-1039, while the control group maintained the same experimental conditions except for the absence of siRNA, and each well was supplemented with 10% M199 medium to make up the total volume. Twelve hours after transfection, the Ichthyophthirius multifiliis predators were washed with 10% M199 medium, and their bioluminescence was observed using a fluorescence microscope (ZEISS Axio Imager A2, Carl Zeiss, Jena, Germany).

[0064] Figure 4 The results showed that no fluorescent signal was detected in the control group of Ichthyophthirius multifiliis predators at 12 h, while a fluorescent signal was detected in the experimental group of Ichthyophthirius multifiliis predators, indicating that siRNA could be successfully transfected into Ichthyophthirius multifiliis predators after 12 h of soaking and transfection.

[0065] 4. Effects of ICP1 knockdown on the viability of Ichthyophthirius multifiliis predators

[0066] The experiment was divided into four groups: a 0-h untreated control group, a 12-h untreated control group, a 12-h negative control group treated with 100 nM siRNA-NC, and a 12-h interference group treated with 100 nM siRNA-1039. Using a stereomicroscope (SOPTOP) with an external Sony EP630A image sensor, 15 Ichthyophthirius multifiliis predators were recorded within 30 seconds, with three replicates for each group. The movement trajectories of the predators were then plotted using Tracker v6.1.7, and the average speed of the predators was calculated based on the path length and time. Adobe Photoshop was used to enhance the movement trajectories of the predators.

[0067] The movement trajectories of the four groups of Ichthyophthirius multifiliis predators are as follows: Figure 5 As shown, each small circle represents the starting position of one Ichthyophthirius multifiliis predator, and the lines represent the movement trajectory of the predator over 30 seconds. Tracker software analysis results show that the average velocity of the first group (0 h group) was 0.0717 mm / s; the average velocity of the second group (12 h group) was 0.0751 mm / s; the average velocity of the third group (12 h-NC group) was 0.0604 mm / s; and the average velocity of the fourth group (12 h-1039 group) was 0.0583 mm / s. There was no significant difference in the average movement velocity of the predators between the 0 h and 12 h groups. However, there were significant differences in the average movement velocity between the 12 h, 12 h-NC, and 1039 groups. (The last sentence appears to be a repetition of the previous one and can be omitted.) Figure 6 ).

[0068] Example 3. Effects of interfering with the ICP1 gene of the Ichthyophthirius multifiliis predator on its invasion of the host.

[0069] 1. Preparation of experimental fish

[0070] The experimental goldfish (Carassius auratus) were purchased from the Wuchang District Flower and Bird Market in Wuhan City, Hubei Province. They measured 6.20 ± 0.36 cm in length and 11.66 ± 1.59 g in weight. Five goldfish were randomly selected for microscopic examination to ensure they were free of Ichthyophthirius multifiliis (white spot disease). All fish were then randomly assigned to 100 L tanks containing 60 L of aerated water for one month, with the water temperature maintained at 31.0 ± 1.0 ℃ to prevent Ichthyophthirius multifiliis infection. They were fed commercial pellet food at 1% of their body weight daily, and their swimming and feeding behavior were observed. One-third of the water in the tank was replaced daily.

[0071] 2. Grouping of the challenge experiment

[0072] The challenge experiment was divided into three groups: a 12-hour blank control group, a 12-hour siRNA-NC negative control group, and a 12-hour siRNA-1039 interference group. Five goldfish were used in each group, and the experiment was repeated three times. The collection and treatment of the Ichthyophthirius multifiliis predators followed step 1 of Example 1, followed by soaking the predators according to step 3 of Example 1. After 12 hours of interference, each goldfish was challenged with a dose of 3,000 larvae. Each goldfish was placed individually in a small aquarium with 500 mL of aerated water. After 2 hours of challenge, the goldfish were transferred to a 40 L water tank with 15 L of aerated water. One-third of the aquarium water was changed daily thereafter.

[0073] 3. Infection status of Ichthyophthirius multifiliis predators after interfering with the ICP1 gene.

[0074] On the third day of the challenge experiment, small white spots visible to the naked eye appeared on the goldfish's body surface. Subsequently, the goldfish were anesthetized with MS-222, and their gills and fin rays (dorsal fin, pectoral fin, pelvic fin, and caudal fin) were taken and placed in a petri dish for examination under a stereomicroscope, and the number of infected Ichthyophthirius multifiliis was counted.

[0075] Microscopic examination of the surface tissues (gills and fins) of goldfish 3 days after viral invasion revealed 170 *Ichthyophthirius multifiliis* parasites on the fins and 172 on the gills in the 12-hour control group, totaling 342 parasites. In the 12-hour control group, 296 *Ichthyophthirius multifiliis* parasites were found on the fins and 120 on the gills, totaling 416 parasites. In the 12-hour control group (NC group), 82 *Ichthyophthirius multifiliis* parasites were found on the fins and 105 on the gills, totaling 187 parasites. Figure 7The number of Ichthyophthirius multifiliis (Ich) parasites on the surface tissues of goldfish in the 12 h control group and the 12 h-NC group was relatively similar, but there were still differences in infection, indicating that individual differences in goldfish may still affect the infection status of Ich when the infection environment and treatment conditions are the same. The number of Ich parasites on the surface tissues of goldfish in the 12 h-1039 group was lower than that in the 12 h-NC group, indicating that interfering with ICP1 expression affected the invasion of Ich parasite predators.

[0076] As can be seen from the above embodiments, the present invention provides siRNA, a kit, a method, and applications for reducing the invasive ability of Ichthyophthirius multifiliis (Ich). The method of the present invention can be used to reduce the invasive ability of Ich and protect the Ich host, providing an efficient and reliable molecular tool for the prevention and control of Ich infection.

[0077] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A siRNA that reduces the invasive ability of Ichthyophthirius multifiliis, characterized in that, The sense strand of the siRNA is shown in SEQ ID NO.5, and the antisense strand is shown in SEQ ID NO.

6.

2. The siRNA according to claim 1, characterized in that, The siRNA is used to silence the expression of the cysteine ​​protease gene in Ichthyophthirius multifiliis, thereby reducing the ability of Ichthyophthirius multifiliis to invade the host.

3. A kit for reducing the invasive ability of Ichthyophthirius multifiliis, characterized in that, The kit includes the siRNA as described in claim 1.

4. The use of the siRNA according to claim 1 in the preparation of kits or biological agents that reduce the invasive ability of Ichthyophthirius multifiliis.

Images