Anti-Therais gene derived from cold spring, screening method, activity determination method and application of anti-Therais gene

Abstract

The invention relates to an anti-Theras gene derived from a cold spring, a screening method, an activity determination method and application of the anti-Theras gene, and particularly discloses an anti-Theras gene derived from the cold spring, and the nucleotide sequence of the anti-Theras gene is shown as SEQ ID NO: 1. According to the application, a novel anti-Theras gene is identified from a deep sea cold spring environment for the first time, and heterologous expression and plaque experiments prove that the novel anti-Theras gene can effectively antagonize a Theras defense system of a host. According to the anti-Theras gene provided by the invention, the types and sources of anti-defense genes are expanded, and a gene blank for non-classical defense system Theras from a cold spring environment is provided.

Description

Technical Field

[0001] This application relates to the field of anti-defense gene technology, and in particular to an anti-Thoeris gene derived from cold springs, a screening method, an activity assay method, and its application. Background Technology

[0002] Viruses play a crucial role in controlling microbial communities and maintaining ecological balance. In recent years, with the increasing severity of drug-resistant bacteria, viruses have attracted widespread attention due to their specific bactericidal characteristics, showing broad application prospects in clinical treatment, food safety, and agricultural production. However, the practical application of viruses is still severely constrained by the host's defense system.

[0003] In the long-term "arms race" with viruses, prokaryotes have evolved a variety of immune defense systems, including the CRISPR-Cas system, restriction-modification (RM) systems, toxin-antitoxin (TA) systems, and novel defense systems discovered in recent years such as Thoeris, Gabija, and CBASS. While these systems have effectively resisted viral infection, they have also greatly limited viral replication and transmission, becoming a significant obstacle to viral research and application.

[0004] To overcome the defenses of prokaryotic hosts, viruses have evolved a class of anti-defense genes in their genomes. These genes encode products that help viruses suppress or evade the host's defense system, thereby increasing their infection efficiency. Current technology reveals that common anti-CRISPR (Acr) genes can inactivate the host's CRISPR-Cas system by inhibiting the nuclease activity of Cas proteins or interfering with the assembly of gRNA-Cas complexes, thus achieving the goal of breaching the host's defense barrier. However, most reported viral anti-defense genes have been identified in clinical strains or laboratory model organisms, resulting in limited sources and types. Furthermore, their antagonistic ability against recently discovered defense systems such as Thoeris and Gabija, especially the Thoeris defense system, is insufficient, making it difficult to cope with the complex and multi-layered immune pressures of prokaryotes. This limits their application.

[0005] Cold seeps are a unique type of seabed habitat formed by the seepage of fluids rich in hydrogen sulfide and methane from the seabed. They are characterized by extreme environments such as high pressure, low temperature, darkness, and high levels of reducing substances. In this environment, chemoautotrophic microorganisms constitute the primary producers, exhibiting extremely high biomass and diversity; simultaneously, the viruses that infect these microorganisms are also abundant. Through a long and intense evolutionary struggle, the hosts and viruses in cold seeps may have developed unique adaptation mechanisms, making cold seeps an important potential source of novel viral resistance genes. However, limited by deep-sea sampling and research methods, our current understanding of the genetic functions of cold seep viruses, especially the diversity and potential of their resistance genes, remains extremely limited. Summary of the Invention

[0006] To address the aforementioned issues, the first objective of this application is to provide an anti-Thoeris gene derived from cold springs.

[0007] The second objective of this application is to provide a metagenomics-based method for screening anti-Thoeris genes.

[0008] The third objective of this application is to provide a method for determining the activity of the anti-Thoeris gene derived from cold springs.

[0009] The fourth objective of this application is to provide an application of the aforementioned anti-Thoeris gene.

[0010] In the first aspect, this application provides an anti-Thoeris gene derived from a cold seep, employing the following technical solution: An anti-Thoeris gene derived from cold springs, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0011] Secondly, this application provides a metagenomics-based method for screening anti-Thoeris genes, employing the following technical solution: A metagenomics-based method for screening anti-Thoeris genes includes the following steps: (1) Process the cold seep metagenomic data to obtain viral contigs and viral operational taxonomic units; (2) Gene prediction is performed on the viral operational taxonomic units obtained in step (1), and the predicted protein sequences are clustered to obtain viral protein clusters; (3) Screen the viral protein clusters obtained in step (2) for anti-defense genes, and obtain multiple anti-defense candidate genes. Then, select anti-Thoeris genes from the multiple anti-defense candidate genes in the anti-Thoeris defense system category.

[0012] Furthermore, in step (1), by integrating at least one virus identification process, virus prediction is performed on the virus contigs with a length greater than 5kb, then the virus genome quality is assessed, and the virus contigs are screened according to preset screening criteria. Then, the screened virus contigs are clustered under the thresholds of 95% nucleotide consistency and 85% coverage to obtain the virus operation classification unit.

[0013] Furthermore, the geNomad, VirSorter2, and VIBRANT software were used for virus prediction, and CheckV was used for viral genome quality assessment.

[0014] Furthermore, the preset screening criteria are: For viral contigs of 5-10kb in length, the geNomad viral score must be no less than 0.9, and the contigs must contain at least one viral marker gene or have a viral marker enrichment value greater than 2.0. For viral contigs with a length greater than or equal to 10 kb, a viral score of not less than 0.8 is required, and the contig must contain at least one marker gene or have an enrichment value greater than 5.0. For the prediction results of VirSorter2, retain viral contigs with a score greater than or equal to 0.8 and containing at least one marker gene; For viral overlap clusters identified by both VirSorter2 and VIBRANT, a second screening is performed using CheckV.

[0015] Furthermore, in step (2), gene prediction is performed using Prodigal software and clustering is performed using MMseqs2. The clustering criteria are sequence consistency greater than or equal to 50% and coverage greater than or equal to 90%.

[0016] Furthermore, in step (3), the AntiDefenseFinder and APIS database are used to compare the DIAMOND and HMMER to screen the antidefense candidate genes from the viral protein cluster.

[0017] Furthermore, based on the anti-Thoeris gene obtained in step (3), AlphaFold3 was used to predict the three-dimensional structure of the protein, and then the structural similarity between the predicted three-dimensional structure of the protein and the known anti-Thoeris protein was judged.

[0018] Thirdly, this application provides a method for determining the activity of the anti-Thoeris gene derived from cold seeps, employing the following technical solution: A method for determining the activity of the anti-Thoeris gene derived from cold springs includes the following steps: (1) The coding sequence of the anti-Thoeris gene obtained by screening in the metagenomics-based anti-Thoeris gene screening method described in claim 2 is combined with the Thoeris defense system operon to synthesize the gene and clone it into an expression vector to complete the plasmid construction; (2) Transform the plasmid obtained in step (1) into the host bacteria to obtain a strain that simultaneously expresses the Thoeris defense system and the anti-Thoeris gene; (3) Cultivate the strain obtained in step (2), perform phage spot test on the cultured strain, and determine the activity test result based on the experimental results.

[0019] Fourthly, this application provides an application of the anti-Thhoeris gene, employing the following technical solution: The application of the above-mentioned anti-Thoeris gene in the preparation of compositions for resisting prokaryotic defense systems.

[0020] This application has the following beneficial effects: 1. This application is the first to identify an anti-Thoeris gene (named RsTad2) from a cold seep environment, and its ability to effectively antagonize the host's Thoeris defense system has been verified by heterologous expression and plaque experiments. Compared with existing anti-defense genes that are mostly limited to classical systems and have a single source, this application expands the types and sources of anti-defense genes and provides a gene gap from the cold seep environment against the non-classical defense system Thoeris. 2. This application combines metagenomics mining, bioinformatics prediction and functional verification experiments to establish a reproducible method for screening viral functional genes, providing a technical path for obtaining functional genes in complex environments; 3. The anti-Thoeris gene in this application not only significantly expands the resource library of viral anti-defense genes, but also provides new molecular tools and technical support for the study of drug-resistant bacteria control, microbial engineering, and viral adaptation mechanisms under extreme environments. 4. The anti-Thoeris gene of this application has significant application value. In the medical field, it can be used to enhance the infection efficiency of viruses against drug-resistant strains, providing a new molecular tool for phage therapy; in industrial microbiology, it can be used to improve the stability of plasmids in host bacteria and enhance the expression efficiency of exogenous genes; in synthetic biology and ecology, it can be used to study virus-host interaction mechanisms under extreme conditions and as a highly efficient anti-defense module for the design of engineered viruses. Attached Figure Description

[0021] Figure 1This is a structural comparison diagram of the anti-defense protein obtained after expression of the anti-Thoeris gene screened in the metagenomics-based anti-Thoeris gene screening method of this application embodiment; Figure 2 This is a diagram showing the results of a phage spot experiment in the method for determining the activity of the anti-Thoeris gene derived from cold springs, as described in this application embodiment. Detailed Implementation

[0022] The present application will be further described in detail below with reference to the accompanying drawings and embodiments.

[0023] Example 1: Anti-Thoeris gene derived from cold springs The nucleotide sequence of the anti-Thoeris gene derived from the cold spring in this embodiment is shown in SEQ ID NO:1, and is as follows: ATGAAAATAATTAATTTAATTAATAAGATAATTAGAAAGAAGGTGAAATATATGAATTTTGGAGAAGCATTGGAAAAACTAAAACAAGGGATGTTTATTTTCAGAAAGGGTTGGAATGGTAAAAATCAACGATTAAAATTACAAGTGCCAGACGAGAATAGCAAAATGACACTGCCTTATATTTATATAATGACAGTGCAAGGCGAATTGGTTCCGTGGTTGGCATCGCAGACAGATATTTTAGC AGATGATTGGTTTATGGGAGAAGCAAAATTAGATGAATTACCACTAGACGAAACAAAAAAAGAAGTTACAAATGATGAAACTACAAAACTACCAGACTATTCAAATCTAATAAACAGAGAGGGAACTGTTTATGCTGGAGACAAAGCATTCGCAAATCCAGCAGAACTTGCTGAATATCTTGGAGTGGCAGAAGATAAAATAGATTGGAAACAGATTCAAGAAGATAATAAATCTGAATAG.

[0024] Example 2: A metagenomics-based screening method for anti-Thoeris genes To obtain the anti-defense genes derived from cold seep viruses, this embodiment first performs viral genome identification on the cold seep metagenomic data. The main process is as follows: (1) For virus contigs with a length greater than 5kb, virus prediction was performed using geNomad, VirSorter2 and VIBRANT software respectively; (2) Use CheckV for quality control.

[0025] The screening criteria are: For viral contigs of 5–10 kb, the geNomad viral score must be no less than 0.9 and must contain at least one viral marker gene or a viral marker enrichment value greater than 2.0; for viral contigs of ≥10 kb, the viral score must be no less than 0.8 and must contain at least one marker gene or an enrichment value greater than 5.0. For VirSorter2 predictions, viral contigs with a score ≥0.8 and containing at least one marker gene were retained. Viral contigs identified by both VirSorter2 (score ≥0.5) and VIBRANT were further screened using CheckV. After multiple-criteria filtering and quality assessment, they were clustered into viral operational taxonomic units (vOTUs) at a 95% nucleotide consistency and 85% coverage threshold.

[0026] (3) Gene prediction was performed on the obtained vOTUs using Prodigal (v2.6.3) software, and the predicted protein sequences were clustered using MMseqs2 (v13.45111; clustering criteria: sequence consistency ≥50% and coverage ≥90%) to obtain viral protein clusters (vPCs).

[0027] (4) AntiDefenseFinder was used to screen all viral protein clusters (vPCs) for antidefense genes, and the results were compared with the APIS database. The methods included DIAMOND blastp (v2.0.2; screening criteria: E value ≤1e-10, sequence identity ≥30%) and HMMER (v3.3.2; screening criteria: E value ≤1e-10). A total of 5403 antidefense candidate genes were identified from the viral protein clusters (vPCs), covering 13 defense categories.

[0028] Subsequently, the most representative candidate gene for defense was selected from the anti-Thoeris system category, namely the anti-Thoeris gene in this embodiment, and named RsTad2.

[0029] Further structural prediction using AlphaFold3 can be found in [reference needed]. Figure 1 , Figure 1The diagram shows the structural alignment of the anti-Thoeris protein obtained after expression of the anti-Thoeris gene. Arrows marked A correspond to the structures of the anti-Thoeris proteins obtained after expression of the anti-Thoeris gene in this embodiment, predicted using Alphafold3. Arrows marked B correspond to the reference proteins, which are from the PDB database (PDB ID: 8WJE). Figure 1 As shown in the figure, the anti-Thoeris gene obtained after expression in this embodiment has a TM-score of 0.43 and an RMSD threshold of 0.39. It can be seen that the anti-Thoeris gene (RsTad2) obtained in this embodiment has a certain structural similarity to the reported anti-Thoeris protein Tad2, suggesting that it may exert an antagonistic function by binding to and blocking Thoeris system signaling molecules.

[0030] Example 3: Method for Assaying Anti-Thoeris Gene Activity To verify the anti-Thoeris gene (RsTad2) defense function, heterologous expression and plaque assays were performed. The main procedures are as follows: (1) Heterologous expression of anti-Thoeris genes and Thoeris anti-defense system a. The coding sequence of the anti-Thoeris gene is compared with its corresponding Thoeris defense system operon (ThsB1-ThsA1, derived from...) Hyphomicrobium The gene was synthesized by sp. and cloned into pQE82L-derived expression vectors by GenScript using the Gibson Assembly method.

[0031] b. Construct the following four types of vectors: plasmids containing only the Thoeris defense system, plasmids containing only the anti-Thoeris gene, plasmids containing both the Thoeris defense system and the anti-Thoeris gene, and an empty vector control. All constructs were transformed into... Escherichia coli In B (ATCC® 11303TM), screening was performed in a culture medium containing the corresponding antibiotic.

[0032] (2) Plaque assay (titer method) a. Inoculate single colonies into LB liquid medium containing antibiotics and incubate at 37°C until OD500. 600 It is approximately 0.6.

[0033] b. Then add 0.2 mM IPTG to induce protein expression for about 1 hour. Take 500 μL of the induced bacterial culture and mix it with 14.5 mL of 0.5% LB soft agar containing antibiotics and 0.1 mM IPTG, and cover the surface of the LB plate.

[0034] c. Spot 4 μL of virus solution at different dilutions onto the plate, including T7 (10⁻⁶). -1 -10 -8 T5 (1-10) -7 ) and T4 (1-10 -7 ).

[0035] d. All plates were incubated at 25°C for approximately 16-18 hours before imaging observation.

[0036] See Figure 2 The diagram shows the results of the plaque experiment, observing plaque formation in different groups. The results show that when the host bacteria expressed only the Thoeris defense system, plaques significantly decreased or disappeared, indicating that the defense system was activated and effectively resisted viral infection. However, when the host simultaneously expressed both the anti-Thoeris gene (RsTad2) and the Thoeris defense system, the resistance effect of the Thoeris system was neutralized, and plaque formation returned to near control levels, demonstrating that the anti-Thoeris gene can antagonize the function of the Thoeris defense system. Strains expressing only the anti-Thoeris gene did not show viral resistance, further illustrating that the mechanism of action of this gene is to antagonize host defense, rather than directly conferring resistance to the host. All experiments were independently repeated three times, with consistent results.

[0037] In summary, this embodiment verifies the anti-Thoeris gene derived from cold seep virus, which can effectively weaken the Thoeris system of the prokaryotic host and improve viral infection efficiency.

[0038] Based on Examples 1-3, this application combines metagenomics mining, bioinformatics prediction, and functional verification experiments to establish a reproducible method for screening viral functional genes, providing a technical path for obtaining functional genes in complex environments. Using this method, this application identified a novel anti-defense gene, RsTad2, for the first time from a cold seep environment, and verified its effective antagonism against the host's Thieris defense system through heterologous expression and plaque experiments.

[0039] The presence of RsTad2 neutralizes the defense mechanisms of the Thaeris system, thereby neutralizing the host's resistance to the virus and restoring viral infection efficiency. This effect demonstrates that RsTad2, as an antagonist, can significantly enhance viral replication in hosts with complex defense systems. Compared to existing anti-defense genes, which are mostly limited to classical systems and have a single source, this application expands the types and sources of anti-defense genes, providing a gene gap from the cold seep environment targeting the non-classical Thaeris defense system.

[0040] Based on this characteristic, RsTad2 has potential applications in multiple fields: (1) In phage therapy, it can enhance the lysis efficiency of viruses against drug-resistant bacteria carrying the defense system, thereby improving the clinical treatment effect; (2) In synthetic biology and industrial microbiology, it can enhance the host bacteria's resistance to phages in large-scale production, thereby improving its stability; (3) In basic research, it can be used as a tool to explore the molecular interaction between viruses and the host defense system.

[0041] In summary, the anti-Thoeris gene (RsTad2) provided in this application not only significantly expands the resource library of viral defense genes, but also provides new molecular tools and technical support for the study of drug-resistant bacteria control, microbial engineering, and viral adaptation mechanisms under extreme environments.

[0042] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A Thoeris-resistant gene derived from cold springs, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. A metagenomics-based method for screening anti-Thoeris genes, characterized in that, Includes the following steps: (1) Process the cold seep metagenomic data to obtain viral contigs and viral operational taxonomic units; (2) Gene prediction is performed on the viral operational taxonomic units obtained in step (1), and the predicted protein sequences are clustered to obtain viral protein clusters; (3) Screen the viral protein clusters obtained in step (2) for anti-defense genes, and obtain multiple anti-defense candidate genes. Then, select anti-Thoeris genes from the multiple anti-defense candidate genes in the anti-Thoeris defense system category.

3. The method for screening anti-Thoeris genes based on metagenomics according to claim 2, characterized in that, In step (1), by integrating at least one virus identification process, virus prediction is performed on the virus contigs with a length greater than 5kb, then the virus genome quality is assessed, and the virus contigs are screened according to preset screening criteria. Then, the screened virus contigs are clustered under the thresholds of 95% nucleotide identity and 85% coverage to obtain the virus operation classification unit.

4. The method for screening anti-Thoeris genes based on metagenomics according to claim 3, characterized in that, Virus prediction was performed using geNomad, VirSorter2, and VIBRANT software, and viral genome quality was assessed using CheckV.

5. The method for screening anti-Thoeris genes based on metagenomics according to claim 3, characterized in that, The preset screening criteria are as follows: for viral contigs with a length of 5-10kb, the geNomad virus score must be no less than 0.9, and they must contain at least one viral marker gene or a viral marker enrichment value greater than 2.0; for viral contigs with a length greater than or equal to 10kb, the virus score must be no less than 0.8, and they must contain at least one marker gene or an enrichment value greater than 5.0; for the prediction results of VirSorter2, viral contigs with a score greater than or equal to 0.8 and containing at least one marker gene are retained; for viral contigs identified by both VirSorter2 and VIBRANT, they are screened again using CheckV.

6. The method for screening anti-Thoeris genes based on metagenomics according to claim 2, characterized in that, In step (2), gene prediction is performed using Prodigal software and clustering is performed using MMseqs2. The clustering criteria are sequence consistency greater than or equal to 50% and coverage greater than or equal to 90%.

7. The method for screening anti-Thoeris genes based on metagenomics according to claim 2, characterized in that, In step (3), the AntiDefenseFinder and APIS databases are used to compare the DIAMOND and HMMER data to screen the antidefense candidate genes from the viral protein clusters.

8. The method for screening anti-Thoeris genes based on metagenomics according to claim 2, characterized in that, Based on the anti-Thoeris gene obtained in step (3), AlphaFold3 was used to predict the three-dimensional structure of the protein, and then the structural similarity between the predicted three-dimensional structure of the protein and the known anti-Thoeris protein was judged.

9. A method for determining the activity of the anti-Thoeris gene derived from cold springs, characterized in that, Includes the following steps: (1) The coding sequence of the anti-Thoeris gene obtained by screening in the metagenomics-based anti-Thoeris gene screening method described in claim 2 is combined with the Thoeris defense system operon to synthesize the gene and clone it into an expression vector to complete the plasmid construction; (2) Transform the plasmid obtained in step (1) into the host bacteria to obtain a strain that simultaneously expresses the Thoeris defense system and the anti-Thoeris gene; (3) Cultivate the strain obtained in step (2), perform phage spot test on the cultured strain, and determine the activity test result based on the experimental results.

10. The use of the anti-Thoeris gene derived from a cold seep as described in claim 1 in the preparation of a composition for resisting prokaryotic defense systems.

Images