Method for identifying RNA interaction protein by dCas13-Turbo ID system and application thereof

The dCas13-TurboID system uses the CRISPR/Cas13 system and TurboID biotin ligase to label RNA-neighbor proteins in living cells, solving the problem that existing technologies cannot capture transient or weak RNA-protein interactions, and achieving high-precision identification of RNA-binding proteins.

CN121950892APending Publication Date: 2026-05-01GUANGXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGXI UNIV
Filing Date
2025-12-24
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing RNA-protein interaction detection technologies are unable to reflect the true interaction between RNA molecules and proteins in the in vivo environment, especially failing to capture transient or weak interaction relationships, leading to false negative results and limiting the analysis of the dynamic regulatory functions of RNA-protein interaction networks.

Method used

The dCas13-TurboID system was used to precisely locate the target RNA using the CRISPR/Cas13 system and to label the RNA-adjacent proteins using the TurboID biotin ligase in a live cell environment. Combined with biotin-avidin purification and mass spectrometry analysis, this method enables efficient identification of RNA-binding proteins.

Benefits of technology

By systematically capturing transient or low-affinity RNA-protein interactions while preserving the native conformation and interaction environment of RNA, a high-precision identification method for RNA-centric RNA is provided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121950892A_ABST
    Figure CN121950892A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological genes, and discloses a method for identifying RNA (Ribonucleic Acid) interaction protein by utilizing a dCas13-Turbo ID system, which comprises the following steps of: forming fusion protein by utilizing dCas13 protein and Turbo ID biotin ligase, constructing by utilizing the fusion protein to obtain recombinant plasmid, constructing sgRNA of target RNA, transgenosis into a plant receptor by adopting an agrobacterium tumefaciens-mediated genetic transformation method, and identifying the RNA interaction protein by utilizing a dCas13-Turbo ID system. A transgenic plant A with fusion protein and sgRNA successfully expressed is obtained; cloning a coding gene for expressing target RNA into the plant expression vector to construct recombinant plasmids, and transgenosis the recombinant plasmids into a plant receptor by adopting an agrobacterium-mediated genetic transformation method to obtain a target RNA overexpressed transgenic plant B; after the transgenic plant A and the transgenic plant B bloom, hybridizing the transgenic plant A and the transgenic plant B to obtain a filial generation, culturing the filial generation, soaking germinated seedlings in a biotin solution, and performing protein extraction, enrichment and mass spectrum identification on the samples. The invention provides a feasible method for researching RNA (Ribonucleic Acid)-centered identification of protein interacting with RNA.
Need to check novelty before this filing date? Find Prior Art

Description

Methods and applications of identifying RNA-interacting proteins using the dCas13-TurboID system Technical Field

[0001] This invention belongs to the field of biogenetic technology, specifically relating to a method for identifying RNA-interacting proteins using the dCas13-TurboID system and its application. Background Technology

[0002] RNA acts as the executor and regulator of genetic information in life processes. The implementation of its biological functions depends not only on its precise sequence and structure but also on complex dynamic regulatory mechanisms such as RNA-protein interaction networks, RNA-RNA interaction networks, RNA-chromatin interaction networks, and RNA-DNA interaction networks. Among these, the RNA-protein interaction network plays a central regulatory role in key life processes such as transcription and processing, modification and editing, transport and localization, translation regulation, and stability and degradation, helping cells respond to changes and maintain homeostasis. Therefore, elucidating the dynamic network of RNA-protein interactions has become a current research hotspot in molecular biology.

[0003] Current mainstream RNA-protein interaction detection technologies mainly include classic methods such as RIP-seq (RNA Immunoprecipitation followed by sequencing), CLIP-seq (Crosslinking Immunoprecipitation followed by sequencing), and RNA pull-down. RIP-seq and CLIP-seq are protein-centric methods suitable for identifying RNA molecules interacting with known proteins. RNA pull-down, on the other hand, is the mainstream method for identifying RNA-interacting proteins. Although RNA pull-down is simple to perform, its application faces significant technical bottlenecks. First, it is applied in vitro, where both RNA and protein are removed from the normal cellular environment. RNA molecules may not form their correct native conformation, making it difficult to reflect the true interaction between RNA and protein in vivo. Furthermore, weak or transient interactions are difficult to capture, leading to false negatives. These technical bottlenecks severely limit our understanding of the dynamic regulatory functions of RNA-protein interaction networks, posing a significant challenge, especially for studying RNA-centric RNA-protein interaction events. Summary of the Invention

[0004] To address the aforementioned shortcomings, this invention discloses a method for identifying RNA-interacting proteins using the dCas13-TurboID system and its application, providing a feasible method for identifying RNA-interacting proteins centered on RNA.

[0005]

[0006] TurboID is a biotin ligase that uses ATP to convert biotin into a highly active intermediate, biotin-5'-AMP. This intermediate can covalently label lysine residues of neighboring proteins within a 10 nm range. Compared to the traditional biotin ligase BioID, TurboID can complete labeling within minutes to hours, capture weak and transient interactions, and operates under milder conditions, making it more suitable for protein research in living plants and animals.

[0007] The CRISPR / Cas13 system belongs to Class 2, Type VI CRISPR systems. Its core effector protein, Cas13, recognizes and binds to specific RNA sequences via crRNA (CRISPR RNA), and then uses a ribonuclease to cleave the target RNA sequence; it is an RNA-guided ribonuclease. Therefore, the CRISPR / Cas13 system can precisely cleave and degrade target RNA, knock down gene expression at the transcriptional level, and clear abnormal or exogenous RNA. dCas13, on the other hand, uses point mutations to eliminate ribonuclease activity, thus losing its ability to cleave RNA molecules. This transforms Cas13 into an RNA navigator, capable of delivering various functional proteins to specific RNA sites. For example, fusing dCas13 with the fluorescent protein GFP allows for real-time observation of the distribution and transport of specific RNAs in living cells.

[0008] Furthermore, in step (4), the seeds of the hybrid offspring obtained in step (3) are taken and sown in 1 / 2 MS medium, treated in darkness at 4°C for 2 days, and then placed in a light incubator for 7 days. The culture temperature is 22°C, with 16 hours of light and 8 hours of darkness per day.

[0009] Furthermore, in step (4), the seedlings soaked in biotin solution are placed in an incubator and left to stand at 28°C for 3-4 hours.

[0010] Furthermore, in step (5), the seedlings treated in step (4) are rinsed three times with ddH2O pre-cooled at 4°C. After the last rinse, the surface moisture of the seedlings is dried as much as possible.

[0011] Further, in step (5), the sample is rapidly ground in liquid nitrogen, protein lysis buffer is added, and after vortexing and mixing, it is incubated at 4°C for 1-2 hours. After centrifugation at 4°C and 12000g for 30 minutes, the supernatant is collected and analyzed by Western blotting to obtain the optimal biotin concentration for treatment. Seedlings are soaked in the optimal biotin concentration according to step (4), and then treated at 28°C for 3-4 hours. Seedlings are taken as samples, rapidly ground in liquid nitrogen, protein lysis buffer is added, and after vortexing and mixing, it is incubated at 4°C for 1-2 hours. After centrifugation at 4°C and 12000g for 30 minutes, the supernatant is collected and immunoprecipitated (IP) with streptavidin magnetic beads, followed by Western blotting and mass spectrometry analysis. The protein lysis buffer includes the following components at the following concentrations: 10% glycerol, 50mM Tris-HCl at pH=8, 150mM NaCl, 5 mM MgCl2, 0.1% NP-40, 1 mM PMSF, 2 mM DTT, 1×cocktail.

[0012] The application of the method for identifying RNA-interacting proteins using the dCas13-TurboID system includes the following steps: (1) forming a dCas13-TurboID fusion protein by combining dCas13 protein with TurboID biotin ligase, and then cloning the encoding gene of the dCas13-TurboID fusion protein into an Arabidopsis expression vector to construct a recombinant plasmid; based on the recombinant plasmid, inserting the sgRNA of the target At_ciR25; the sequence of the target At_ciR25 is: GTTCAGAATCTAATTGAACGATGCCTCCAGCTTTACA TGAACCAGAAAGAAGTTGTTGACACTCTTCTAGAACAGGCTAAGATCGAACCTGGTTTTACAGAACTAGTTTGGCAGAAGCTTGAAGAAGAGAACCGCGAATTTTTCAAGGCATATTATCTGAGGCTCATGGTGAAGCACCAGATAATGGAATATAACGAACTGCTTGAGCAGCAGATAAACCACATGCGCCAGATGCATCCAACTGCAGGGGCTTCTGTTCGAAAC AGGAATGGTTCTCATGTTCCACCAA (as shown in Sequence 2 in the sequence listing); the sequence of the sgRNA is: CGTTCAATTAGATTCTGAACTTGGTGGAAC (as shown in Sequence 3 in the sequence listing); the transgenic Arabidopsis thaliana plant A with successful expression of fusion protein and sgRNA was obtained by Agrobacterium-mediated genetic transformation into Arabidopsis thaliana recipient; (2) the gene encoding the expression target At_ciR25 was cloned into the Arabidopsis thaliana expression vector described in step (1) to construct a recombinant plasmid, and then the transgenic Arabidopsis thaliana plant A was obtained by Agrobacterium-mediated genetic transformation into Arabidopsis thaliana recipient to obtain the target At_ci (3) After the transgenic Arabidopsis thaliana plant A obtained in step (1) and the transgenic Arabidopsis thaliana plant B obtained in step (2) flower, they are hybridized to obtain hybrid offspring that target At_ciR25 under the guidance of sgRNA dCas13-TurboID fusion protein; (4) The hybrid offspring obtained in step (3) are cultured, and then the seedlings that have germinated for 7 to 14 days are completely soaked in 50 to 300 μM biotin solution, and then treated at 28°C for 3 to 4 hours; (5) The seedlings treated in step (4) are used as samples for protein extraction, enrichment and mass spectrometry identification.

[0013] Compared with existing technologies, this technical solution has the following advantages: In the existing RNA-protein interaction detection technology system, RIP-seq (RNA Immunoprecipitation followed by sequencing) and CLIP-seq (Crosslinking Immunoprecipitation followed by sequencing) can only find RNA molecules that interact with known proteins. RNA pull-down, as a technique for finding RNA molecules interacting with proteins, can only be applied to the in vitro environment and cannot reflect the real interaction between RNA molecules and proteins in the in vivo environment. At the same time, it cannot effectively capture proteins that have transient or weak binding interactions with RNA.

[0014] This invention achieves high-precision localization of target RNA molecules using the CRISPR-dCas13 system, followed by rapid and efficient biotinylation of neighboring proteins in a live-cell environment using TurboID biotin ligase. Combined with subsequent biotin-avidin purification and mass spectrometry analysis, all proteins bound to a specific RNA can be systematically identified. This method not only fully preserves the native conformation and interaction environment of RNA within the cell but also effectively captures transient or low-affinity RNA-protein interactions. Attached Figure Description

[0015] Figure 1 is a schematic diagram of the working principle of the dCas13-TurboID fusion protein described in Example 1.

[0016] Figure 2 is a plasmid construction map of the dCas13-TurboID fusion protein described in Example 1.

[0017] Figure 3 is the identification spectrum of transgenic Arabidopsis plant A described in Example 1.

[0018] Figure 4 is an identification diagram of the transgenic Arabidopsis plant B described in Example 1.

[0019] Figure 5 is a comparison spectrum of the identification effects obtained after soaking in biotin solutions of different concentrations in Example 1.

[0020] Figure 6 is a spectrum of the results obtained after immunoprecipitation (IP) using streptavidin magnetic beads in Example 1. Detailed Implementation

[0021] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.

[0022] Example 1: Referring to Figure 1, a method for identifying RNA-interacting proteins using the dCas13-TurboID system includes the following steps: (1) dCas13 protein is ligated with TurboID biotin ligase to form a dCas13-TurboID fusion protein, and then the coding gene of the dCas13-TurboID fusion protein is cloned into an Arabidopsis expression vector to construct a recombinant plasmid (as shown in Figure 2); based on the recombinant plasmid, the sgRNA of the target At_ciR25 is incorporated; the gene is transgenic into an Arabidopsis recipient using Agrobacterium-mediated genetic transformation to obtain transgenic Arabidopsis plant A with successful expression of the fusion protein and sgRNA, as shown in Figure 3; (2) The coding gene of the target At_ciR25 is cloned into the Arabidopsis expression vector described in step (1) to construct a recombinant plasmid, and then the gene is transgenic into an Arabidopsis recipient using Agrobacterium-mediated genetic transformation to obtain transgenic Arabidopsis plant B with overexpression of the target At_ciR25, as shown in Figure 4; (3) the gene obtained in step (1) is then used to construct a recombinant plasmid. After flowering, transgenic Arabidopsis plant A and transgenic Arabidopsis plant B obtained in step (2) were hybridized to obtain hybrid offspring that targeted the dCas13-TurboID fusion protein At_ciR25 under the guidance of sgRNA; (4) the seeds of the hybrid offspring obtained in step (3) were taken and sown in 1 / 2 MS medium, treated in darkness at 4°C for 2 days, and then placed in a light incubator for 7 days. The culture temperature was 22°C, with 16 hours of light and 8 hours of darkness per day. Then, 1 seed of the germination was collected. Seedlings aged 0 days were completely immersed in a 50-300 μM biotin solution and then left to stand at 28°C for 3 hours; (5) Seedlings treated in step (4) were used as samples and rinsed three times with ddH2O pre-cooled at 4°C. After the last rinse, the surface moisture of the seedlings was dried as much as possible. The samples were then rapidly ground in liquid nitrogen, and protein lysis buffer was added and vortexed and incubated at 4°C for 2 hours. After that, the samples were centrifuged at 4°C and 12000g for 30 minutes and the supernatant was taken. The supernatant was analyzed by Western Blot to obtain the optimal biotin concentration for treatment, as shown in Figure 5.(6) Using the optimal biotin concentration, take the seeds of the hybrid offspring obtained in step (3) and sow them in 1 / 2 MS medium. Treat them in darkness at 4℃ for 2 days, and then place them in a light incubator for 7 days. The culture temperature is 22℃, with 16 hours of light and 8 hours of darkness per day. Then, take the seedlings that have germinated for 10 days and immerse them completely in the biotin solution. Then, treat them statically at 28℃ for 3 hours. Take the seedlings as samples and grind them rapidly in liquid nitrogen. Add the protein lysis buffer and vortex to mix. Then, incubate them at 4℃ for 1-2 hours. After that, centrifuge them at 4℃ and 12000g for 30 minutes and take the supernatant. Perform immunoprecipitation (IP) with streptavidin magnetic beads and then perform Western blotting and mass spectrometry analysis, as shown in Figure 6. The protein lysis buffer includes the following components at the following concentrations: 10% glycerol, 50mM Tris-HCl at pH=8, 150mM The following were added: NaCl, 5 mM MgCl2, 0.1% NP-40, 1 mM PMSF, 2 mM DTT, and 1× cocktail.

[0023] Example 2: The method for identifying RNA-interacting proteins using the dCas13-TurboID system described in this example differs from the method described in Example 1 only in that step (4) involves taking the seeds of the hybrid offspring obtained in step (3) and sowing them in 1 / 2 MS medium, treating them in darkness at 4°C for 2 days, and then culturing them in a light incubator for 7 days at a temperature of 22°C, with 16 hours of light and 8 hours of darkness per day. Then, seedlings that have germinated for 7 days are completely immersed in biotin solution and then treated statically at 28°C for 4 hours. Steps (5) to (6) involve washing the seedlings treated in step (4) three times with pre-cooled ddH2O. After the last wash, the surface moisture of the seedlings is dried as much as possible. The sample is then rapidly ground in liquid nitrogen, and protein lysis buffer is added and vortexed for mixing. The sample is then incubated at 4°C for 1.5 hours. After centrifugation at 4°C and 12000g for 30 minutes, the supernatant is collected and subjected to Western spectroscopy. Blot analysis was performed using streptavidin magnetic beads for immunoprecipitation (IP), followed by Western blotting and mass spectrometry analysis. The protein lysis buffer contained the following components at the following concentrations: 10% glycerol, 50 mM Tris-HCl at pH 8, 150 mM NaCl, 5 mM MgCl2, 0.1% NP-40, 1 mM PMSF, 2 mM DTT, and 1×cocktail.

[0024] Example 3: The method for identifying RNA-interacting proteins using the dCas13-TurboID system described in this example differs from the method described in Example 1 only in that step (4) involves taking the seeds of the hybrid offspring obtained in step (3) and sowing them in 1 / 2 MS medium, treating them in darkness at 4°C for 2 days, and then culturing them in a light incubator for 7 days at a temperature of 22°C, with 16 hours of light and 8 hours of darkness per day. Then, seedlings that have germinated for 14 days are completely immersed in biotin solution and then treated statically at 28°C for 3 hours. Steps (5) to (6) involve using the seedlings treated in step (4) as samples and washing them three times with pre-cooled ddH2O at 4°C. After the last wash, the surface moisture of the seedlings is dried as much as possible. Then, the samples are rapidly ground in liquid nitrogen, and protein lysis buffer is added and vortexed for mixing. The mixture is then incubated at 4°C for 1 hour. After centrifugation at 4°C and 12000g for 30 minutes, the supernatant is collected and subjected to Western spectroscopy. Blot analysis was performed using streptavidin magnetic beads for immunoprecipitation (IP), followed by Western blotting and mass spectrometry analysis. The protein lysis buffer contained the following components at the following concentrations: 10% glycerol, 50 mM Tris-HCl at pH 8, 150 mM NaCl, 5 mM MgCl2, 0.1% NP-40, 1 mM PMSF, 2 mM DTT, and 1×cocktail.

[0025] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A method for identifying RNA-interacting proteins using the dCas13-TurboID system, characterized in that: Includes the following steps: (1) The dCas13 protein was ligated with TurboID biotin ligase to obtain the dCas13-TurboID fusion protein. The protein sequence of the dCas13-TurboID fusion protein is shown in Sequence 1 of the sequence listing. Then, the coding gene of the dCas13-TurboID fusion protein was cloned into a plant expression vector to construct a recombinant plasmid. Based on the recombinant plasmid, the sgRNA of the target RNA was inserted. Then, the transgene was introduced into the plant recipient by Agrobacterium-mediated genetic transformation to obtain transgenic plant A with successful expression of fusion protein and sgRNA. (2) The coding gene of the target RNA was cloned into the plant expression vector described in step (1) to construct a recombinant plasmid. (2) Generate plasmids, and then use Agrobacterium-mediated genetic transformation to transgenerate into plant recipients to obtain transgenic plant B with target RNA overexpression; (3) After the transgenic plant A obtained in step (1) and the transgenic plant B obtained in step (2) flower, they are hybridized to obtain hybrid offspring that target RNA with dCas13-TurboID fusion protein under the guidance of sgRNA; (4) Take the hybrid offspring obtained in step (3) for cultivation, and then take seedlings that have germinated for 7 to 14 days and completely soak them in 50 to 300 μM biotin solution, and then stand at 28°C for 3 to 4 hours; (5) Take the seedlings treated in step (4) as samples for protein extraction, enrichment and mass spectrometry identification.

2. The method for identifying RNA-interacting proteins using the dCas13-TurboID system according to claim 1, characterized in that: In step (4), the seeds of the hybrid offspring obtained in step (3) are taken and sown in 1 / 2 MS medium, and treated in darkness at 4°C for 2 days. Then, they are placed in a light incubator for 7 days. The culture temperature is 22°C, with 16 hours of light and 8 hours of darkness per day.

3. The method for identifying RNA-interacting proteins using the dCas13-TurboID system according to claim 1, characterized in that: In step (4), seedlings soaked in biotin solution are placed in an incubator and left to stand at 28°C for 3-4 hours.

4. The method for identifying RNA-interacting proteins using the dCas13-TurboID system according to claim 1, characterized in that: In step (5), the seedlings treated in step (4) are rinsed three times with ddH2O pre-cooled at 4°C. After the last rinse, the surface moisture of the seedlings is dried as much as possible.

5. The method for identifying RNA-interacting proteins using the dCas13-TurboID system according to claim 1, characterized in that: In step (5), the sample is rapidly ground in liquid nitrogen, protein lysis buffer is added, and the mixture is vortexed and incubated at 4°C for 1-2 hours. Afterwards, it is centrifuged at 4°C and 12000g for 30 minutes, and the supernatant is collected. The supernatant is then subjected to Western blotting analysis to obtain the optimal biotin concentration. Using the optimal biotin concentration, seedlings are soaked according to step (4), and then left to stand at 28°C for 3-4 hours. Seedlings are then used as samples, rapidly ground in liquid nitrogen, protein lysis buffer is added, and the mixture is vortexed and incubated at 4°C for 1-2 hours. Afterwards, it is centrifuged at 4°C and 12000g for 30 minutes, and the supernatant is collected. Immunoprecipitation is performed using streptavidin magnetic beads, followed by Western blotting. Blot and mass spectrometry analysis; the protein lysis buffer contained the following components at the following concentrations: 10% glycerol, 50 mM Tris-HCl at pH 8, 150 mM NaCl, 5 mM MgCl2, 0.1% NP-40, 1 mM PMSF, 2 mM DTT, and 1×cocktail.

6. The application of the method for identifying RNA-interacting proteins using the dCas13-TurboID system as described in any one of claims 1 to 5, characterized in that: Includes the following steps: (1) The dCas13 protein was ligated with TurboID biotin ligase to obtain the dCas13-TurboID fusion protein. Then, the coding gene of the dCas13-TurboID fusion protein was cloned into the Arabidopsis expression vector to construct a recombinant plasmid. Based on the recombinant plasmid, the sgRNA of the target At_ciR25 was constructed. The sequence of the target At_ciR25 is shown in Sequence 2 of the sequence listing, and the sequence of the sgRNA is shown in Sequence 3 of the sequence listing. The transgenic Arabidopsis was introduced into the Arabidopsis recipient using Agrobacterium-mediated genetic transformation to obtain transgenic Arabidopsis plant A that successfully expressed the fusion protein and sgRNA. (2) The coding gene of the expression target At_ciR25 was cloned into the Arabidopsis expression vector described in step (1) to construct a recombinant plasmid. Construct a recombinant plasmid, and then use Agrobacterium-mediated genetic transformation to transgenerate it into the Arabidopsis thaliana recipient to obtain transgenic Arabidopsis thaliana plant B that overexpresses the target At_ciR25; (3) After the transgenic Arabidopsis thaliana plant A obtained in step (1) and the transgenic Arabidopsis thaliana plant B obtained in step (2) flower, they are hybridized to obtain hybrid offspring that target At_ciR25 with dCas13-TurboID fusion protein under the guidance of sgRNA; (4) Take the hybrid offspring obtained in step (3) for cultivation, and then take the seedlings that have germinated for 7 to 14 days and completely soak them in 50 to 300 μM biotin solution, and then stand at 28°C for 3 to 4 hours; (5) Take the seedlings treated in step (4) as samples for protein extraction, enrichment and mass spectrometry identification.