A molecular marker for identifying the gender of protocobitis typus and application thereof

By developing sex-specific molecular markers for mandarin fish and designing specific amplification primers, and utilizing PCR technology and fluorescence detection, the problem of non-destructive and early sex identification in the juvenile stage of mandarin fish has been solved, achieving rapid and accurate sex identification and efficient breeding.

CN121992091BActive Publication Date: 2026-06-16GUANGZHOU UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
GUANGZHOU UNIVERSITY
Filing Date
2026-04-08
Publication Date
2026-06-16

Smart Images

  • Figure CN121992091B_ABST
    Figure CN121992091B_ABST
Patent Text Reader

Abstract

The application discloses a kind of mandarin fish gender identification molecular markers and its application, molecular marker includes the DNA fragment as shown in SEQ ID NO.1 and the DNA fragment as shown in SEQ ID NO.2, when the 647th position of DNA fragment as shown in SEQ ID NO.1 is C base, mandarin fish gender is female;When the 647th position of DNA fragment as shown in SEQ ID NO.1 is C base and the 249th position of DNA fragment as shown in SEQ ID NO.2 is A base, mandarin fish gender is male, also disclosed the reagent, primer, kit or method for detecting the application of molecular marker in mandarin fish genotyping, mandarin fish genetic gender identification or mandarin fish assisted breeding;For fast and accurate screening female mandarin fish and male mandarin fish, shorten breeding time, improve breeding efficiency has important practical significance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker for sex identification of mandarin fish and its application. Background Technology

[0002] The mandarin fish (Siniperca chuatsi) is an important freshwater aquaculture species in my country, with a significant aquaculture industry. Recent studies have clearly revealed a significant sexual dimorphism in the growth of male and female mandarin fish: females grow faster before sexual maturity, while males exhibit stronger overwintering adaptability and disease resistance after sexual maturity. Therefore, in aquaculture practice, early and accurate sex identification, and subsequent sex-controlled breeding, could significantly improve the growth performance, stress resistance, and overall economic benefits of the farmed population. However, mandarin fish lacks obvious external sex characteristics, making it difficult to distinguish sex by visual inspection in juvenile stages. Traditional sex identification relies heavily on dissection or histological observation, methods that are not only destructive but also unsuitable for early-stage aquaculture. With the development of molecular biology techniques, molecular identification methods based on sex-specific genetic markers have become a key approach for early, non-destructive sex identification in fish.

[0003] Developing sex-specific molecular markers for mandarin fish and establishing a corresponding typing system will provide key technical support for early sex identification of this fish species. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker for sex identification of mandarin fish, primers for amplifying the molecular marker, and a kit that can rapidly and accurately achieve non-destructive sex identification of mandarin fish.

[0005] The present invention also aims to provide a method for sex determination of mandarin fish.

[0006] The final objective of this invention is to provide reagents, primers, kits, or methods for detecting the sex of the mandarin fish and their application in mandarin fish genotyping, sex identification, or assisted breeding.

[0007] The first objective of the present invention can be achieved by the following technical solution: a molecular marker for sex identification of mandarin fish, the molecular marker comprising a DNA fragment as shown in SEQ ID NO.1 and a DNA fragment as shown in SEQ ID NO.2, wherein when the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base, the mandarin fish is female; when the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base and the 249th position of the DNA fragment shown in SEQ ID NO.2 is an A base, the mandarin fish is male.

[0008] The present invention also discloses a primer for amplifying the molecular marker for sex identification of the mandarin fish, the primer comprising a reverse primer X, a reverse primer Y and a forward primer, the sequence of the reverse primer X is shown in SEQ ID NO.3, the sequence of the reverse primer Y is shown in SEQ ID NO.4 and the sequence of the forward primer is shown in SEQ ID NO.5.

[0009] in:

[0010] The nucleotide sequence of the reverse primer X is as follows:

[0011] 5'-ACAGTAATCAAGGCGTGAGT-3';

[0012] The nucleotide sequence of the reverse primer Y is as follows:

[0013] 5'-ACAGTAATCAAGGCGTGAGG-3'.

[0014] The nucleotide sequence of the forward primer is as follows:

[0015] 5'-CATTGCAGTCCACACAGAAG-3'.

[0016] Preferably, the reverse primer X and the reverse primer Y contain a fluorescent tag sequence, and the fluorescent groups of the reverse primer X and the reverse primer Y are different.

[0017] Preferably, the tag sequence of the fluorescent group is located at the 5' end of the reverse primer X and the reverse primer Y.

[0018] Preferably, the fluorescent group is FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 or BHQ3.

[0019] In some embodiments of the present invention, the 5' ends of the reverse primer X and the reverse primer Y are respectively connected to different fluorescent group universal tag sequences. The two tag sequences can be complementary to universal reporter primers with HEX and FAM fluorescent groups, respectively, corresponding to the HEX and FAM fluorescence detection channels.

[0020] The present invention further discloses a kit for sex identification of mandarin fish, including the primers mentioned above.

[0021] Preferably, the kit further includes DNA polymerase, dNTPs, and MgCl2.

[0022] In some embodiments of the present invention, the kit further includes TRET cassette fluorescent primers and ROX internal reference dye.

[0023] The second objective of this invention can be achieved through the following technical solution: a method for sex determination of mandarin fish, comprising the following steps:

[0024] (1) Extract genomic DNA from the mandarin fish to be tested;

[0025] (2) Using the genomic DNA from step (1) as a template, perform PCR amplification using the primers or kits described above;

[0026] (3) Analyze the PCR amplification products and identify the sex of the mandarin fish based on the genotype of the molecular markers in the genome of the mandarin fish to be tested.

[0027] In the above methods for sex determination of mandarin fish with upturned mouths:

[0028] Preferably, in step (3), when only the 647th position of the DNA fragment shown in SEQ ID NO.1 is detected as a C base (HEX signal only), the sex of the mandarin fish is female (XX); when both the 647th position of the DNA fragment shown in SEQ ID NO.1 and the 249th position of the DNA fragment shown in SEQ ID NO.2 are detected as a C base (HEX and FAM dual signals), the sex of the mandarin fish is male (XY).

[0029] In some embodiments of the present invention, when only HEX fluorescence signal is detected in step (3), it is determined to be female XX; when both HEX and FAM dual fluorescence signals are detected, it is determined to be male XY.

[0030] The last objective of the present invention can be achieved by the following technical solution: the application of the reagent for detecting the molecular marker, the primer, and the kit in the genotyping, genetic sex identification, or assisted breeding of mandarin fish.

[0031] The present invention has the following beneficial effects:

[0032] (1) The reagent for detecting molecular markers for sex identification of mandarin fish provided by the present invention can accurately identify the genetic sex of mandarin fish;

[0033] (2) The primers for amplifying molecular markers for sex identification of mandarin fish provided by the present invention can detect the genetic sex of mandarin fish. They are simple to use, have high throughput and high accuracy, and are suitable for the detection of a large number of samples.

[0034] (3) The molecular markers, primers, kits and methods provided by the present invention are of great practical significance for rapidly and accurately screening female and male mandarin fish, shortening breeding time and improving breeding efficiency. Attached Figure Description

[0035] Figure 1 The results of detecting 60 mandarin fish covering different growth stages using primers for amplifying molecular markers for sex identification in Example 1 of this invention are shown. The x-axis represents HEX fluorescence intensity (465-510), and the y-axis represents FAM fluorescence intensity (533-580). Detailed Implementation

[0036] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0037] Example 1

[0038] Development of molecular markers associated with sex-determining genes in mandarin fish

[0039] 1. Preparation of DNA samples from mandarin fish (Siniperca chuatsi)

[0040] Ten sexually mature mandarin fish (Ctenoptera litura) were obtained from Foshan, Guangdong Province. Based on the morphology of their gonads, they were initially classified into 5 females and 5 males, numbered M1-M5 and F1-F5 respectively. After dissection, the gonads were removed and fixed in Born's solution. Paraffin sections and HE staining were performed for further sex verification. 5g of dorsal muscle was taken from each fish and preserved in liquid nitrogen, and approximately 3cm of caudal fin was preserved in anhydrous ethanol. The muscle samples were prepared using a standard column centrifugation method (using a universal column-based genome extraction kit, Beijing Kangwei Century Biotechnology Co., Ltd.) following the manufacturer's instructions. The quality and concentration of the samples were determined using 1% agarose gel electrophoresis and a NanoDrop2000 microspectrophotometer to ensure they met the requirements for high-throughput sequencing.

[0041] 2. Sequencing library construction and high-throughput sequencing

[0042] Three female and three male fish samples with the best DNA quality from the sampling population were selected to construct paired-terminal genomic DNA libraries with insert sizes of 500 bp. Genome size assessment and assembly were performed on the genome sequencing data of the female and male fish with the highest sequencing depth. Genome size assessment was primarily based on the correlation between kmer depth and frequency distribution, analyzed using the software Jellyfish (2.2.10), with an initial kmer value of 21. Reference genome assembly employed a de novo assembly strategy, assembling reads into contig sequences based on their overlap, and further assembling these contig sequences into scaffold sequences based on their pair-end relationships. Using the software SOAPdenovo2 (version r241) combined with a multi-kmer assembly strategy, the kmer parameter range was set from 35 bp to 75 bp, with 3 bp intervals. Reference genome assembly was performed on the female and male fish with the highest sequencing depth, and the reference genome with the highest N50 value was selected as the optimal reference genome.

[0043] 3. Sex-specific sequence analysis

[0044] Based on the sequence alignment results, a sequence unique to male mandarin fish was identified. Since the Y chromosome genome has an additional sequence compared to the X chromosome, this sequence was found by comparing read coverage using high-multiplier sequencing. This sequence is unique to the Y chromosome, and co-linked markers were found around it.

[0045] 4. Development of molecular markers for sex identification in mandarin fish (Siniperca chuatsi).

[0046] Based on the location of male-specific sequences on chromosomes, SNP loci that differentiate between males and females are searched around these loci. Sequence copy number and GC content analyses are performed on these developed loci to ensure a high success rate for sex identification molecular markers in mandarin fish. These loci are then designed as molecular markers for sex identification in mandarin fish.

[0047] The information on the molecular markers for sex identification of mandarin fish is as follows: The molecular markers include the DNA fragment shown in SEQ ID NO.1 (female) and the DNA fragment shown in SEQ ID NO.2 (male). When the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base, the mandarin fish is female; when the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base and the 249th position of the DNA fragment shown in SEQ ID NO.2 is an A base, the mandarin fish is male.

[0048] The SNP positions in the sequence were determined based on the measured reference genome of Mandarin fish (accession numbers GCA_027580155.1 (male) and GCA_020085105.1 (female) in the NCBI database). In the female, C is located at position 30194791 on chromosome 3 of Mandarin fish (CM050866.1), and A is located at position 18690284 on chromosome 14 of Mandarin fish (CM050877.1).

[0049] Based on the characteristics of SNP site information, a set of competitive allele-specific PCR primers with fluorescent tags were designed, including reverse primer X, reverse primer Y, and forward primer COM. The two reverse primers have allelic code bases at their leading ends.

[0050] Reverse primer X (tagged sequence):

[0051] 5'- GAAGGTCGGAGTCAACGGATT ACAGTAATCAAGGCGTGAGT-3' (SEQ ID NO.3), where the underlined part is the HEX fluorescent tag sequence, as shown in SEQ ID NO.6;

[0052] Reverse primer Y (tagged sequence):

[0053] 5'- GAAGGTGACCAAGTTCATGCT ACAGTAATCAAGGCGTGAGG-3' (SEQ ID NO.4), where the underlined part is the FAM fluorescent tag sequence, as shown in SEQ ID NO.7;

[0054] Forward primer COM:

[0055] 5'-CATTGCAGTCCACACAGAAG-3' (SEQ ID NO. 5).

[0056] The 5' end of the reverse primers is added with a fluorescent tag sequence, wherein the 5' end of reverse primer X is connected to the HEX fluorescent tag sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO.6), and the 5' end of reverse primer Y is connected to the FAM fluorescent tag sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO.7).

[0057] All primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. This embodiment provides a high-throughput and simple genotyping method. Simply add the specific Primer mix (Guangzhou Henodel Biotechnology Co., Ltd.) and the universal Master mix to a PCR microplate containing the DNA sample, perform PCR amplification, and analyze the final results using a fluorescence detector.

[0058] The Master mix contains the following components: universal TRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2. The Master mix is ​​a product of Guangzhou Henode Biotechnology Co., Ltd., and its product name is FLU-ARMS for KASP 2X PCR mix V5F.

[0059] Example 2: Method for genetic sex determination in mandarin fish (Siniperca chuatsi)

[0060] This embodiment is used to verify whether the primers in Example 1 can achieve genetic sex identification, and includes the following steps:

[0061] (1) Genomic DNA was extracted from 30 female and 30 male mandarin fish;

[0062] (2) Dilution of DNA concentration:

[0063] The DNA concentration was diluted to 18-22 ng / μL (20 ng / μL in this example) and used as a template;

[0064] (3) PCR amplification reaction system:

[0065] Template DNA 4.5 μL, Primer mix 0.5 μL (concentration of reverse primer X and reverse primer Y is 1 μM, concentration of forward primer is 3 μM), Master mix 5 μL;

[0066] (4) The PCR reaction procedure is as follows:

[0067] 95℃ for 5 minutes; 95℃ for 20 seconds, 61℃~55℃ for 60 seconds, with each cycle reducing the annealing extension temperature by 0.6℃, for 10 cycles; 95℃ for 5 seconds, 58℃ for 20 seconds, for 40 cycles;

[0068] (5) Fluorescence scanning of PCR amplification products: The fluorescence signal of the reaction system was scanned using LightCycle480 and the data was analyzed and genotyped.

[0069] (6) Results Analysis:

[0070] When only the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base (i.e., the 30,194,791st C base on chromosome 3), and the result is only a HEX signal, the sex is female (XX). When both the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base (the 30,194,791st C base on chromosome 3) and the 249th position of the DNA fragment shown in SEQ ID NO.2 (the 18,690,284th A base on chromosome 14) are detected, and the result is both HEX and FAM signals, the sex is male (XY) (Table 1).

[0071] Table 1 Experimental Results

[0072] Sample number 465-510 533-580 result Score Genetic sex Sample 1 3.864 13.211 HEX signal only 0.99 Female, XX Sample 2 3.791 14.723 HEX signal only 0.83 Female, XX Sample 3 4.185 12.109 HEX signal only 0.71 Female, XX Sample 4 3.927 15.341 HEX signal only 0.94 Female, XX Sample 5 4.052 11.678 HEX signal only 0.68 Female, XX Sample 6 3.92 11.85 HEX signal only 0.77 Female, XX Sample 7 3.814 13.965 HEX signal only 0.89 Female, XX Sample 8 4.113 12.542 HEX signal only 0.76 Female, XX Sample 9 4.092 11.85 HEX signal only 0.74 Female, XX Sample 10 3.768 15.793 HEX signal only 0.91 Female, XX Sample 11 3.975 12.317 HEX signal only 0.79 Female, XX Sample 12 4.021 13.684 HEX signal only 0.85 Female, XX Sample 13 3.889 11.85 HEX signal only 0.67 Female, XX Sample 14 3.842 14.219 HEX signal only 0.82 Female, XX Sample 15 4.156 11.935 HEX signal only 0.73 Female, XX Sample 16 3.908 15.127 HEX signal only 0.96 Female, XX Sample 17 4.071 13.5 HEX signal only 0.95 Female, XX Sample 18 3.783 12.764 HEX signal only 0.78 Female, XX Sample 19 4.097 14.582 HEX signal only 0.87 Female, XX Sample 20 3.829 13.295 HEX signal only 0.92 Female, XX Sample 21 3.83 15.492 HEX signal only 0.81 Female, XX Sample 22 4.134 11.816 HEX signal only 0.7 Female, XX Sample 23 3.951 14.973 HEX signal only 0.84 Female, XX Sample 24 3.806 12.458 HEX signal only 0.75 Female, XX Sample 25 3.989 11.85 HEX signal only 0.87 Female, XX Sample 26 4.072 15.301 HEX signal only 0.93 Female, XX Sample 27 4.083 13.5 HEX signal only 0.75 Female, XX Sample 28 3.867 13.749 HEX signal only 0.88 Female, XX Sample 29 3.892 15.492 HEX signal only 0.81 Female, XX Sample 30 4.105 12.183 HEX signal only 0.72 Female, XX Sample 31 5.649 11.395 HEX and FAM dual signals 0.88 Male, XY Sample 32 6.217 10.843 HEX and FAM dual signals 0.72 Male, XY Sample 33 5.429 11.926 HEX and FAM dual signals 0.91 Male, XY Sample 34 6.753 10.318 HEX and FAM dual signals 0.6 Male, XY Sample 35 6.344 10.637 HEX and FAM dual signals 0.77 Male, XY Sample 36 5.894 11.572 HEX and FAM dual signals 0.86 Male, XY Sample 37 6.428 10.295 HEX and FAM dual signals 0.66 Male, XY Sample 38 6.045 11.847 HEX and FAM dual signals 0.96 Male, XY Sample 39 5.571 11.238 HEX and FAM dual signals 0.84 Male, XY Sample 40 6.892 10.541 HEX and FAM dual signals 0.58 Male, XY Sample 41 5.936 11.705 HEX and FAM dual signals 0.93 Male, XY Sample 42 5.969 10.443 HEX and FAM dual signals 0.84 Male, XY Sample 43 6.184 10.976 HEX and FAM dual signals 0.79 Male, XY Sample 44 5.317 11.429 HEX and FAM dual signals 0.89 Male, XY Sample 45 6.549 10.183 HEX and FAM dual signals 0.63 Male, XY Sample 46 6.881 10.274 HEX and FAM dual signals 0.64 Male, XY Sample 47 5.782 11.814 HEX and FAM dual signals 0.95 Male, XY Sample 48 6.015 10.732 HEX and FAM dual signals 0.81 Male, XY Sample 49 5.503 11.167 HEX and FAM dual signals 0.87 Male, XY Sample 50 6.158 11.49 HEX and FAM dual signals 0.94 Male, XY Sample 51 6.327 10.459 HEX and FAM dual signals 0.74 Male, XY Sample 52 5.841 11.638 HEX and FAM dual signals 0.9 Male, XY Sample 53 6.684 10.307 HEX and FAM dual signals 0.61 Male, XY Sample 54 5.97 11.422 HEX and FAM dual signals 0.99 Male, XY Sample 55 5.476 11.295 HEX and FAM dual signals 0.85 Male, XY Sample 56 6.253 10.812 HEX and FAM dual signals 0.77 Male, XY Sample 57 5.908 11.546 HEX and FAM dual signals 0.92 Male, XY Sample 58 5.384 12.081 HEX and FAM dual signals 0.55 Male, XY Sample 59 6.719 10.243 HEX and FAM dual signals 0.59 Male, XY Sample 60 6.303 11.275 HEX and FAM dual signals 0.87 Male, XY NTC 1.2 1.805 No specific fluorescence signal 0 NTC 1.181 1.932 No specific fluorescence signal 0 NTC 1.214 1.818 No specific fluorescence signal 0 NTC 1.186 1.742 No specific fluorescence signal 0 NTC 1.195 1.809 No specific fluorescence signal 0 NTC 1.208 1.827 No specific fluorescence signal 0 NTC 1.196 1.91 No specific fluorescence signal 0 NTC 1.179 2.041 No specific fluorescence signal 0 NTC 1.211 1.803 No specific fluorescence signal 0 NTC 1.188 1.835 No specific fluorescence signal 0 NTC 1.203 1.714 No specific fluorescence signal 0 NTC 1.192 1.822 No specific fluorescence signal 0

[0073] Combining sampling results from both female and male mandarin fish, primers amplifying molecular markers for sex identification in mandarin fish were used to detect the results of 60 mandarin fish covering different growth stages. Figure 1 As shown, Figure 1 Allele Y corresponds to a single HEX fluorescence signal (female XX), Both Alleles corresponds to dual HEX and FAM fluorescence signals (male XY), Negative / NTC has no specific fluorescence signal. Figure 1 The results were completely consistent with the results of the gonadal examination, with a detection accuracy of 100%. The results indicate that the primers used in this embodiment to amplify the molecular markers for sex identification of mandarin fish can accurately distinguish between female and male mandarin fish, and are fast and accurate. Therefore, they can be used for molecular marker-assisted selection breeding.

[0074] Example 3: Application in all-female breeding of mandarin fish

[0075] 1. Inducing pseudo-male fish

[0076] Female mandarin fish were soaked in a solution of 1 μg / L 17α-methyltestosterone for two months. During the rearing period, natural light was used, the water temperature was maintained at 23-30℃, and the amount of bait fish was not excessive, so that the fish were kept in a non-satiated state.

[0077] 2. Selection of pseudo-male fish and all-female culture

[0078] A tissue sample of approximately 3 cm from the caudal fin was taken, and the genetic sex identification method for mandarin fish in Example 2 was used to screen out pseudo-males (XX) that were genetically female. The identified pseudo-males (XX) were raised until sexual maturity, and then mated with normal XX female mandarin fish during the breeding season. The resulting offspring were all female mandarin fish.

[0079] 3. Comparison of benefits with traditional methods

[0080] When the method of this invention is compared with the conventional "PCR electrophoresis method", the method of this invention can significantly increase the detection throughput, greatly shorten the identification cycle, save experimental operation time, effectively avoid subjective bias in the results, and significantly improve the efficiency and accuracy of gender identification.

[0081] This embodiment fully demonstrates that the molecular marker primers provided by the present invention can not only achieve rapid, non-destructive, and high-precision sex identification in the juvenile stage of mandarin fish, but also significantly shorten the breeding cycle, reduce production costs, and improve breeding efficiency, providing reliable technical support for sex control breeding and industrial application of mandarin fish. Compared with traditional methods, the present invention has outstanding advantages in terms of time, space, and economic cost.

[0082] This invention successfully developed molecular marker primers for sex identification of mandarin fish by designing specific amplification primers. By detecting the genotype of the individual at these two loci, the genetic sex and corresponding genotype can be accurately determined directly. The development and practical application of these molecular marker primers can not only efficiently and accurately identify the sex of mandarin fish, but also be applied to parental molecular selection in mandarin fish hybridization breeding, providing reliable molecular technical support for mandarin fish hybridization breeding and significantly improving hybrid seed production efficiency.

[0083] This invention is not limited to the specific embodiments described above. The embodiments described above are merely for illustrating the use of this invention in detail, and equivalent production methods and technical details are also part of this invention. In fact, those skilled in the art, based on the foregoing description, can find different adjustments according to their own needs, and these adjustments should all be within the scope of the appended claims.

Claims

1. A molecular marker primer for sex identification of mandarin fish, characterized in that, The primers include reverse primer X, reverse primer Y, and forward primer. The sequence of reverse primer X is shown in SEQ ID NO.3, the sequence of reverse primer Y is shown in SEQ ID NO.4, and the sequence of forward primer is shown in SEQ ID NO.

5. The molecular markers include the DNA fragment shown in SEQ ID NO.1 and the DNA fragment shown in SEQ ID NO.

2. When the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base, the sex of the mandarin fish is female; when the 647th position of the DNA fragment shown in SEQ ID NO.1 is a C base and the 249th position of the DNA fragment shown in SEQ ID NO.2 is an A base, the sex of the mandarin fish is male.

2. The primer according to claim 1, characterized in that, The 5' ends of the reverse primers X and Y are linked to a fluorescent tag sequence, and the fluorescent groups of the reverse primers X and Y are different.

3. The primer according to claim 2, characterized in that, The fluorescent group is FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 or BHQ3.

4. A reagent kit for sex identification of mandarin fish, characterized in that, Includes the primers described in any one of claims 1-3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes DNA polymerase, dNTPs, and MgCl2.

6. A method for sex determination of mandarin fish, characterized in that, Includes the following steps: (1) Extract genomic DNA from the mandarin fish to be tested; (2) Using the genomic DNA from step (1) as a template, perform PCR amplification using the primers described in any one of claims 1 to 3 or the kit described in claim 4 or 5; (3) Analyze the PCR amplification products and identify the sex of the mandarin fish based on the genotype of the molecular markers in the genome of the mandarin fish to be tested; In step (3), when the test individual only detects a C base at position 647 of the DNA fragment shown in SEQ ID NO.1, the sex of the mandarin fish is female; when the test individual simultaneously detects a C base at position 647 of the DNA fragment shown in SEQ ID NO.1 and an A base at position 249 of the DNA fragment shown in SEQ ID NO.2, the sex of the mandarin fish is male.

7. The application of the primers according to any one of claims 1 to 3, and the kit according to claim 4 or 5, in genetic sex identification of mandarin fish or in all-female assisted breeding of mandarin fish, characterized in that, When the tested individual only shows a C base at position 647 of the DNA fragment shown in SEQ ID NO.1, the sex of the mandarin fish is female; when the tested individual shows a C base at position 647 of the DNA fragment shown in SEQ ID NO.1 and an A base at position 249 of the DNA fragment shown in SEQ ID NO.2, the sex of the mandarin fish is male.