Rhodococcus strain and application thereof in degrading insecticide and enhancing resistance of parasitic wasps

Abstract

The invention relates to an agricultural pest biological control technology, and aims to provide a rhodococcus strain and application thereof to degradation of insecticides and enhancement of parasitic wasp resistance. The strain is preserved in the China Center for Type Culture Collection, the preservation name is Fanqing Sheng Rhodococcus IT-1, the classification name of Latin is Rhodococcus qingshengii, and the preservation number is CCTCC NO: M 20252461. The 16S rRNA gene sequence of the strain is as shown in SEQ ID NO: 1. The strain is unique in source and broad in function spectrum; biological control can be enhanced, and the effect is remarkable; the strain is supplemented back into the parasitic wasp body in a feeding mode, the endurance capacity of the parasitic wasp to imidacloprid and thiamethoxam can be remarkably improved, and the strain has great significance in maintaining and enhancing the biological control function of an agricultural ecosystem and reducing dependence of chemical pesticides.

Description

Technical Field

[0001] This invention relates to microbial technology and biological control technology for agricultural pests, specifically involving a strain of Rhodococcus (IT-1) and its application in degrading insecticides and enhancing the resistance of parasitic wasps. Background Technology

[0002] Neonicotinic insecticides (such as imidacloprid and thiamethoxam) are widely used globally due to their high efficiency and broad spectrum. However, studies have shown that neonicotinic insecticides have high bioaccumulation and environmental persistence, allowing them to persist in soil, water, and organisms for extended periods. This poses a serious threat to non-target organisms (such as pollinators and natural enemies) and disrupts ecological balance. Microbial degradation is an economical and environmentally friendly strategy for removing pesticide residues from the environment.

[0003] Fruit flies are widely distributed in nature, numerous, and diverse, causing significant damage and substantial economic losses to agricultural production, especially berry cultivation. Statistics show that approximately 90% of fruit flies in nature are parasitized by parasitic wasps. Currently, 16 genera belonging to 4 families of fruit fly parasitic wasps have been discovered and reported. Among them, the genera *Leptopilina* (Family Figitidae), *Ganaspis* (Family Figitidae), and *Asobara* (Family Braconidae) account for over 20% of the species. *Leptopilina* and *Asobara* are dominant parasitic enemies of fruit fly pests, demonstrating excellent biocontrol potential in orchard ecosystems. Among them, the fruit fly gall wasp L. drosophilae and the Japanese open-armed constrictor wasp A. japonica are particularly outstanding: the former can accurately locate and parasitize the early larvae of fruit flies, effectively suppressing their population base; the latter is good at parasitizing the middle and late larvae, and shows a significant pest control effect with its high parasitism rate.

[0004] However, the application of pesticides in the field severely impacts the population survival and pest control efficacy of parasitic wasps. Recent studies have shown that symbiotic bacteria in the insect gut may participate in the host's detoxification and metabolic processes of pesticides, providing a new approach to enhancing the pesticide resistance of natural enemy insects.

[0005] Currently, a few microorganisms capable of degrading neonicotinoid insecticides have been reported. For example, patent CN112779194B discloses a strain of *Gordonella alkali-eating* for degrading imidacloprid, and patent CN116376764A discloses a strain of *Pseudomonas* capable of degrading acetamiprid. However, most strains have single functions, and few studies have directly linked degrading bacteria to enhancing the resistance of natural enemy insects. Screening functional strains from the unique habitat of parasitic wasp intestines and confirming that they can both directly degrade insecticides and replenish the host to enhance resistance has significant innovative value and application potential. Currently, there are no reports of *Rhodococcus* strains simultaneously possessing the functions of degrading imidacloprid and thiamethoxam while enhancing the resistance of parasitic wasps. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a strain of Rhodococcus and its application in degrading insecticides and enhancing the resistance of parasitic wasps.

[0007] To solve the technical problem, the solution of the present invention is:

[0008] A strain of Rhodococcus is provided, characterized in that the strain is deposited at the China Center for Type Culture Collection, with the deposit name Rhodococcus qingshengii IT-1, the Latin taxonomic name Rhodococcus qingshengii, and the accession number CCTCC NO: M 20252461.

[0009] As a preferred embodiment of the present invention, the Rhodococcus strain is isolated from the intestinal contents of adult Drosophila gall midge.

[0010] As a preferred embodiment of the present invention, the 16S rRNA gene sequence of the Rhodococcus strain is shown in SEQ ID NO: 1.

[0011] The present invention also provides a method for culturing the aforementioned Rhodococcus strain, which involves transferring the strain to a liquid culture medium and culturing it at 28–32°C with shaking; wherein the liquid culture medium is LB medium or an inorganic salt culture medium with neonicotinoid insecticides as the sole carbon source; wherein the neonicotinoid insecticide is at least one of imidacloprid or thiamethoxam.

[0012] The present invention also provides the application of the aforementioned Rhodococcus strain in degrading neonicotinoid insecticides or enhancing the resistance of parasitic wasps to neonicotinoid insecticides, wherein the neonicotinoid insecticide is at least one of imidacloprid or thiamethoxam.

[0013] The present invention further provides a microbial agent with the function of degrading imidacloprid or thiamethoxam, the microbial agent comprising a Rhodococcus strain as the active ingredient and an agriculturally acceptable carrier.

[0014] This invention also provides a method for using the aforementioned microbial inoculant: the microbial inoculant is added to water at a dosage ratio of 1% to 5%, mixed evenly, and then applied by spraying to fields or forests contaminated with imidacloprid or thiamethoxam, with the application rate controlled at 450 to 750 L / hm². 2 Scope; the carrier in the microbial agent is sterile phosphate buffer, and the viable bacteria concentration is 5 × 10⁻⁶. 9 cfu / mL.

[0015] The present invention further provides a microbial agent that enhances the resistance of parasitic wasps to imidacloprid or thiamethoxam, the microbial agent comprising a Rhodococcus strain as the active ingredient and an acceptable carrier in the parasitic wasp feed.

[0016] This invention also provides a method for using the aforementioned microbial agent. Before use, the parasitic wasps are fed a sucrose aqueous solution containing antibiotics to clear the intestinal flora of the wasps for one day; then, they are fed the microbial agent for two days. The carrier in the microbial agent is sucrose water, and the live bacteria concentration is 5 × 10⁻⁶. 9 cfu / mL.

[0017] As a preferred embodiment of the present invention, the parasitic wasp is a parasitic wasp belonging to the genus *Gallus spp.* or *Braconidae*.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] 1. Unique strain origin: This strain was isolated from the intestine of the fruit fly gall wasp, a natural enemy insect exposed to pesticides. Its habitat origin indicates that it has good adaptability and specificity to the parasitic wasp system, providing an ideal strain resource for enhancing the stress resistance of natural enemy insects through microbial means.

[0020] 2. Broad-spectrum function, dual effect of one strain: The Rhodococcus IT-1 provided by this invention can simultaneously degrade imidacloprid and thiamethoxam, two neonicotinoid insecticides that are widely coexisting in farmland environments. This solves the problem of single-function strains having weak targeting and limited effect in practical applications, and achieves synergistic remediation of compound pollution.

[0021] 3. Enhanced biological control with significant results: By feeding the parasitic wasps with this strain, the parasitic wasps' tolerance to imidacloprid and thiamethoxam can be significantly improved, effectively protecting the population in the field. This is of great significance for maintaining and enhancing the biological control function of agricultural ecosystems and reducing dependence on chemical pesticides.

[0022] 4. Broad application prospects: The degradation method and the strategy for enhancing the resistance of natural enemy insects provided by this invention both belong to the field of biotechnology. They are environmentally friendly and do not produce secondary pollution. The developed microbial agents have broad application prospects in water purification and the protection of natural enemy insects.

[0023] 5. The "one-bacterial-two-effect" microbial strain provided by this invention not only provides a new tool for the remediation of pesticide-polluted environments, but also has the potential to substantially improve the field survival and pest control capabilities of natural enemy insects by regulating their gut microecology, thus providing a brand-new solution to the problem of antagonism between chemical pesticides and biological control measures.

[0024] 6. The strains of this invention can not only efficiently degrade neonicotinoid insecticides imidacloprid and thiamethoxam, but also significantly enhance the resistance of parasitic wasps to these insecticides, thereby addressing the current state of microbial resources threatened by multiple neonicotinoid insecticides. Attached Figure Description

[0025] Figure 1 This is the phylogenetic tree of Rhodococcus IT-1 in this invention.

[0026] Figure 2 Photograph of Rhodococcus IT-1 colonies.

[0027] Figure 3 The degradation efficiency of Rhodococcus IT-1 on imidacloprid in MSM medium was measured.

[0028] Figure 4 The degradation efficiency of thiamethoxam by Rhodococcus IT-1 in MSM medium is shown.

[0029] Figure 5 To investigate the changes in resistance of Rhodococcus IT-1 to the fruit fly gall wasp Ld under imidacloprid stress;

[0030] Figure 6 To investigate the changes in resistance of Rhodococcus IT-1 to the Japanese open-mandible brachiopod wasp (Aj) under imidacloprid stress;

[0031] Figure 7 To investigate the changes in resistance of Rhodococcus IT-1 to Drosophila melanogaster (Ld) under thiamethoxam stress.

[0032] Figure 8 To investigate the changes in resistance of Rhodococcus IT-1 to Japanese open-mandible brachiopod wasp (Aj) under thiamethoxam stress. Detailed Implementation

[0033] The present invention will now be described in detail with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited thereto.

[0034] Example 1: Isolation, Screening and Identification of Strains

[0035] 1. Strain isolation: Male and female Drosophila galli were collected from a field in Taizhou City, Zhejiang Province, where neonicotinoid insecticides imidacloprid and thiamethoxam had been used, and were stably passaged under laboratory conditions.

[0036] Female adult Drosophila gall midges were collected, and their intestinal contents were extracted. The contents were serially diluted with sterile phosphate-buffered saline (PBS, pH 7.0), and appropriate amounts of each dilution were spread onto inorganic salt agar plates containing either 5 mg / L imidacloprid or 5 mg / L thiamethoxam as the sole carbon source. The inorganic salt agar plate composition was: Na₂HPO₄ 1.5 g / L, KH₂PO₄ 0.5 g / L, NH₄NO₃ 1.0 g / L, MgSO₄·7H₂O 0.2 g / L, NaCl 1.0 g / L, agar 15 g / L, pH 7.0. The plates were incubated upside down in a 30°C incubator and observed until single colonies appeared on both inorganic salt agar plates.

[0037] 2. Degradation Function Validation: Single colonies were selected from plates for purification and culture. The purified strains were inoculated into MSM liquid medium with 5 mg / L imidacloprid or 5 mg / L thiamethoxam as the sole carbon source and cultured at 30 °C and 180 rpm for 5 days with shaking. The residual amounts of the corresponding insecticides in the culture medium were periodically detected by high performance liquid chromatography (HPLC). A strain with stable degradation ability against both insecticides was screened and named IT-1.

[0038] 3. Strain Identification and Preservation: The 16S rRNA gene sequence was amplified using universal primers 27F and 1522R (as shown in SEQ ID NO: 2 and SEQ ID NO: 3), yielding a gene sequence of approximately 1449 bp (as shown in SEQ ID NO: 1). The sequencing results were BLAST-aligned in the NCBI database. The results showed that strain IT-1 was most homologous to strains of the genus *Rhodococcus*, and it was identified as *Rhodococcus qingshengii*.

[0039] SEQ ID NO: 1:

[0040]

[0041] SEQ ID NO: 2: agagtttgatcmtggctcag 20

[0042] SEQ ID NO: 3: aaggaggtgatccagccgca 20

[0043] The applicant deposited this strain with the China Center for Type Culture Collection (CCTCC) on November 6, 2025, and the collection status is viable. The collection name is *Rhodococcus qingshengii* IT-1, the Latin taxonomic name is *Rhodococcus qingshengii*, and the accession number is CCTCC NO: M 20252461. The deposit address is the Collection Center of Wuhan University, Wuhan, Hubei Province, 430072, China; the contact number is 027-68754052.

[0044] Example 2: Determination of the in vitro degradation ability of strain IT-1

[0045] To quantitatively assess the degradation ability of strain IT-1, parallel degradation experiments were designed.

[0046] The activated IT-1 strain was inoculated into LB liquid medium and cultured at 30 °C and 180 rpm until the logarithmic growth phase. The bacterial cells were collected by centrifugation, washed with sterile PBS, and resuspended to prepare a high-density bacterial suspension (OD). 600 (≈ 1.0), determined according to a proprietary standard curve, the viable bacterial concentration is approximately 5 × 10⁻⁶. 9 CFU / mL. MSM liquid medium with 5 mg / L imidacloprid and 5 mg / L thiamethoxam as the sole carbon source were prepared as reaction systems. The bacterial suspensions were inoculated at a rate of 5% (v / v), and an uninoculated medium was set up as a blank control. All treatments were incubated in a shaker at 30 °C and 180 rpm, and samples were taken at 0, 1, 3, 5, 15, and 25 days. Insecticide residues were analyzed by high-performance liquid chromatography, and degradation rates were calculated.

[0047] Insecticide degradation rate = (Insecticide content in control group - Insecticide content in experimental group) / Insecticide content in control group × 100%.

[0048] Result: As Figure 3 , 4As shown, strain IT-1 exhibits significant degradation activity against both insecticides. In the figure, CK represents the blank control group without inoculation with strain IT-1, and IT-1 represents the experimental group inoculated with Rhodococcus IT-1. After 5 days of culture, the degradation rates of imidacloprid and thiamethoxam reached approximately 12% and 25%, respectively. After 25 days of culture, the degradation rates exceeded 50% and 40%, respectively, significantly higher than the control group. This fully demonstrates its broad-spectrum efficacy.

[0049] Based on the above experimental data, microbial agents (containing sterile phosphate buffer and live bacteria) can be used in field or forest agricultural operations to degrade imidacloprid or thiamethoxam residues on plant surfaces or in the soil. The recommended application method is as follows: mix the above-mentioned agent with water at a ratio of 1%–5%, then apply it as a spray to fields or forests contaminated with fipronil, controlling the application rate at 450–750 L / hm². 2 scope.

[0050] Example 3: Experiment on the enhancement of parasitic wasp resistance by strain IT-1

[0051] 1. Aseptic pretreatment of parasitic wasps: Healthy adult fruit fly gall wasps (Ld) and Japanese open-mandible parasitic wasps (Aj) were selected after emergence and fed with 10% (w / v) sucrose water containing a mixture of antibiotics (tetracycline 500 μg / mL; rifampin 500 μg / mL; ampicillin 200 μg / mL; penicillin-streptomycin 200 μg / mL) for 24 hours to establish a model wasp with a lack of intestinal flora.

[0052] 2. Strain replenishment: Strain IT-1 was cultured in LB medium to the logarithmic growth phase, and OD was prepared. 600 The bacterial cell-sucrose suspension had a concentration of approximately 1.0. Based on a specific standard curve, the viable cell concentration was approximately 5 × 10⁻⁶. 9 cfu / mL. Feed this suspension to antibiotic-pretreated parasitic wasps for 2 days to complete the bacterial strain replenishment.

[0053] 3. Biological resistance determination: *Drosophila melanogaster* (Ld) and *Ajax japonicus* (Aj) were used as experimental subjects. The following treatment groups were established for each group: (A) Conventional group: healthy parasitic wasps without any treatment; (B) Aseptic group: parasitic wasps treated with antibiotics but not reintroduced with IT-1; (C) Reintroduced group: parasitic wasps treated with antibiotics and reintroduced with IT-1 strain. Parasitic wasps from each treatment group were transferred into cylindrical tubes containing a series of concentration gradients of thiamethoxam or imidacloprid in sucrose solution, with 20 wasps per tube. Each treatment was repeated three times. They were reared at 25 °C and 50% relative humidity, and mortality was recorded within 24 h. Data analysis was performed using SPSS software. If the LC50 of the aseptic group and the reintroduced group was significantly lower than the control group, the mortality rate was significantly lower. 50If the confidence intervals do not overlap, then LC 50 The values ​​were considered to be significantly different.

[0054] Results: See Tables 1-4 below and Figure 5-8 As shown, the LC50 of parasitic wasps in the replenishment group (C) against imidacloprid and thiamethoxam. 50 The values ​​were all significantly higher than those in the sterile group (B). For example, after IT-1 supplementation, the resistance fold of *Gallus spp.* to imidacloprid increased by 1.86 times and to thiamethoxam by 2.25 times; after IT-1 supplementation, the resistance fold of *Braconida japonicus* to imidacloprid increased by 1.80 times and to thiamethoxam by 1.66 times. This result clearly confirms that strain IT-1 successfully colonized the intestines of parasitic wasps and played a key detoxification role, thereby significantly enhancing the host's tolerance to the two target pesticides.

[0055] Table 1. Effects of supplementary IT-1 on imidacloprid resistance in Drosophila melanogaster.

[0056]

[0057] Table 2. Effects of supplemental IT-1 on imidacloprid resistance in the Japanese wrasse.

[0058]

[0059] Table 3 Effects of IT-1 supplementation on thiamethoxam resistance in Drosophila melanogaster

[0060]

[0061] Table 4 Effects of IT-1 supplementation on thiamethoxam resistance in Japanese open-armed mandible wasps

[0062]

[0063] In summary, this invention successfully isolated and identified a strain of *Rhodococcus fanqingsheng* IT-1 derived from the gut of the fruit fly *Gallus fennectus*. The unique advantage of this strain lies in its ability to simultaneously and efficiently degrade two structurally similar neonicotinoid insecticides, imidacloprid and thiamethoxam. Further biological functional verification showed that reintroducing this strain effectively enhanced the in vivo resistance of these two important parasitic wasps to the aforementioned pesticides. This invention provides a new core strain resource and a feasible technical pathway for developing microbial remediation agents targeting compound neonicotinoid pesticide residues, as well as for biofortification strategies that enhance the field adaptability of natural enemy insects through microbial intervention.

Claims

1. A strain of Rhodococcus, characterized in that, This strain is deposited at the China Center for Type Culture Collection (CCTCC) under the name Rhodococcus qingshengii IT-1, with the Latin taxonomic name Rhodococcus qingshengii and accession number CCTCCNO: M 20252461.

2. The Rhodococcus strain according to claim 1, characterized in that, The Rhodococcus strain was isolated from the intestinal contents of adult Drosophila gall midge.

3. The Rhodococcus strain according to claim 1, characterized in that, The 16S rRNA gene sequence of the Rhodococcus strain is shown in SEQ ID NO:

1.

4. A method for culturing the Rhodococcus strain according to any one of claims 1 to 3, characterized in that, The strain is transferred to a liquid culture medium and cultured at 28–32°C with shaking; the liquid culture medium is LB medium or an inorganic salt medium with neonicotinoid insecticides as the sole carbon source; the neonicotinoid insecticide is at least one of imidacloprid or thiamethoxam.

5. The use of the Rhodococcus strain according to any one of claims 1 to 3 in degrading neonicotinoid insecticides or enhancing the resistance of parasitic wasps to neonicotinoid insecticides, wherein the neonicotinoid insecticide is at least one of imidacloprid or thiamethoxam.

6. A microbial agent with the function of degrading imidacloprid or thiamethoxam, characterized in that, The microbial agent includes the Rhodococcus strain as described in any one of claims 1 to 3 as the active ingredient, and an agriculturally acceptable carrier.

7. The method of using the microbial agent according to claim 6, characterized in that, Mix the microbial agent with water at a ratio of 1% to 5%, then apply it as a spray to fields or forests contaminated with imidacloprid or thiamethoxam. The application rate should be controlled at 450–750 L / hm². 2 Scope; the carrier in the microbial agent is sterile phosphate buffer, and the viable bacteria concentration is 5 × 10⁻⁶. 9 cfu / mL.

8. A microbial agent that enhances the resistance of parasitic wasps to imidacloprid or thiamethoxam, characterized in that, The microbial agent includes the Rhodococcus strain as described in any one of claims 1 to 3 as an active ingredient, and an acceptable carrier in parasitic bee feed.

9. The method of using the microbial agent according to claim 8, characterized in that, Before use, parasitic wasps were fed a sucrose solution containing antibiotics to clear the intestinal flora for one day; then, they were fed a microbial agent for two days. The carrier of the microbial agent was sucrose solution, and the live bacteria concentration was 5 × 10⁻⁶. 9 cfu / mL.

10. The method according to claim 9, characterized in that, The parasitic wasps are those belonging to the genera *Gallus spp.* or *Bronchiolochia*.

Images