Primer set for identifying molecular marker of endangered plant of silver fir population and application thereof

By designing molecular markers DYS, SHS, BMS, HP, and DLS and their primer sets, combined with PCR amplification and electrophoresis detection, the cumbersome problem of tracing the origin of Cathaya argyrophylla populations has been solved, enabling rapid and convenient origin tracing and supporting the protection and genetic monitoring of Cathaya argyrophylla.

CN122038595BActive Publication Date: 2026-07-14INST OF BOTANY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610280766.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-09
Publication Date
2026-07-14
Estimated Expiration
2046-03-09

AI Technical Summary

Technical Problem

Existing technologies are cumbersome and time-consuming in distinguishing different populations of Cathaya argyrophylla, making it difficult to meet the needs for rapid, accurate, and standardized origin traceability of the endangered plant Cathaya argyrophylla.

Method used

Molecular markers DYS, SHS, BMS, HP, and DLS, along with their specific primer sets, are provided. The origin of Cathaya argyrophylla populations can be directly identified through PCR amplification and agarose gel electrophoresis, simplifying the operation process and improving analytical efficiency.

Benefits of technology

It enables rapid, simple, and intuitive origin tracing of Cathaya argyrophylla populations, is applicable to forensic identification and species control, supports the protection and genetic diversity monitoring of Cathaya argyrophylla, simplifies technical processes, and improves analytical efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038595B_ABST
    Figure CN122038595B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of species provenance tracing, and particularly relates to a primer set of molecular markers for identifying populations of endangered plant Cunninghamia lanceolata and application thereof. The present application provides five molecular markers DYS, SHS, BMS, HP and DLS for identifying populations of endangered plant Cunninghamia lanceolata for the first time, wherein the molecular markers DYS, SHS, BMS, HP and DLS are respectively used for identifying the Dayaoshan population, the Shunhuangshan population, the Bamianshan population, the Huaping population and the Daluoshan population of Cunninghamia lanceolata. Then, a primer set for amplifying the molecular markers DYS, SHS, BMS, HP and DLS is designed, and a tracing method of the source of Cunninghamia lanceolata is developed. The method can trace the geographical source of Cunninghamia lanceolata simply and efficiently, and provides reliable technical support for the judicial identification and species control of the endangered plant Cunninghamia lanceolata.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of species origin tracing technology, specifically involving primer sets for identifying molecular markers of endangered plant Cathaya argyrophylla populations and their applications. Background Technology

[0002] Silver Fir ( Cathaya argyrophylla Cathaya argyrophylla is the only extant species of the genus Cathaya in the family Pinaceae. It is a relict plant endemic to China and a Class I protected wild plant in China, often referred to as the "giant panda" of the plant kingdom. Only about a thousand Cathaya argyrophylla trees remain, mostly growing in harsh environments such as sparsely populated mountain ridges or the tops of cap-shaped rocky mountains. They are distributed in isolation across four subtropical mountain ranges in China: the Dalou Mountains, Yuecheng Mountains, Bamian Mountains, and Dayao Mountains. Studies have shown that the existing populations of Cathaya argyrophylla can be classified into five genetic lineages: the Dalou Mountain group, the Bamian Mountain group, the Shunhuang Mountain group, the Huaping group, and the Dayao Mountain group. There are no significant phenotypic differences among the different groups, making it difficult to distinguish their origin based on morphological characteristics.

[0003] Molecular markers possess advantages such as high polymorphism, strong genetic stability, insensitivity to environmental conditions, direct reflection of genetic differences at the DNA level, and the ability to be rapidly and standardizedly detected. As a Class I protected wild plant in China, Cathaya argyrophylla (Silver Fir) urgently requires rapid, accurate, and standardized origin-tracing technologies for the control of illegal trade in its timber and products, the scientific introduction and ex-situ conservation of its germplasm resources, and the monitoring of genetic diversity in reintroduced wild populations. Therefore, developing molecular markers to distinguish different Cathaya argyrophylla populations not only has scientific value but also possesses the potential for direct application in law enforcement and conservation practices, making it crucial for the protection of Cathaya argyrophylla.

[0004] Although existing technologies have developed SNP molecular markers for tracing Cathaya argyrophylla populations, using these markers still requires first-generation sequencing, relying on base differences in the sequences to distinguish different populations. This process is somewhat cumbersome and time-consuming. Therefore, discovering simpler and more efficient molecular markers and developing matching primer sets is essential for tracing the origin of the endangered plant Cathaya argyrophylla, for forensic identification, and species management. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides primer sets for identifying molecular markers of the endangered plant *Cathaya argyrophylla* and their applications. This invention provides, for the first time, five molecular markers—DYS, SHS, BMS, HP, and DLS—for identifying *Cathaya argyrophylla* populations. These markers are used to identify the Dayaoshan, Shunhuangshan, Bamianshan, Huaping, and Daloushan populations of *Cathaya argyrophylla*, respectively. Primers for amplifying these markers were then designed, and a method for tracing the geographical origin of *Cathaya argyrophylla* was developed. This method can easily and efficiently trace the geographical origin of *Cathaya argyrophylla*, providing reliable technical support for the forensic identification and species management of this endangered plant.

[0006] To achieve the above objectives, the specific technical solution of the present invention is as follows: The first aspect of the present invention provides a primer set for identifying molecular markers for the endangered plant Cathaya argyrophylla populations, wherein the molecular markers are at least one of the molecular markers DYS, SHS, BMS, HP and DLS; The nucleotide sequence of the molecular marker DYS is shown in SEQ ID NO.1. Deletion polymorphism exists in the sequence from 114bp to 199bp. The nucleotide sequence of the molecular marker SHS is shown in SEQ ID NO.2. Deletion polymorphism exists in the sequence from 243bp to 311bp. The nucleotide sequence of the molecular marker BMS is shown in SEQ ID NO.3. A deletion polymorphism exists in the sequence from 220bp to 326bp. The nucleotide sequence of the molecular marker HP is shown in SEQ ID NO.4. Deletion polymorphism exists in the sequence from 117bp to 243bp. The nucleotide sequence of the molecular marker DLS is shown in SEQ ID NO.5. Deletion polymorphism exists in the sequence from 141bp to 199bp. Molecular marker DYS was used to identify the Cathaya argyrophylla population in Dayaoshan, molecular marker SHS was used to identify the Cathaya argyrophylla population in Shunhuangshan, molecular marker BMS was used to identify the Cathaya argyrophylla population in Bamianshan, molecular marker HP was used to identify the Cathaya argyrophylla population in Huaping, and molecular marker DLS was used to identify the Cathaya argyrophylla population in Daloushan. The primer set is a primer set for amplifying molecular markers DYS, SHS, BMS, HP, or DLS. The primer set for amplifying DYS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.6 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.7; The primer set for amplifying SHS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.9; The primer set for amplifying BMS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.11; The primer set for amplifying HP consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.13; The primer set for amplifying DLS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.15.

[0007] A second aspect of the present invention provides the application of the primer set of molecular markers described above for identifying populations of the endangered plant Cathaya argyrophylla in the preparation of a kit for identifying Cathaya argyrophylla populations.

[0008] Furthermore, the kit consists of the primer set for identifying molecular markers for the endangered plant Cathaya argyrophylla populations as described above, a high-fidelity DNA polymerase premix, and nuclease-free water.

[0009] Furthermore, the high-fidelity DNA polymerase premix contains dNTP Mix, Phanta Max Super-Fidelity DNA Polymerase, and 2×Phanta Max Buffer.

[0010] Furthermore, the amplification products of the primer set were detected by agarose gel electrophoresis, and the origin of the Cathaya argyrophylla population was identified based on the band size. When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

[0011] The third aspect of this invention provides the application of the primer set of molecular markers described above for identifying populations of the endangered plant Cathaya argyrophylla in the identification of Cathaya argyrophylla populations.

[0012] Furthermore, the amplification products of the primer set were detected by agarose gel electrophoresis, and the origin of the Cathaya argyrophylla population was identified based on the band size. When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

[0013] The fourth aspect of the present invention provides the application of the primer set of molecular markers described above for identifying populations of the endangered plant Cathaya argyrophylla in distinguishing populations of Cathaya argyrophylla, wherein the distinction is based on the place of origin of Cathaya argyrophylla.

[0014] Furthermore, the amplification products of the primer set were detected by agarose gel electrophoresis, and the Cathaya argyrophylla populations were distinguished based on the band size: When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

[0015] The fifth aspect of this invention provides the application of the primer set of molecular markers described above for identifying endangered Cathaya argyrophylla populations in tracing the origin of Cathaya argyrophylla.

[0016] Furthermore, the amplification products of the primer set were detected by agarose gel electrophoresis, and the origin of the Cathaya argyrophylla was traced based on the band size: When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

[0017] The sixth aspect of this invention provides a method for tracing the origin of Cathaya argyrophylla, comprising the following steps: DNA was extracted from the Cathaya argyrophylla sample to be tested; Using the DNA of the Cathaya argyrophylla sample to be tested as a template, the template was amplified by PCR using any one of the primer sets for amplifying DYS, SHS, BMS, HP, or DLS to obtain PCR products. The PCR products were analyzed by agarose gel electrophoresis. The population type of the tested Cathaya argyrophylla samples was determined according to the following rules: When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

[0018] Furthermore, each 10 μL PCR amplification reaction system includes: 1 μL DNA template, 0.4 μL each of 10 μmol / L forward and reverse primers, 0.2 μL dNTP Mix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 5 μL 2×Phanta Max Buffer, and nuclease-free water to make up the difference.

[0019] Further, the reaction conditions for the PCR amplification are: (1) 95℃ pre-denaturation for 3 min; (2) 95℃ denaturation for 15 s, 53℃~56℃ annealing for 15 s, 72℃ extension for 30 s; 30 cycles; (3) 72℃ extension for 5 min.

[0020] Furthermore, when using the primer set for amplifying DYS, the annealing temperature for the PCR amplification reaction is 56°C; when using the primer set for amplifying SHS, the annealing temperature for the PCR amplification reaction is 54°C; when using the primer set for amplifying BMS, the annealing temperature for the PCR amplification reaction is 56°C; when using the primer set for amplifying HP, the annealing temperature for the PCR amplification reaction is 54°C; and when using the primer set for amplifying DLS, the annealing temperature for the PCR amplification reaction is 53°C.

[0021] Furthermore, the concentration of the agarose gel is 2 w / v.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention, based on the genome of *Cathaya argyrophylla* and resequencing data of *Cathaya argyrophylla* populations from different geographical origins, provides for the first time a primer set for identifying molecular markers of the endangered plant *Cathaya argyrophylla* populations and their applications. The molecular markers for identifying endangered *Cathaya argyrophylla* populations are DYS, SHS, BMS, HP, and DLS, which are used to identify the Dayaoshan, Shunhuangshan, Bamianshan, Huaping, and Daloushan populations of *Cathaya argyrophylla*, respectively. Then, specific primer sets for amplifying the molecular markers DYS, SHS, BMS, HP, and DLS were designed, establishing a method for tracing the origin of *Cathaya argyrophylla*. This method can easily and efficiently trace the geographical origin of *Cathaya argyrophylla*, laying a solid foundation for the protection and genetic distribution of this rare and endangered plant.

[0023] (1) Achieving Simple and Efficient Source Tracing: This invention addresses the shortcomings of current SNP molecular markers used in tracing Cathaya argyrophylla populations, which still rely on first-generation sequencing and interpretation based on base sequence differences, resulting in a relatively cumbersome and time-consuming process. It discloses a primer set for identifying molecular markers in endangered Cathaya argyrophylla populations. This primer set can specifically amplify and identify InDel molecular markers in endangered Cathaya argyrophylla populations. InDel molecular markers are directly distinguished by the polymorphism in the length of PCR amplification products, enabling rapid and intuitive detection without sequencing. This significantly simplifies the technical process, improves analytical efficiency, and is therefore more suitable for the rapid and convenient source tracing needs of Cathaya argyrophylla.

[0024] (2) The method is practical, reliable, and easy to promote: The method for tracing the origin of Cathaya argyrophylla established in this invention is based on a primer set that specifically amplifies the InDel molecular marker. Through conventional PCR amplification and electrophoresis analysis, the origin of the Cathaya argyrophylla population can be accurately determined based on the band size. This method is simple to operate and easy to master, requiring no complex instruments or cumbersome steps. It is easy to promote in actual forensic identification, species management, and conservation research scenarios, providing an efficient, stable, and widely applicable technical means for the geographical tracing of Cathaya argyrophylla.

[0025] (3) Positive significance for species protection: The primer set and source tracing method for identifying molecular markers of endangered Cathaya argyrophylla populations provided by this invention help trace the origin of Cathaya argyrophylla, a national first-class protected plant, and provide a scientific basis for species protection of Cathaya argyrophylla. It can better understand the distribution range, genetic structure and other information of Cathaya argyrophylla, thereby formulating more effective protection strategies, strengthening the protection of this rare species, promoting the recovery and growth of its population, and having important positive significance for maintaining biodiversity and ecological balance. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1This is an agarose gel electrophoresis image of PCR performed using primers amplifying DYS. M represents the DNA Marker. Lanes 1-3 correspond to three individuals from the *Cathaya argyrophylla* population in the Dayaoshan area; lanes 4-6 correspond to three individuals from the Shunhuangshan population; lanes 7-9 correspond to three individuals from the Bamianshan population; lanes 10-12 correspond to three individuals from the Huaping population; and lanes 13-15 correspond to three individuals from the Daloushan population. This image is only an example of the electrophoresis pattern (showing the results of three individual samples from each *Cathaya argyrophylla* population) to visually display the banding characteristics of each population at this marker site. For details on the actual sample size and statistical results used for validity verification for each population, please refer to the specific implementation section of the instruction manual.

[0028] [[ID= This is an agarose gel electrophoresis image of PCR performed using primers amplifying SHS. M represents the DNA Marker. Lanes 1-3 correspond to three individuals from the *Cathaya argyrophylla* population in the Dayaoshan area; lanes 4-6 correspond to three individuals from the Shunhuangshan population; lanes 7-9 correspond to three individuals from the Bamianshan population; lanes 10-12 correspond to three individuals from the Huaping population; and lanes 13-15 correspond to three individuals from the Daloushan population. This image is only an example of the electrophoresis pattern (showing the results of three individual samples from each *Cathaya argyrophylla* population) to visually display the banding characteristics of each population at this marker site. For details on the actual sample size and statistical results used for validity verification for each population, please refer to the specific implementation section of the instruction manual.

[0029] ​ This is an agarose gel electrophoresis image of PCR performed using the primer set for amplifying BMS. M represents the DNA Marker. Lanes 1-3 correspond to three individuals from the *Cathaya argyrophylla* population in the Dayaoshan area; lanes 4-6 correspond to three individuals from the Shunhuangshan population; lanes 7-9 correspond to three individuals from the Bamianshan population; lanes 10-12 correspond to three individuals from the Huaping population; and lanes 13-15 correspond to three individuals from the Daloushan population. This image is only an example of the electrophoresis pattern (showing the results of three individual samples from each *Cathaya argyrophylla* population) to visually display the banding characteristics of each population at this marker site. For details on the actual sample size and statistical results used for validity verification for each population, please refer to the specific implementation section of the instruction manual.

[0030] ​This is an agarose gel electrophoresis image of PCR performed using primers amplifying HP. M represents the DNA Marker. Lanes 1-3 correspond to three individuals from the *Cathaya argyrophylla* population in the Dayaoshan area; lanes 4-6 correspond to three individuals from the Shunhuangshan population; lanes 7-9 correspond to three individuals from the Bamianshan population; lanes 10-12 correspond to three individuals from the Huaping population; and lanes 13-15 correspond to three individuals from the Daloushan population. This image is only an example of the electrophoresis pattern (showing the results of three individual samples from each *Cathaya argyrophylla* population) to visually display the banding characteristics of each population at this marker site. For details on the actual sample size and statistical results used for validity verification for each population, please refer to the implementation section of the instruction manual.

[0031] ​ This is an agarose gel electrophoresis image of PCR performed using the primer set for amplifying DLS. M represents the DNA Marker. Lanes 1-3 correspond to three individuals from the *Cathaya argyrophylla* population in the Dayaoshan area; lanes 4-6 correspond to three individuals from the Shunhuangshan population; lanes 7-9 correspond to three individuals from the Bamianshan population; lanes 10-12 correspond to three individuals from the Huaping population; and lanes 13-15 correspond to three individuals from the Daloushan population. This image is only an example of the electrophoresis pattern (showing the detection results of three individual samples from each *Cathaya argyrophylla* population) to visually display the banding characteristics of each population at this marker site. For details on the actual sample size and statistical results used for validity verification for each population, please refer to the specific implementation section of the instruction manual. Detailed Implementation

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0033] Example 1: Development of molecular markers for identifying endangered Cathaya argyrophylla populations The molecular marker DYS was used to identify the *Cathaya argyrophylla* population in the Dayao Mountains. Its nucleotide sequence is shown in SEQ ID NO.1, and a deletion polymorphism exists from 114bp to 199bp in the sequence shown in SEQ ID NO.1. The molecular marker SHS was used to identify the *Cathaya argyrophylla* population in the Shunhuang Mountains. Its nucleotide sequence is shown in SEQ ID NO.2, and a deletion polymorphism exists from 243bp to 311bp in the sequence shown in SEQ ID NO.2. The molecular marker BMS was used to identify the *Cathaya argyrophylla* population in the Bamian Mountains. Its nucleotide sequence is shown in SEQ ID NO.3, and a deletion polymorphism exists from 220bp to 326bp in the sequence shown in SEQ ID NO.3. The molecular marker HP was used to identify the *Cathaya argyrophylla* population in the Huaping Mountains. Its nucleotide sequence is shown in SEQ ID NO.4, and a deletion polymorphism exists from 117bp to 243bp in the sequence shown in SEQ ID NO.4. The molecular marker DLS was used to identify the *Cathaya argyrophylla* population in the Dalou Mountains. Its nucleotide sequence is shown in SEQ ID NO.5, and a deletion polymorphism exists from 141bp to 199bp in the sequence shown in SEQ ID NO.5.

[0034] SEQ ID NO.1: TCTTATCACCTCACTTCGAGCACTGAAGATAAGGAAGCGCTCATTTTCCTACCTTCCTGAAGCGTGAATTGGCCTGCCTTACTATAGATTTATTCTCGGCAGAGAATATAAGG ​ ​ The underlined nucleotide sequence in the sequence AAGCGTAGAAGCGTGAATTGGGCAGAAGAGAGCGTGAATTGGGCAGATGGCATTCAGGAGTGGGAGATGGAAAAAAGGAAAGATTGAAACAAAAAACATGGCAAATTTAAGTTGTGGGGAACGTGGAAGTCCCTACTCAAATA, shows a unique deletion.

[0035] SEQ ID NO.2: TTGGTGCCCAGTACCTCTTCAGGCCAGCCCATCAAGAGGGAACTGGTTAGTGCCCAGCAAGATAGGCCATCAGGCAAGACTTCAAAGCCAGAAAGAGAGGCAAGAGGGAACTGGTTAGTGCCCAGCAAGAGCAAGATAGGCAAGAGGGAACTGGTTAGTGCCGAGCAAGAGGGAACTGGTTAGTGCCCAGCAAGCTGGTTAGTGCCCAGCAAGATAGGCCATTCTTTCTTTTCTTTCTCCGC ​ ​ The underlined nucleotide sequence in SEQ ID NO.2 of the Cathaya argyrophylla Shunhuangshan population has a unique deletion.

[0036] SEQ ID NO.3: CCAGGAACCTTTCTCCGTTGTAACGACTGGTCTTCTTCTCCATCCATTGTCCAGAGTGGCCAGAGGATCATGAATAGAAAGAGCGAAAGAAAAAGCATGCATAAAAAGGTGGGGTGATAGTGAGACCATTTATTCATTTATTGCTATTTATCGCTATTGAGTAGAGTAAAGCTATCTTTTCCTTTTCATTCACGGGGGTGCACAACTAACTCAACTAA G ​ ​ The nucleotide sequence shown underlined in SEQ ID NO.3 of the *Cathaya argyrophylla* population contains a unique deletion.

[0037] SEQ ID NO.4: AATAGAATATAAGGGGTACATGTCAGCTGCCATTGATTCAGCAAGGAATCGTATGGTAGGCATGCTATGAACCCTTACTGCTTTGCCTTATGAATTATTCATGACTGGATTCGAGA ​ ​ ​ The underlined nucleotide sequence in the sequence shown in SEQ ID NO.4 of the Yinshanhuaping population has a unique deletion.

[0038] SEQ ID NO.5: GGCAGATTCATTATTGTTAAGCAGTAAGGGAGTTCTATCTAGATAGGGCTGGAGAAAAAATCTCGGGCTGGACTCCATCAAGTGGATATTAACTGCAAGAAGGAAGTTTAACCATCCTTCTTAGGAAGAATAAGGAACAT ​ ​ The underlined nucleotide sequence in SEQ ID NO.5 of the *Cathaya argyrophylla* Daloushan population contains a unique deletion.

[0039] Example 2: Design of primer sets for identifying molecular markers for the endangered plant Cathaya argyrophylla population This invention further designs specific primer sets for amplifying molecular markers DYS, SHS, BMS, HP, and DLS.

[0040] The primer set for amplifying DYS consists of forward primer DYS-F and reverse primer DYS-R. The nucleotide sequences of forward primer DYS-F and reverse primer DYS-R are shown in SEQ ID NO.6 and SEQ ID NO.7, respectively. DYS-F: 5'TCTTATCACCTCACTTCGAGCAC-3', SEQ ID NO.6; DYS-R: 5'TATTTGAGTAGGGACTTCCACGTT-3', SEQ ID NO.7.

[0041] The primer set for amplifying SHS consists of forward primer SHS-F and reverse primer SHS-R. The nucleotide sequences of forward primer SHS-F and reverse primer SHS-R are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively. SHS-F: 5'TTGGTGCCCAGTACCTC-3', SEQ ID NO.8; SHS-R: 5'CTTTCCATTCTTGCTAGCCTT-3', SEQ ID NO.9.

[0042] The primer set for amplifying BMS consists of forward primer BMS-F and reverse primer BMS-R. The nucleotide sequences of forward primer BMS-F and reverse primer BMS-R are shown in SEQ ID NO.10 and SEQ ID NO.11, respectively. BMS-F: 5'CCAGGAACCTTTCTCCGTTG-3', SEQ ID NO.10; BMS-R: 5'ACGGGAACTAATTACTAGCACGAG-3', SEQ ID NO. 11.

[0043] The primer set for amplifying HP consists of forward primer HP-F and reverse primer HP-R. The nucleotide sequences of forward primer HP-F and reverse primer HP-R are shown in SEQ ID NO.12 and SEQ ID NO.13, respectively. HP-F: 5'AATAGAATATAAGGGGTACATGTCAGC-3', SEQ ID NO.12; HP-R: 5'AGTCCTGATTAACCCGAAAACGA-3', SEQ ID NO. 13.

[0044] The primer set for amplifying DLS consists of forward primer DLS-F and reverse primer DLS-R. The nucleotide sequences of forward primer DLS-F and reverse primer DLS-R are shown in SEQ ID NO.14 and SEQ ID NO.15, respectively. DLS-F: 5'GGCAGATTCATTATTGTTAAGCAGT-3', SEQ ID NO.14; DLS-R: 5'AGGTCTAGATATTAGTACCAGC-3', SEQ ID NO. 15.

[0045] Example 3: Validation and Application of Molecular Markers Genomic DNA was extracted from the leaves of *Cathaya argyrophylla* samples. The extracted DNA was amplified by PCR using the primer set described in Example 2 to obtain PCR products. The size of the PCR products was detected by 2 w / v% agarose gel electrophoresis, and the geographical origin of the *Cathaya argyrophylla* samples was determined based on the size of the PCR products. The specific steps are as follows:

[0046] (1) Collecting leaf samples of Cathaya argyrophylla: Leaf samples were collected from five natural populations of Cathaya argyrophylla as test samples. Specifically, leaf samples of 16 individual trees were collected from the Daloushan population, leaf samples of 10 individual trees were collected from the Huaping population, leaf samples of 10 individual trees were collected from the Bamianshan population, leaf samples of 10 individual trees were collected from the Shunhuangshan population, and leaf samples of 10 individual trees were collected from the Dayaoshan population.

[0047] (2) Genomic DNA extraction: Total DNA was extracted from the sample to be tested using a plant sample DNA extraction kit.

[0048] (3) PCR amplification: The extracted DNA was amplified by PCR using the primer sets for amplifying DYS, SHS, BMS, HP, or DLS as described in Example 2, respectively, to obtain PCR amplification products.

[0049] Each 10 μL PCR amplification reaction mixture includes: 1 μL DNA template, 0.4 μL each of 10 μmol / L forward and reverse primers, 0.2 μL dNTP Mix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 5 μL 2×Phanta Max Buffer, and nuclease-free water to make up the difference. The concentrations of deoxyadenosine triphosphate, deoxythymidine triphosphate, deoxyguanosine triphosphate, and deoxycytidine triphosphate in the dNTP Mix are all 10 mM.

[0050] The reaction conditions for PCR amplification were: (1) 95℃ pre-denaturation for 3 min; (2) 95℃ denaturation for 15 s, 53℃~56℃ annealing for 15 s, 72℃ extension for 30 s; 30 cycles; (3) 72℃ extension for 5 min.

[0051] Specifically, when using primers for amplifying DYS, the annealing temperature for the PCR amplification reaction is 56℃; when using primers for amplifying SHS, the annealing temperature for the PCR amplification reaction is 54℃; when using primers for amplifying BMS, the annealing temperature for the PCR amplification reaction is 56℃; when using primers for amplifying HP, the annealing temperature for the PCR amplification reaction is 54℃; and when using primers for amplifying DLS, the annealing temperature for the PCR amplification reaction is 53℃.

[0052] (4) Detection of amplification products: The amplification products were detected by 2w / v% agarose gel electrophoresis. The geographical origin of the Cathaya argyrophylla sample to be tested was determined according to the following judgment rules.

[0053] The criteria for judgment are: When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the sample being tested is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the sample to be tested is from the *Cathaya argyrophylla* population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the sample to be tested is a population of *Cathaya argyrophylla*; or When using primers for amplifying HP, if a 204 bp band is displayed on the agarose gel, the sample being tested is a *Cathaya argyrophylla* population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the sample to be tested is a Cathaya argyrophylla population from the Dalou Mountain area.

[0054] (5) The test results are shown in Table 1 and ​ As shown.

[0055] Table 1 Test Results From Table 1, ​ It can be seen that: when using the primer set for amplifying DYS, the PCR product size of the Dayaoshan population sample was 256 bp, while the PCR product size of other Cathaya argyrophylla population samples was 342 bp; when using the primer set for amplifying SHS, the PCR product size of the Shunhuangshan population sample was 299 bp, while the PCR product size of other Cathaya argyrophylla population samples was 368 bp; when using the primer set for amplifying BMS, the PCR product size of the Bamianshan population sample was 350 bp, while the PCR product size of other Cathaya argyrophylla population samples was 457 bp. When using the primer set for amplifying HP, the PCR product size of the Huaping population sample was 204 bp, while the PCR product size of other Cathaya argyrophylla population samples was 331 bp; when using the primer set for amplifying DLS, the PCR product size of the Daloushan population sample was 263 bp, while the PCR product size of other Cathaya argyrophylla population samples was 322 bp. The validation results based on 56 single-plant samples show that the identification accuracy of the 5 pairs of specific primer sets all reached 100%, proving that the molecular markers provided by this invention have high effectiveness and reliability.

[0056] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0057] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A primer set for identifying molecular markers of the endangered plant *Cathaya argyrophylla*, characterized in that... The molecular marker is DYS, SHS, BMS, HP, or DLS; The nucleotide sequence of the molecular marker DYS is shown in SEQ ID NO.

1. Deletion polymorphism exists in the sequence from 114bp to 199bp. The nucleotide sequence of the molecular marker SHS is shown in SEQ ID NO.

2. Deletion polymorphism exists in the sequence from 243bp to 311bp. The nucleotide sequence of the molecular marker BMS is shown in SEQ ID NO.

3. A deletion polymorphism exists in the sequence from 220bp to 326bp. The nucleotide sequence of the molecular marker HP is shown in SEQ ID NO.

4. Deletion polymorphism exists in the sequence from 117bp to 243bp. The nucleotide sequence of the molecular marker DLS is shown in SEQ ID NO.

5. Deletion polymorphism exists in the sequence from 141bp to 199bp. Molecular marker DYS was used to identify the Cathaya argyrophylla population in Dayaoshan, molecular marker SHS was used to identify the Cathaya argyrophylla population in Shunhuangshan, molecular marker BMS was used to identify the Cathaya argyrophylla population in Bamianshan, molecular marker HP was used to identify the Cathaya argyrophylla population in Huaping, and molecular marker DLS was used to identify the Cathaya argyrophylla population in Daloushan. The primer set is a primer set for amplifying molecular markers DYS, SHS, BMS, HP, or DLS. The primer set for amplifying DYS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.6 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.7; The primer set for amplifying SHS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.8 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.9; The primer set for amplifying BMS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.10 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.11; The primer set for amplifying HP consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.13; The primer set for amplifying DLS consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO.14 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

15.

2. The application of the primer set for identifying molecular markers of endangered Cathaya argyrophylla populations as described in claim 1 in the preparation of a kit for identifying the origin of Cathaya argyrophylla populations, characterized in that, The amplification products of the primer set were detected by agarose gel electrophoresis, and the origin of the Cathaya argyrophylla population was identified based on the band size. When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

3. The application of the primer set of claim 1, which identifies molecular markers for identifying endangered Cathaya argyrophylla populations, in identifying the origin of Cathaya argyrophylla populations, is characterized in that... The amplification products of the primer set were detected by agarose gel electrophoresis, and the origin of the Cathaya argyrophylla population was identified based on the band size. When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

4. The application of the primer set of claim 1, which identifies molecular markers for identifying endangered Cathaya argyrophylla populations, in distinguishing Cathaya argyrophylla populations, characterized in that, The distinction was made based on the origin of Cathaya argyrophylla; the amplification products of the primer set were detected by agarose gel electrophoresis, and the Cathaya argyrophylla populations were distinguished based on the band size. When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

5. The application of the primer set for identifying molecular markers of the endangered plant *Cathaya argyrophylla* population as described in claim 1 in tracing the origin of *Cathaya argyrophylla*, characterized in that... The amplification products of the primer set were detected by agarose gel electrophoresis, and the origin of Cathaya argyrophylla was traced based on the band size. When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

6. A method for tracing the origin of Cathaya argyrophylla, characterized in that, Includes the following steps: DNA was extracted from the Cathaya argyrophylla sample to be tested; Using the DNA of the Cathaya argyrophylla sample to be tested as a template, the template is amplified by PCR using any one of the primer sets for amplifying DYS, SHS, BMS, HP, or DLS in claim 1 to obtain PCR products. The PCR products were analyzed by agarose gel electrophoresis. The population type of the tested Cathaya argyrophylla samples was determined according to the following rules: When using primers to amplify DYS, if a 256bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population in the Dayao Mountains; or When using primers to amplify SHS, if a 299bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla Shunhuangshan population; or When using primer sets to amplify BMS, if a 350bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is from the Cathaya argyrophylla population; or When using primers to amplify HP, if a 204 bp band is displayed on the agarose gel, the tested Cathaya argyrophylla sample is a Cathaya argyrophylla meadow population; or When using primer sets to amplify DLS, if a 263bp band is displayed on the agarose gel, the Cathaya argyrophylla sample to be tested is from the Cathaya argyrophylla Daloushan population.

7. The method for tracing the origin of Cathaya argyrophylla according to claim 6, characterized in that, Each 10 μL PCR amplification reaction system includes: 1 μL DNA template, 0.4 μL each of 10 μmol / L forward and reverse primers, 0.2 μL dNTP Mix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 5 μL 2×Phanta Max Buffer, and nuclease-free water to make up the difference.

8. The method for tracing the origin of Cathaya argyrophylla according to claim 6, characterized in that, The reaction conditions for the PCR amplification were: (1) 95℃ pre-denaturation for 3 min; (2) 95℃ denaturation for 15 s, 53℃~56℃ annealing for 15 s, 72℃ extension for 30 s; 30 cycles; (3) 72℃ extension for 5 min.

Citation Information

Patent Citations

  • Kit for real-time fluorescent PCR detection of cathaya argyrophylla and its products and application thereof

    CN111041121A

  • Methods for identifying microbial strains having enhanced plant colonization efficiency

    WO2020163027A1