Issuanon / PRAX-222 for treatment of SCN2A-related disorders

Abstract

Provided are methods of treating a subject having an SCN2A-related disorder, such as developmental and epileptic encephalopathy (DEE), comprising administering to the subject an oligomeric compound. Also provided are methods of reducing the frequency of epileptic seizures experienced by a subject suffering from an SCN2A-related condition, the method comprising administering to the subject an oligomeric compound.

Description

Related applications

[0001] This application claims priority to the following U.S. provisional patent applications: U.S. Provisional Patent Application No. 63 / 689297, filed August 30, 2024; U.S. Provisional Patent Application No. 63 / 686359, filed August 23, 2024; U.S. Provisional Patent Application No. 63 / 672118, filed July 16, 2024; U.S. Provisional Patent Application No. 63 / 651681, filed May 24, 2024; U.S. Provisional Patent Application No. 63 / 604103, filed November 29, 2023; U.S. Provisional Patent Application No. 63 / 542017, filed October 2, 2023; and U.S. Provisional Patent Application No. 63 / 538713, filed September 15, 2023. The entire contents of each of the foregoing applications are hereby incorporated herein by reference. Background Technology

[0002] The human gene SCN2A encodes the human SCN2A protein, which is the α-1 subunit of the voltage-gated sodium channel NaV1.2. Mutations in SCN2A are associated with a variety of neurodevelopmental and intellectual disorders and conditions, such as developmental and epileptic encephalopathy (DEE), including early-onset epileptic encephalopathy (EE), late-onset epileptic encephalopathy, and benign familial neonatal-infant seizures (BFNIS). Mutations in SCN2A are also associated with intellectual disability (ID) and / or autism spectrum disorder (ASD), with or without seizures (Wolff, M. et al., 2019). Epilepsy 60, S59-S67; Sanders, S. et al., 2018, Trends in Neurosciences 41, 442-456; Wolff, M. et al., 2017, Brain 140, 1316-1336). DEE encompasses a wide range of conditions, including neonatal and early infantile DEE, such as Ohtahara Syndrome and epilepsy of infancy with migratory focal seizures (EIMFS); infantile and childhood DEE, such as West Syndrome and Lennon-Gastaut Syndrome; Dravet syndrome; idiopathic / genetic generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic unstable epilepsy (MAE); migratory partial epilepsy of infancy (MMPSI); and familial hemiplegic migraine, with or without epilepsy (Wolff, M. et al., 2019; Harkin, LA et al., 2007). "brain"130, 843-852; Escayg, A. et al., 2010, "epilepsy" 51, 1650-1658; Miller IO et al., November 29, 2007 [Updated April 18, 2019]. In: Adam MP, Ardinger HH, Pagon RA et al., edited, GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020. Available at www.ncbi.nlm.nih.gov / books / NBK1318 / ).

[0003] Symptoms and signs associated with DEE include seizures, hypotonia, sensory integration dysfunction, delayed and impaired motor development, intellectual and cognitive impairment, motor and balance disorders, visual impairment, language and speech delay, gastrointestinal disorders, delayed neurodevelopment, sleep problems, and sudden epileptic death. Seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, prolonged seizures (usually lasting longer than 10 minutes), and frequent seizures (e.g., convulsive, myoclonic, absence, focal, drowsy, and tonic seizures) (Guzzetta, F., 2011). "epilepsy" 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006, Wolff et al., 2019). Symptoms and signs associated with ID and ASD include delayed motor development, delayed social and language milestones, repetitive movements, uncoordinated oral movements, gastrointestinal disorders, sleep problems, and seizures (Wolff et al., 2019).

[0004] Currently, there is a lack of acceptable treatment options for DEE such as EE, late-onset EE, and BFNIS, as well as for ID and ASD. Therefore, the purpose of this article is to provide methods for treating these diseases and conditions. Summary of the Invention

[0005] In one aspect, this document discloses a method for reducing the frequency of seizures experienced by subjects with SCN2A-related conditions, the method comprising administering an effective amount of an oligomeric compound to the subject, wherein: the SCN2A-related conditions are caused by a gain-of-function mutation in the SCN2A gene; and the oligomeric compound comprises a 6-10-4 sequence having the sequence CCACGACATATTTTTCTACA (SEQ ID NO: 3) from 5' to 3'. MOE interstitial bodies; wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside; wherein the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7 and 17-18 are phosphodiester internucleotide bonds, and the internucleotide bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19 and 19-20 are thiophosphate internucleotide bonds; and each cytosine is 5-methylcytosine.

[0006] In some embodiments, the oligomeric compound is administered in doses of about 0.1 mg to about 20 mg. In some embodiments, the oligomeric compound is administered in doses of about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, or about 20 mg. In some embodiments, the oligomeric compound is administered at a dose of about 0.5 mg, about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 8 mg, about 12 mg, or about 15 mg. In some embodiments, the oligomeric compound is administered at a dose of about 1 mg. In some embodiments, the oligomeric compound is administered at a dose of about 8 mg.

[0007] In some embodiments, the oligomeric compound is administered at a dose of about 0.5 mg to about 8 mg, such as about 0.5 mg, about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, or about 8 mg. In some embodiments, the oligomeric compound is administered at a dose of about 0.5 mg to about 8 mg, such as about 0.5 mg, about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, or about 8 mg, every 2 to 6 weeks, such as every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, or every 6 weeks. The intervals between administrations may be approximate and may be changed by the clinician based on medical judgment and / or clinical indications, such as patient travel, availability of medical personnel and medications, disease, or adverse events in the patient.

[0008] In some embodiments, the oligomeric compound is administered at a total dose of about 15 mg to about 30 mg over about 20-25 weeks, for example, at a total dose of about 15 mg, about 20 mg, about 22.5 mg, about 25 mg, or about 30 mg over 20, 21, 22, 23, 24, or 25 weeks. In some embodiments, the oligomeric compound is administered at a total dose of about 22.5 mg over 23 weeks.

[0009] In some embodiments, the oligomeric compound is applied once a month. In other embodiments, the oligomeric compound is applied more than once a month. In other embodiments, the oligomeric compound is applied every two months, every three months, every four months, every five months, or every six months, or once a year.

[0010] In some embodiments, the epileptic seizure is selected from the group consisting of: focal motor seizures, tonic seizures, generalized tonic-clonic seizures, and myoclonic seizures.

[0011] In some embodiments, administration of the oligomer compound resulted in a reduction in the average number of daily seizures experienced by the subject over a 28-day period compared to the average number of seizures experienced by the subject prior to administration of the oligomer compound.

[0012] In some embodiments, the administration of the oligomer reduces the number of seizures experienced by the subject over a 28-day period by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the number of seizures experienced by the subject prior to administration of the oligomer.

[0013] In one aspect, this document discloses a method for treating a subject suffering from an SCN2A-related condition, the method comprising administering an oligomeric compound to the subject at a dose of about 0.1 mg to about 20 mg, wherein: the SCN2A-related condition is caused by a gain-of-function mutation in the SCN2A gene; and the oligomeric compound comprises a 6-10-4 sequence having the sequence (from 5' to 3') of CCACGACATATTTTTCTACA (SEQ ID NO: 3). MOE interstitial bodies; each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside; the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7 and 17-18 are phosphodiester internucleotide bonds, and the internucleotide bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19 and 19-20 are thiophosphate internucleotide bonds; and each cytosine is 5-methylcytosine.

[0014] In some embodiments, the oligomeric compound is administered at doses of about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, or about 20 mg. In some embodiments, the oligomeric compound is administered at doses of about 0.5 mg, about 1 mg, about 1.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 8 mg, about 12 mg, or about 15 mg. In some embodiments, the oligomeric compound is administered at a dose of about 1 mg. In some embodiments, the oligomeric compound is administered at a dose of about 8 mg.

[0015] In some embodiments, the oligomeric compound is applied about once a month. In other embodiments, the oligomeric compound is applied more frequently than about once a month. In other embodiments, the oligomeric compound is applied about once every two months, three months, four months, five months, or six months, or once a year.

[0016] In some embodiments, the administration of the oligomeric compound reduces the frequency of seizures experienced by the subject compared to the frequency of seizures experienced by the subject prior to administration of the oligomeric compound.

[0017] In some embodiments, administration of the oligomer compound resulted in a reduction in the average daily number of seizures experienced by the subject over a 28-day period compared to the average daily number of seizures experienced by the subject before administration of the oligomer compound.

[0018] In some embodiments, the administration of the oligomer reduces the number of seizures experienced by the subject over a 28-day period by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or at least about 85% compared to the number of seizures experienced by the subject prior to administration of the oligomer.

[0019] In some embodiments, the administration of the oligomer compound increased the number of seizure-free days experienced by the subject compared to the number of seizure-free days experienced by the subject prior to administration of the oligomer compound.

[0020] In some embodiments, the administration of the oligomer compound increases the number of seizure-free days experienced by the subject over the same period compared to the number of seizure-free days experienced by the subject over a period of time prior to the administration of the oligomer compound.

[0021] In some embodiments, the administration of the oligomer compound increases the percentage of seizure-free days experienced by the subject in each 28-day period compared to the percentage of seizure-free days experienced by the subject in each 28-day period prior to the administration of the oligomer compound.

[0022] In some embodiments, the epileptic seizure is selected from the group consisting of: focal motor seizures, tonic seizures, generalized tonic-clonic seizures, and myoclonic seizures.

[0023] In some embodiments, the subject is a human being. In some embodiments, the subject is between 2 and 18 years of age. In some embodiments, the subject is between 0 and 24 months of age. In some embodiments, the subject is a newborn. In some embodiments, the newborn is a preterm newborn. In some embodiments, the newborn has low birth weight, is preterm, or is not preterm.

[0024] In some embodiments, SCN2A-related disorders are SCN2A developmental and epileptic encephalopathy (SCN2A DEE). In some embodiments, SCN2A-related disorders are early epileptic encephalopathy (EE).

[0025] In some embodiments, gain-of-function mutations in the SCN2A gene are selected from the group consisting of: L210Q, A263V, E430A, R1882Q, G879R, Q1479H, V423L, G1593R, K1502N, V1601L, G211D, S1780I, D343H, and A1329D. In some embodiments, the gain-of-function mutation is A1329D.

[0026] In some embodiments, the oligomeric compound comprises a modified oligonucleotide represented by the following chemical symbol: mCesmCeoAeomCeoGeoAeomCdsAdsTdsAdsTdsTdsTdsTdsTdsm CdsTeoAesmCesAe (SEQ ID NO:3), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphodiester nucleoside internucleotide bond.

[0027] In some embodiments, the oligomeric compound is a modified oligonucleotide represented by the following chemical structure: (SEQ ID NO: 3) or its salt.

[0028] In some embodiments, the modified oligonucleotide is a sodium or potassium salt. In some embodiments, the modified oligonucleotide is a sodium salt.

[0029] In some embodiments, the modified oligonucleotide is represented by the following chemical structure: (SEQ ID NO: 3).

[0030] In some embodiments, the oligomeric compound is administered as part of a pharmaceutical composition comprising the oligomeric compound and a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS). In some embodiments, the pharmaceutically acceptable diluent is aCSF.

[0031] In some embodiments, an oligomeric compound is administered intrathecally. Attached Figure Description

[0032] Figure 1 This is a schematic diagram illustrating the administration of medication to subjects in a clinical trial.

[0033] Figure 2 It is a bar graph showing the median change in seizure frequency relative to 28-day baseline after 3 doses.

[0034] Figure 3 It is a bar chart showing the percentage of seizure-free days for each patient in each dosing period after 3 doses, calculated as the number of seizures in the days between dosings.

[0035] Figure 4 Small figure A is a box plot, which shows the daily seizure frequency of subject 2001 after 3 doses, divided by the dosing period (28 days).

[0036] Figure 4 Small figure B is a box plot, which shows the daily seizure frequency of subject 2002 after 3 doses, divided by the dosing period (28 days).

[0037] Figure 4 The small figure C is a box plot, which shows the daily seizure frequency of subject 2003 after 3 doses, divided by the dosing period (28 days).

[0038] Figure 4The small figure D is a box plot, which shows the daily seizure frequency of subject 2004 after 3 doses, divided by the dosing period (28 days).

[0039] Figure 5 Small figure A is a graph showing the daily seizure frequency of subject 2001 during each dosing period after 3 doses.

[0040] Figure 5 Small Figure B is a graph showing the daily seizure frequency of subject 2002 during each dosing period after 3 doses.

[0041] Figure 5 Small figure C is a graph showing the daily seizure frequency of subject 2003 during each dosing period after 3 doses.

[0042] Figure 5 Small figure D is a graph showing the daily seizure frequency of subject 2004 during each dosing period after 3 doses.

[0043] Figure 6 Small graph A is a bar chart showing the mean and median changes in seizure frequency relative to baseline for the four subjects. The results represent the overall percentage reduction relative to baseline observed in the four subjects over four 28-day time periods.

[0044] Figure 6 Small plot B is a bar chart showing the percentage change in the mean and median of seizure-free days relative to baseline for the four subjects. The results represent the overall relative percentage increase in the proportion of seizure-free days for the four subjects.

[0045] Figure 7 Small figure A shows a representative aEEG trace in the subject, which shows a typical zigzag pattern similar to the EEG state in the first week.

[0046] Figure 7 Small figure B shows a representative aEEG trace in the subjects, showing a reduction in seizures after several loading doses of phenytoin (arrow) in the third week.

[0047] Figure 7 Small figure C shows a representative aEEG trace, indicating that the reduction in seizures is unsustainable because the state pattern recurs even at phenytoin levels >40 μg / mL. The seizures are subclinical or motor seizures.

[0048] Figure 8 Figure A shows a side view and an intracellular view of the 3D structure of Nav1.2, highlighting the transmembrane segments S4 and S5 (S4-5) in domain III. DIIIThe A1329 residue is located in the intracellular linker between the cells. It also indicates four domains (DI-DIV), an inactivation gate, and a β2 subunit.

[0049] Figure 8 Small Figure B shows S4-5 before and after computer-simulated mutagenesis. DIII Enlarged view of the region (top, WT; bottom, A1329D). The D1329-F1489 interaction may affect the binding of the IFM inactivation motif to its receptor pocket, resulting in inactivation delay and persistent current.

[0050] Figure 9 Small figure A shows the sodium current (I Na Density-voltage relationship (illustrated voltage scheme). Representative I Na The trace is shown on the left.

[0051] Figure 9 Small figure B shows the continuous inward movement of I. Na - Voltage relationship. Representative I caused by -10 mV depolarization. Na The trace is shown on the left.

[0052] Figure 9 The small figure C shows the voltage dependence of activation.

[0053] Figure 9 The small figure D shows the voltage dependence of deactivation.

[0054] Figure 9 The small figure E shows I Na The time-dependent inactivation process on membrane potential. Representative WT and A1329D INa traces induced by -25 mV and -5 mV voltages are shown on the left.

[0055] Figure 9 The small figure F shows the input-output relationship of the WT and A1329D variants.

[0056] Figure 10 Inset A shows the patient's clinical course, including the high-dose SCB and the introduction of compound 1. A related decrease in seizure frequency is shown (bottom).

[0057] Figure 10 Small figure B is a bar graph showing the number of seizures per hour for each drug level of phenytoin (PHT) and carbamazepine (CBZ). A total of seven compounds were administered at one intrathecal dose (30.5 mg total dose).

[0058] Figure 10Small figure C shows the aEEG trace 1 day before the first administration of compound 1, which shows the peak seizure frequency ( Status epilepticus ).

[0059] Figure 10 Small figure D shows the aEEG trace 1 week after the first administration of compound 1.

[0060] Figure 10 Small figure E shows the aEEG trace 7 weeks after the first administration of compound 1.

[0061] Figure 10 Small figure F shows the aEEG trace 10 weeks after the first administration of compound 1. Detailed Implementation

[0062] definition As used in this article, the terms “about” and “approximately” refer to values ​​that are within 10% higher or lower than the described value.

[0063] As used in this article, the term "SCN2A" refers to Na v 1.2, namely the α subunit of a voltage-gated sodium channel expressed in the brain, having an amino acid sequence from any vertebrate or mammalian source, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise stated. In some embodiments, SCN2A may include one or more mutations that cause neurological disorders such as epileptic encephalitis. SCN2A is encoded by the SCN2A gene. In some embodiments, SCN2A is the human SCN2A as represented by SEQ ID NO: 1 as described herein.

[0064] Exemplary accession numbers for human SCN2A mRNA transcripts and human SCN2A protein are detailed below:

[0065] As used herein, the term "2'-deoxynucleoside" refers to a nucleoside comprising a 2'-H(H)deoxyfuranosyl sugar moiety. In some embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and comprises a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl conformation found in naturally occurring deoxyribonucleic acid (DNA). In some embodiments, the 2'-deoxynucleoside may comprise modified nucleotides or may comprise RNA nucleotides (uracil).

[0066] As used herein, the term "2'-MOE" refers to the 2'-OCH2CH2OCH3 group that replaces the 2'-OH group of the furanyl sugar moiety. "2'-MOE sugar moiety" means a sugar moiety in which the 2'-OH group of the furanyl sugar moiety is replaced by a 2'-OCH2CH2OCH3 group. Unless otherwise indicated, the 2'-MOE sugar moiety is β-D-ribosyl. "MOE" means O-methoxyethyl.

[0067] As used herein, the term "2'-MOE nucleoside" refers to a nucleoside containing the 2'-MOE sugar moiety.

[0068] As used herein, the term "5-methylcytosine" refers to cytosine modified with a methyl group attached at the 5-position. 5-methylcytosine is a modified nucleobase.

[0069] As used herein, the term “improvement” when referring to treatment means an improvement in at least one symptom or sign relative to the same symptom or sign in the absence of treatment. In some embodiments, improvement is a reduction in the severity or frequency of a symptom or sign, or a delay or slowing of the progression of the severity or frequency of a symptom or sign. In some embodiments, a symptom or sign is seizures, hypotonia, sensory integration dysfunction, motor dysfunction, intellectual and cognitive dysfunction, motor and balance dysfunction, visual dysfunction, language and speech developmental delay, neurodevelopmental delay, sudden epileptic death, motor developmental delay, delay in social and language milestones, repetitive movements, uncoordinated oral movements, gastrointestinal disorders (e.g., gastroesophageal reflux, diarrhea, constipation, motility disorders, etc.), or sleep problems. In some embodiments, a seizure is a focal, clonic, tonic, or generalized tonic-clonic seizure, a prolonged seizure (typically lasting more than 10 minutes), or a frequent seizure (e.g., convulsive, myoclonic, absence, focal, sluggish, or tonic seizure). In some embodiments, the seizure is a focal motor seizure, a tonic seizure, a generalized tonic-clonic seizure, or a myoclonic seizure.

[0070] As used herein, the term "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. The term "artificial cerebrospinal fluid" or "aCSF" refers to a fluid that has been prepared or manufactured to possess some of the properties of cerebrospinal fluid.

[0071] As used herein, the term "effective amount" for oligomeric compounds refers to an amount of oligomeric compound sufficient to achieve a beneficial or desired outcome (including clinical outcomes) when administered to a subject (including a human). For example, in the case of treating a subject with an SCN2A-related condition, such as an SCN2A-related condition caused by a gain-of-function mutation, an "effective amount" is an amount of oligomeric compound that reduces the number of seizures experienced by the subject compared to the number of seizures experienced by the subject prior to administration of the oligomeric compound. In some embodiments, when administered to a subject with an SCN2A-related condition, such as an SCN2A-related condition caused by a gain-of-function mutation, an "effective amount" of the oligomeric compound is sufficient to achieve a therapeutic response, such as a reduction in one or more symptoms compared to a response obtained without administration of the oligomeric compound.

[0072] As used herein, the term "interstitial body" refers to a modified oligonucleotide comprising an inner region having a plurality of nucleotides supporting RNase H cleavage, situated between an outer region having one or more nucleotides, wherein the nucleotides constituting the inner region are chemically distinct from the one or more nucleotides constituting the outer region. The inner region may be referred to as a "interstitial body," and the outer region may be referred to as a "wing" or "wing segment." In some embodiments, the inner region is a deoxygenated region. The location of the inner region or interstitial body refers to the sequence of the nucleotides in the inner region, and is counted starting from the 5'-end of the inner region. Unless otherwise indicated, "interstitial body" refers to a glycosylation motif. In some embodiments, each nucleotide in the interstitial body is a 2'-β-D-deoxynucleotide. In some embodiments, the interstitial body contains a 2'-substituted nucleotide at positions 1, 2, 3, 4, or 5, and the remaining nucleotides in the interstitial body are 2'-β-D-deoxynucleotides. As used herein, the term "MOE interstitial body" refers to an interstitial body having an interstitial space containing a 2'-β-D-deoxynucleoside and a wing containing a 2'-MOE nucleoside. As used herein, the term "mixed-wing interstitial body" refers to an interstitial body having wings containing modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, interstitial bodies may contain one or more modified nucleoside interbonds and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified interstitial body pattern.

[0073] As used herein, the term "nucleoside internucleotide" refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, the term "modified nucleoside internucleotide" refers to any nucleoside internucleotide other than a phosphodiester nucleoside internucleotide. The terms "phosphothiophosphate nucleoside internucleotide" or "PS nucleoside internucleotide" refer to a modified nucleoside internucleotide in which one of the non-bridging oxygen atoms of the phosphodiester nucleoside internucleotide is replaced by a sulfur atom.

[0074] As used herein, the term "linker-nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to the conjugate moiety. Linker-nucleosides reside within the conjugate linker of the oligomer. Linker-nucleosides are not considered part of the oligonucleotide moiety of the oligomer, even if they are adjacent to the oligonucleotide.

[0075] As used herein, the term "nucleobase" refers to an unmodified or modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the sequence of consecutive nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or nucleoside inter-bond modifications.

[0076] As used herein, the term "nucleoside" refers to a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently either unmodified or modified. As used herein, the term "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abase-free nucleosides, which lack a nucleobase. The term "linked nucleosides" refers to nucleosides linked in a continuous sequence (i.e., no additional nucleosides are present between the linked nucleosides). Oligonucleotides may be described herein as sequences comprising linked oligonucleotides.

[0077] As used herein, the term "oligomeric compound" refers to an oligonucleotide and optionally one or more additional features, such as conjugation groups or terminal groups. An oligomeric compound may be paired with or unpaired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-chain oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed from two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-chain oligomeric compound."

[0078] As used herein, the term "oligonucleotide" refers to a chain of linked nucleosides connected by nucleotide bonds, wherein each nucleoside and nucleotide bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, the term "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or nucleotide bond is modified. As used herein, the term "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or nucleotide modifications.

[0079] As used herein, the term "pharmaceutically acceptable carrier or diluent" refers to any substance suitable for administration to a subject. Certain such carriers enable pharmaceutical compositions to be formulated, for example, into tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solutions, or sterile artificial cerebrospinal fluid.

[0080] As used herein, the term "pharmaceutically acceptable salt" refers to any physiologically and pharmaceutically acceptable salt of a compound, such as an oligomer. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not confer undesirable toxicological effects.

[0081] As used herein, the term "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.

[0082] As used herein, the term "subject" means any organism to which the oligomeric compounds disclosed herein may be administered, for example, for therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). Subjects may be seeking or potentially needing treatment, require treatment, are currently receiving treatment, will receive treatment in the future, or be persons or animals being cared for by trained professionals for a particular disease or ailment.

[0083] In a particular embodiment, the “subject” is a human subject. In another embodiment, the human subject is a pediatric subject. A pediatric subject is a child under 18 years of age, such as under 17 years of age, under 16 years of age, under 15 years of age, under 14 years of age, under 13 years of age, under 12 years of age, under 11 years of age, under 10 years of age, under 9 years of age, under 8 years of age, under 7 years of age, under 6 years of age, under 5 years of age, under 4 years of age, under 3 years of age, under 2 years of age, under 1 year of age, under 6 months of age, under 3 months of age, or under 1 month of age. In some embodiments, a pediatric subject may be 2-18 years of age, such as 2 years of age, 3 years of age, 4 years of age, 5 years of age, 6 years of age, 7 years of age, 8 years of age, 9 years of age, 10 years of age, 11 years of age, 12 years of age, 13 years of age, 14 years of age, 15 years of age, 16 years of age, 17 years of age, or 18 years of age. In some embodiments, the pediatric subject can be 0-24 months old, such as 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, or 24 months old. In some embodiments, the pediatric subject is a newborn. In other embodiments, the pediatric subject is a premature newborn. In some embodiments, the newborn has low birth weight, is premature, or is not premature.

[0084] As used herein, the term "glycan moiety" refers to an unmodified or modified sugar moiety. As used herein, the term "unmodified sugar moiety" refers to the 2'-OH(H)β-D-ribosyl moiety found in RNA ("unmodified RNA sugar moiety") or the 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA ("unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, an oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, the term "modified sugar moiety" or "modified sugar" refers to a modified furanyl sugar moiety or a sugar substitute.

[0085] As used herein, the term "symptom or sign" refers to any physical characteristic or test result that indicates the presence or extent of a disease or ailment. In some embodiments, the symptom is obvious to the subject or a medical professional examining or testing the subject. In some embodiments, the sign is obvious during invasive diagnostic testing, including but not limited to autopsy. In some embodiments, the sign is obvious on a brain MRI scan.

[0086] As used herein, the term "SCN2A-related disorders" refers to a class of neurogenetic diseases or disorders characterized by functional abnormalities of the SCN2A. SCN2A-related disorders include, for example, epilepsy, pediatric epilepsy, benign familial neonatal / infant seizures, severe early-onset epilepsy, epileptic encephalopathy, early-onset epileptic encephalopathy (i.e., early-onset epileptic encephalopathy), late-onset epileptic encephalopathy, Ōtahara syndrome, infantile spasms syndrome (i.e., West syndrome), Lennox-Gasto syndrome, generalized epilepsy with febrile seizures, infancy migratory partial epilepsy (i.e., infancy epilepsy with migratory focal seizures), infantile spasms, autism spectrum disorders, motor disorders, and drug-resistant epilepsy. In some embodiments, SCN2A-related disorders may be caused by gain-of-function SCN2A mutations. SCN2A-related disorders that may be caused by gain-of-function SCN2A mutations include, for example, Ōtahara syndrome, infancy epilepsy with migratory focal seizures, developmental and epileptic encephalopathy (DEE), including early-onset epileptic encephalopathy (EE). In some embodiments, gain-of-function mutations in SCN2A associated with SCN2A-related conditions include mutations selected from the group consisting of: L210Q, A263V, E430A, R1882Q, G879R, Q1479H, V423L, G1593R, K1502N, V1601L, G211D, S1780I, D343H, and c.3986C>Ap. (A1329D).

[0087] Oligomeric compounds The method disclosed herein comprises administering an oligomeric compound to a subject suffering from SCN2A-related conditions, said oligomeric compound comprising a 6-10-4 sequence having the sequence (from 5' to 3') of CCACGACATATTTTTCTACA (SEQ ID NO: 3). MOE interstitial bodies; wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside; wherein the internucleotide bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7 and 17-18 are phosphodiester internucleotide bonds, and the internucleotide bonds between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19 and 19-20 are thiophosphate internucleotide bonds; and wherein each cytosine is 5-methylcytosine.

[0088] In some embodiments, the oligomeric compound comprises a modified oligonucleotide represented by the following chemical symbols: m C es m C eo Aeo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T eo A es m C es A e (SEQ ID NO: 3), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond.

[0089] In some embodiments, the oligomeric compound is a modified oligonucleotide represented by the following chemical structure: (SEQ ID NO: 3) or its salt.

[0090] The modified oligonucleotide can be a sodium or potassium salt. In one embodiment, the modified oligonucleotide is a sodium salt.

[0091] In some embodiments, the modified oligonucleotide may be represented by the following chemical structure: (SEQ ID NO: 3).

[0092] In some embodiments, the oligomeric compounds disclosed herein may also be referred to herein as "Compound 1" or "elsunursen".

[0093] In the context of this disclosure, the oligomeric compounds of this disclosure may be administered as part of a pharmaceutical composition comprising the oligomeric compound and a pharmaceutically acceptable carrier or diluent. In some embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and the oligomeric compound. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises or consists of the oligomeric compound and sterile water. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises or consists of the oligomeric compound and phosphate-buffered saline (PBS). In some embodiments, the sterile PBS is pharmaceutical grade PBS. In some embodiments, the pharmaceutical composition comprises or consists of the oligomeric compound and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In some embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0094] In some embodiments, the pharmaceutical composition may comprise the oligomeric compound of this disclosure and one or more excipients. In some embodiments, the excipients are selected from water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

[0095] In the context of this disclosure, the oligomeric compound can be administered to a subject by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), intraneural, perineurial, etc.). In some embodiments, the oligomeric compound is administered intrathecally to the subject.

[0096] Treatment methods for SCN2A-related conditions This article discloses a method for reducing the number of seizures experienced by subjects with SCN2A-related conditions caused by gain-of-function mutations in the SCN2A gene, the method comprising administering the disclosed oligomeric compound to the subject.

[0097] This disclosure also provides a method for reducing the frequency of seizures experienced by a subject with SCN2A-related conditions, the method comprising administering to the subject an effective amount of the oligomeric compound of this disclosure. In some embodiments, the term "seizure frequency" refers to the number of seizures experienced by the subject within a given time period, such as one day, one week, 14 days, 28 days, one month, three months, six months, or one year.

[0098] This disclosure also provides a method for reducing the average daily number of seizures experienced by subjects with SCN2A-related conditions, the method comprising administering an effective amount of the oligomeric compound of this disclosure to the subject.

[0099] This disclosure also provides a method for increasing the number of seizure-free days experienced by subjects with SCN2A-related conditions, the method comprising administering an effective amount of the oligomeric compound of this disclosure to the subject.

[0100] This disclosure also provides a method for reducing the seizure burden experienced by a subject with SCN2A-related conditions or by a caregiver of a subject with SCN2A-related conditions, the method comprising administering an effective amount of the oligomeric compound of this disclosure to the subject. In some embodiments, as used herein, the term “seizure burden” encompasses the frequency of seizures, the severity of seizures, and the burden associated with the unpredictability of seizures. For example, in Berg et al., "epilepsy (Open Access) (Epilepsia Open) The burden associated with epileptic seizures was discussed in 2019, 4:293-301, the entire contents of which are hereby incorporated herein by reference.

[0101] In some embodiments, in addition to reducing seizures based on, for example, optimal standard of care, the methods of this disclosure allow for a reduction in seizure frequency relative to baseline based on optimal standard of care. In some embodiments, subjects who received compound 1 in combination with standard of care in the context of this disclosure experienced a greater reduction in the number of seizures, e.g., the average number of seizures per day, compared to subjects who received standard of care but not compound 1. In some embodiments, subjects who received compound 1 in combination with standard of care in the context of this disclosure experienced a greater reduction in seizure frequency compared to subjects who received standard of care but not compound 1. In some embodiments, subjects who received compound 1 in combination with standard of care in the context of this disclosure experienced a greater increase in the number of seizure-free days compared to subjects who received standard of care but not compound 1. In some embodiments, subjects who received compound 1 in combination with standard of care in the context of this disclosure experienced a greater reduction in seizure burden compared to subjects who received standard of care but not compound 1.

[0102] As used herein, the term "standard of care therapy" encompasses any therapy (other than compound 1) that may be used to treat SCN2A-related conditions. In some embodiments, standard of care therapy may comprise one or more sodium channel blocking agents, such as carbamazepine, oxcarbazepine, lamotrigine, valproate, or topiramate.

[0103] This article also discloses a method for treating subjects suffering from SCN2A-related diseases caused by gain-of-function mutations in the SCN2A gene, the method comprising administering the disclosed oligomeric compound to the subject at a dose of about 0.1 mg to about 20 mg.

[0104] The methods disclosed herein can be used to improve one or more symptoms of early-onset DEE, including, for example, seizures; communication limitations, such as language and speech delays; autonomic dysfunction; developmental delays; gastrointestinal abnormalities; motor disorders, such as choreoathetosis, dystonia, and ataxia; anxiety; sensory problems; urinary retention problems; irritability; sleep problems (e.g., inability to fall asleep and inability to stay asleep); and behavioral problems. Seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, prolonged seizures (typically lasting more than 10 minutes), and frequent seizures.

[0105] The methods disclosed herein for treating subjects with SCN2A-related conditions can have a disease-modifying effect on the subjects. The disease-modifying effect may include one or more of the following: a decrease in the frequency of seizures experienced by the subject compared to subjects receiving standard care therapy without receiving compound 1, or compared to untreated subjects; an increase in the number of seizure-free days experienced by the subject; and an increase in the subject's survival rate. In some embodiments, the disease-modifying effect may also include a normalized developmental curve, which includes one or more of the following: an increase in the subject's ability to care for others, engage in social interactions, process and / or manage external stimuli, and grow and / or develop language and / or speech compared to subjects receiving standard care therapy without receiving compound 1, or compared to untreated subjects.

[0106] In some embodiments, the method of this disclosure reduces the number of seizures experienced by the subject compared to the number of seizures experienced by the subject prior to administration of the oligomeric compound. In some embodiments, seizures may include one or more of the following: focal, clonic, tonic, and generalized tonic-clonic seizures; prolonged seizures (typically lasting longer than 10 minutes); and frequent seizures. In some embodiments, seizures may include one or more of the following: focal motor seizures, tonic seizures, generalized tonic-clonic seizures, and myoclonic seizures.

[0107] In some aspects, the methods disclosed herein include a dose escalation phase (or titration phase) and a maintenance phase. Typically, the dose escalation phase is used to determine the maximum dose for the subject, and the maintenance phase is used to continuously administer the maximum dose to the subject. In some aspects, the methods do not include a dose escalation phase and continuously administer a selected dose (also referred to herein as a maintenance dose) to the subject.

[0108] In some embodiments, in the context of this disclosure, the oligomeric compound is administered to the subject at a dose of about 0.1 mg to about 20 mg, such as about 0.1 mg to about 0.5 mg, about 0.1 mg to about 1 mg, about 1 mg to about 5 mg, about 0.5 mg to about 8 mg, about 0.5 mg to about 10 mg, about 1 mg to about 8 mg, about 1 mg to about 10 mg, about 2 mg to about 10 mg, or about 5 mg to about 15 mg. In some embodiments, the oligomeric compound is administered at doses of about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, or about 20 mg. In some embodiments, the oligomeric compound is administered at doses of about 0.5 mg, about 1 mg, about 1.5 mg, about 2.0 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 8 mg, about 12 mg, or about 15 mg. In one embodiment, the oligomeric compound is administered at a dose of about 1 mg. In some embodiments, the oligomeric compound is administered at a dose of about 8 mg.

[0109] In some embodiments, the oligomeric compound is administered at a dose of at least 0.25 mg. In some embodiments, the oligomeric compound is administered at a dose of at least 0.5 mg. In some embodiments, the oligomeric compound is administered at a dose of at least 0.75 mg. In some embodiments, the oligomeric compound is administered at a dose of at least 1 mg. In some embodiments, the oligomeric compound is administered at a dose of at least 0.25 mg, at least 0.5 mg, at least 0.75 mg, at least 1 mg, at least 1.5 mg, at least 2 mg, at least 2.5 mg, at least 3 mg, at least 4 mg, at least 5 mg, at least 6 mg, at least 7 mg, at least 8 mg, at least 9 mg, at least 10 mg, at least 11 mg, at least 12 mg, at least 13 mg, at least 14 mg, at least 15 mg, at least 16 mg, at least 17 mg, at least 18 mg, at least 19 mg, or at least 20 mg.

[0110] In one aspect, the dosage of the oligomeric compound may be titrated once or multiple times. In some embodiments, the dose is increased by 0.5 to 10 times between each titration, or by 1 to 10 times or 1.25 to 5 times between each titration. In some embodiments, the dose is increased by 1.25 to 2 times, 1.5 to 3 times, 1.5 to 2.5 times, or 1.5 to 2 times between each titration. In some embodiments, the dose is increased by 1.25 to 1.75 times between each titration. In some embodiments, for all subsequent doses, the dose is increased by 2 times, up to 8 mg, and then increased by no more than 1.5 times.

[0111] In various embodiments, the dose may be titrated up or down in the clinician’s medical judgment based on any clinical factors, such as patient response or lack of response, at a specific dose, laboratory results (e.g., blood cell count, ECG results, brain scan results, pharmacokinetic assessment results, etc.), patient disease or adverse events.

[0112] Down titration can occur at any multiple and any number of times, for example, reducing the dose by 0.5 to 10 times between each down titration dose, or by 1 to 10 times or 1.25 to 5 times between each down titration dose. In some embodiments, the dose is reduced by 1.25 to 2 times, 1.5 to 3 times, 1.5 to 2.5 times, or 1.5 to 2 times between each down titration dose. In some embodiments, the dose is reduced by 1.25 to 1.75 times between each titration dose. In some embodiments, the dose is reduced by 0.5 times, 1 time, or 2 times. In one embodiment, down titration may include immediately stopping or pausing administration.

[0113] In various embodiments, an upward titration can be followed by a downward titration. In other embodiments, a downward titration can be followed by an upward titration.

[0114] In some embodiments, during the dose escalation period, the dose of the oligomeric compound can be titrated from an initial dose of about 1 mg to a maximum dose of at least about 1.5 mg, about 2 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 8 mg, about 10 mg, about 12 mg, about 15 mg, about 18 mg, about 20 mg, about 25 mg, about 30 mg, about 32 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 100 mg or more. In some embodiments, during the dose escalation period, the dose of the oligomeric compound is titrated from an initial dose of about 0.25 mg, about 0.5 mg, about 0.75 mg, about 1 mg, about 1.5 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, or about 15 mg to a maximum dose of at least about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, or more. In some embodiments, the maximum dose is about 4-100 mg, about 4-50 mg, about 4-25 mg, about 4-15 mg, about 1-10 mg, about 1.5-10 mg, about 4-8 mg, about 1 to 5 mg, about 1.5 to 5 mg, about 1.5 to 8 mg, about 8-100 mg, about 8-75 mg, about 8-50 mg, about 8-25 mg, or about 8-15 mg. In some embodiments, the maximum dose is about 15-100 mg, about 15-75 mg, about 15-50 mg, about 15-40 mg, about 15-30 mg, or about 15-25 mg. In some embodiments, during the dose escalation period, the dose of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of at least about 15 mg. In some embodiments, during the dose escalation period, the dose of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 32 mg. In some embodiments, during the dose escalation period, the dose of the oligomer is titrated from an initial dose of about 1 mg to a maximum dose of about 32-64 mg. In some embodiments, the dose of the oligomer is titrated from an initial dose of about 1 mg to a maximum dose of at least 64 mg.

[0115] In some embodiments, during the dose escalation period, the dose of the oligomeric compound may be administered from an initial dose of about 1 mg to a cumulative dose of at least about 5 mg, about 7 mg, about 8 mg, about 10 mg, about 20 mg, about 30 mg, about 40 mg, about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 500 mg, about 1 g, about 10 g, or about 54 g or more. In some embodiments, the oligomeric compound is administered at doses ranging from an initial dose of about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 25 mg, or about 30 mg to at least about 50 mg, about 60 mg, about 70 mg, about 80 mg, about 90 mg, about 100 mg, about 110 mg, about 120 mg, about 130 mg, about 140 mg, about 150 mg, about 160 mg, about 170 mg, about 180 mg, about 190 mg, about 200 mg, about 500 mg, about 1 g, or about 10 mg. g or a cumulative dose of about 54 grams or more.

[0116] In some embodiments, the cumulative dose is about 40-200 mg, about 50-200 mg, about 50-175 mg, about 50-150 mg, about 50-125 mg, about 50-100 mg, about 50-75 mg, about 40-50 mg, about 75-200 mg, about 75-175 mg, about 75-150 mg, about 75-125 mg, about 75-100 mg, about 100-200 mg, about 100-175 mg, about 100-150 mg, about 100-125 mg, about 125-200 mg, about 125-175 mg, about 125-150 mg, about 150-200 mg, or about 150-175 mg. In some embodiments, the oligomeric compound is administered from an initial dose of about 1 mg up to a cumulative dose of at least about 40 mg or 50 mg. In some embodiments, the oligomeric compound is administered from an initial dose of about 1 mg to a cumulative dose of at least about 100 mg. In some embodiments, the oligomeric compound is administered from an initial dose of about 1 mg to a cumulative dose of at least about 40-100 mg, 50-100 mg, 100 mg to 200 mg, 200 mg to 500 mg, about 500 mg to about 1 g, about 1 g to about 10 g, about 10 g to about 540 g.

[0117] In some embodiments, the administration of the oligomeric compound, including dose escalation and descent during treatment, is determined by the clinician based on available information and relevant considerations. Relevant considerations may include any considerations that the clinician deems relevant, such as, as non-limiting examples, the patient's overall health condition, response to drug treatment, infectious disease status and management, vital signs, seizure counts and / or test results, such as blood cell counts, ECG results, brain scan results, pharmacokinetic assessment results, etc.

[0118] In one aspect, the maximum dose is reached after administration of multiple titrations of the oligomeric compound. In some embodiments, the maximum dose of the dose escalation period is reached after administration of 2-20 titrations of the oligomeric compound, including after administration of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 titrations of the oligomeric compound. In some embodiments, the maximum dose of the dose escalation period is reached after administration of 2-4, 2-10, 4-16, 4-12, 4-10, 4-8, 5-15, 5-12, 5-10, 5-8, 6-12, 6-10, 8-12, or 8-10 titrations of the oligomeric compound. In some embodiments, the maximum dose of the dose escalation period is reached after administration of up to about 4 to about 12 titrations of the oligomeric compound. In other embodiments, titration is not required to reach the maximum dose; for example, dose 1 is the maximum dose.

[0119] In one aspect, the titration dose of the oligomer is administered at intervals of approximately 3 to 20 weeks. In some embodiments, the titration dose of the oligomer is administered at intervals of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks. In some embodiments during dose escalation, the titration dose of the oligomer is administered approximately every 4 to 6 weeks. In some embodiments, the titration dose of the oligomer is administered at intervals of at least approximately 6 weeks. In some embodiments, the titration dose of the oligomer is administered at intervals of at least approximately 2 to 4 weeks. In other embodiments, the titration dose of the oligomer is administered at intervals of at least approximately 2 weeks, at least approximately 3 weeks, or at least approximately 4 weeks. In some embodiments, the titration dose of the oligomer is administered at a frequency not exceeding once every 6 weeks. In other embodiments, the titration dose of the oligomer is administered at a frequency not exceeding once every 4 weeks. In other embodiments, the titrated dose of the oligomeric compound is administered at a frequency not exceeding once every 3 weeks. In other embodiments, the titrated dose of the oligomeric compound is administered at a frequency not exceeding once every 2 weeks.

[0120] In some embodiments, the oligomeric compound is administered to the subject weekly. In some embodiments, the oligomeric compound is administered to the subject every 2 weeks. In some embodiments, the oligomeric compound is administered to the subject every 3 weeks. In some embodiments, the oligomeric compound is administered to the subject every 4 weeks. In some embodiments, the oligomeric compound is administered to the subject every 6 weeks. In some embodiments, the oligomeric compound is administered to the subject every 8 weeks. In some embodiments, the oligomeric compound is administered to the subject every 10 weeks. In some embodiments, the oligomeric compound is administered to the subject every 12 weeks. In some embodiments, the oligomeric compound is administered to the subject monthly.

[0121] In some embodiments, during the dose escalation period, the dose of the oligomeric compound is titrated from an initial dose of about 1 mg to a maximum dose of about 15 mg. In some embodiments, during the dose escalation period, the dose of the oligomeric compound is titrated from a first dose of about 1 mg to a second dose of about 2 mg, and optionally to a third dose of about 4 mg, and optionally to a fourth dose of up to about 8 mg, and optionally to a fifth dose of up to about 12 mg, and optionally to a sixth dose of up to about 15 mg. In some embodiments, the fourth dose of about 8 mg is titrated to a fifth dose of about 15 mg. In some embodiments, the administration interval for each titration dose is 2-6 weeks. In other embodiments, titration may continue until the maximum dose of 100 mg.

[0122] In one aspect, the treatment method further includes administering a maintenance dose during a maintenance period. In some embodiments, the maintenance period follows the dose escalation period. In some embodiments, the maintenance dose is the maximum dose following the dose escalation period. In other embodiments, a maintenance dose is selected and administered to the subject without the subject experiencing a dose escalation period.

[0123] In some embodiments, the maintenance dose is administered approximately every 16-20 weeks or every 2-20 weeks. In some embodiments, the maintenance dose is administered approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks. In some embodiments, the maintenance dose is administered approximately every 1-4 weeks, 1-6 weeks, 1-8 weeks, 1-16 weeks, 2-16 weeks, 2-8 weeks, 6-18 weeks, 6-16 weeks, 6-14 weeks, 6-12 weeks, 6-10 weeks, 8-18 weeks, 8-16 weeks, 8-14 weeks, 8-12 weeks, 8-10 weeks, 10-18 weeks, 10-16 weeks, 10-14 weeks, or 10-12 weeks. In some embodiments, the maintenance dose is administered approximately every 12 weeks.

[0124] In one aspect of the treatment, a maintenance dose is administered after the maximum dose as described herein has been reached during the dose escalation period. In some embodiments, a maintenance dose is administered after a maximum dose of about 1-15 mg has been reached, such as about 1 mg, about 1.5 mg, about 2 mg, about 2.5 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 10 mg, about 12 mg, or about 15 mg. In some embodiments, a maintenance dose is administered after a maximum dose of about 15 mg has been reached. In some embodiments, a maintenance dose is administered after a maximum dose greater than 15 mg has been reached. In some embodiments, a maintenance dose is administered after a maximum dose of about 15-32 mg has been reached. In some embodiments, a maintenance dose is administered after a maximum dose of about 30-50 mg has been reached. In some embodiments, a maintenance dose is administered after a maximum dose greater than 50 mg has been reached.

[0125] In one aspect, multiple maintenance doses are administered. In some embodiments, the interval between administrations of the maintenance dose is approximately 2-20 weeks. In some embodiments, the interval between administrations of the maintenance dose is approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks. In various embodiments, the interval between administrations of the maintenance dose is approximately one month. In some embodiments, the interval between administrations of the maintenance dose is approximately 8-16, 8-14, 8-12, 8-10, 10-16, 10-14, or 10-12 weeks. In some embodiments, the maintenance dose is administered at least once every approximately 12 weeks.

[0126] In one aspect, the maintenance dose is administered over a period of 6 months or longer. In some embodiments, the maintenance dose is administered for the remainder of the subject's life. In some embodiments, the maintenance dose is administered for at least 1-50 years. In some embodiments, the maintenance dose is administered for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, the maintenance dose is administered for at least 2-50 years, 2-40 years, 2-35 years, 2-30 years, 2-25 years, 2-20 years, 2-15 years, 2-10 years, or 2-5 years. In some embodiments, the maintenance dose is administered for at least 2 years.

[0127] In one aspect, the treatment method involves inhibiting the expression of SCN2A in the subject's neuronal cells. In other aspects, the treatment method involves inhibiting the expression of SCN2A mRNA in the subject by approximately 10% to approximately 90%, approximately 35% to approximately 80%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, or more than approximately 95% but less than 100%. In other aspects, attenuation of SCN2A mRNA is achieved by approximately 25% to approximately 50% or approximately 35% to approximately 40%.

[0128] In one aspect, the subject was diagnosed with early-onset DEE before one year of age. In another aspect, the subject was diagnosed with early-onset DEE before three months of age. In some embodiments, the subject was diagnosed with early-onset DEE before two months of age or one month of age. In some embodiments, the subject was diagnosed with early-onset DEE in utero. Typically, the diagnosis involves determining that the subject carries an SCN2A mutation before administration of the oligomeric compound. Any SCN2A mutation can be used to diagnose early-onset DEE, including any known SCN2A mutation and any SCN2A mutation to be identified in the future. In some embodiments, the SCN2A mutation includes one or more of the following: A263V, E430A, E430G, R1882Q, G879R, G1593R, K1502N, V1601L, G211D, S1780I, D343H, R1626Q, G882E, M1545V, L210Q, Q1479H, N1662D, F1597L, V423L, A215T, I891T, A1329D, or a combination thereof. In some embodiments, the SCN2A mutation includes one or more of the following: Q1531K, L1563V, E1321K, Y1589C, M252V, R223E, L1330F, V208E, R36G, R1882G, D343G, V261L, F1651C, R1319Q, A263V, Q383E, V1325I, K908E, V261M, S987I, R1629H, R1882Q, M1338T, E999K, R856Q, V423L, S1336Y, R1626Q, G882E, N212D, E1211K, D195G, L1342P, R220Q, R853Q, R1435 K503fs R937C or a combination thereof. In some embodiments, the SCN2A mutation comprises one or more of the following: L210Q, A263V, E430A, R1882Q, G879R, Q1479H, V423L, G1593R, K1502N, V1601L, G211D, S1780I, D343H, and A1329D, or a combination thereof. In some embodiments, the SCN2A mutation comprises A1329D.

[0129] In one aspect, the subject is a human or a non-human animal. In some embodiments, the subject is a human. In some embodiments, the subject is a person aged 2 to 18 years. In other embodiments, the subject is a person older than 2 years or younger than 18 years. In other embodiments, the subject is a person older than 18 years.

[0130] In some embodiments, the subject is a person under 2 years old. In some embodiments, the subject is a human infant. In other embodiments, the infant is 6 months or younger, 5 months or younger, 4 months or younger, 3 months or younger, 2 months or younger, or 1 month or younger.

[0131] In some embodiments, the subject is a human newborn. In other embodiments, the newborn is a full-term newborn, i.e., born after 39 weeks or more of gestation. In still other embodiments, the newborn is a preterm newborn, i.e., born before 39 weeks of gestation. In some embodiments, the subject is a preterm human newborn born before 38 weeks, 37 weeks, 36 weeks, 35 weeks, 34 weeks, 33 weeks, 32 weeks, 31 weeks, 30 weeks, or 28 weeks of gestation. In various embodiments, the newborn has a low birth weight, regardless of gestational age.

[0132] In the context of this invention, the oligomeric compounds described herein may be administered to a subject in combination with another pharmaceutical agent or therapy, such as an antiepileptic agent. Non-limiting examples of antiepileptic agents include brivaracetam, carbamazepine, clobazam, clonazepam, diazepam, divalproex, eslicarbazepine, ethosuximide, ezogabine, felbamate, gabapentin, lacosamide, lamotrigine, and levetiracetam. Levetiracetam, lorazepam, oxcarbazepine, permpanel, phenobarbital, phenytoin, pregabalin, primidone, rufinamide, tigabine, topiramate, valproic acid, vigabatrin, zonisamide, and cannabidiol. In one embodiment, the oligomeric compound is administered in combination with carbamazepine.

[0133] In addition to intrathecal administration, the oligomeric compounds described herein can also be administered, for example, via oral, parenteral, intraventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, or transdermal administration. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracisional, intraventricular, intraparenchymal, rectal, and local administration.

[0134] Other SCN2A conditions that can be treated according to the methods disclosed in this application include developmental or epileptic encephalopathy (DEE), such as Ōtahara syndrome; infantile epilepsy with migratory focal seizures (EIMFS); infantile and childhood DEE, such as West syndrome and Lennox-Gasstor syndrome; Drawee syndrome; idiopathic / genetic generalized epilepsy (IGE / GGE); temporal lobe epilepsy; myoclonic unstable epilepsy (MAE); migratory partial epilepsy of infancy (MMPSI); and familial hemiplegic migraine, with or without epilepsy. In some embodiments, the SCN2A-related condition is late-onset epileptic encephalopathy. In some embodiments, the SCN2A-related condition is benign familial neonatal-infant epilepsy. In some embodiments, the SCN2A-related condition is intellectual disability (ID). In some embodiments, the SCN2A-related condition is autism spectrum disorder (ASD).

[0135] The treatments disclosed in this article can be used to improve one or more symptoms of SCN2A, including seizures, hypotonia, sensory problems (such as sensory integration dysfunction), delayed and impaired motor development, intellectual and cognitive impairment, motor and balance impairment, visual impairment, language and speech delay, gastrointestinal disorders, delayed neurodevelopment, and sleep problems. Seizures include focal, clonic, tonic, and generalized tonic-clonic seizures, prolonged seizures (usually lasting more than 10 minutes), and frequent seizures.

[0136] In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the frequency of seizures experienced by the subject compared to the frequency of seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, administration of the oligomer compound to a subject in need, in the context of this disclosure, results in a reduction in the frequency of seizures experienced by the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to the frequency of seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, a reduction in the frequency of seizures in the subject is observed at least 1 week, at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after the initiation of administration of the oligomer compound. In some embodiments, a decrease in the frequency of seizures experienced by subjects was observed within 28 days after the initiation of administration of the oligomeric compound. In some embodiments, the term "seizure frequency" refers to the number of seizures experienced by a subject within a given time period, such as a 28-day time period.

[0137] In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject with SCN2A-related conditions results in a reduction in the average daily number of seizures experienced by the subject compared to the average daily number of seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the average daily number of seizures experienced by the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to the average daily number of seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, a reduction in the average daily number of seizures experienced by the subject is observed for at least 1 week, at least 2 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after initiation of administration of the oligomer compound. In other embodiments, a reduction in the average daily number of seizures was observed within 24 hours of initiating administration of the oligomeric compound. In some embodiments, a reduction in the average daily number of seizures was observed within 28 days of initiating administration of the oligomeric compound. In some embodiments, a reduction in the average daily number of seizures was observed after administration of multiple doses of the oligomeric compound, i.e., two doses, three doses, or four or more doses.

[0138] In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject with SCN2A-related conditions results in a reduction in the frequency of focal motor seizures experienced by the subject compared to the frequency of focal motor seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the frequency of focal motor seizures experienced by the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the frequency of focal motor seizures experienced by the subject prior to administration of the oligomer compound.

[0139] In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject with SCN2A-related conditions results in a reduction in the frequency of tonic-clonic seizures experienced by the subject compared to the frequency of tonic-clonic seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the frequency of tonic-clonic seizures experienced by the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the frequency of tonic-clonic seizures experienced by the subject prior to administration of the oligomer compound.

[0140] In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject with SCN2A-related conditions results in a reduction in the frequency of myoclonic seizures experienced by the subject compared to the frequency of myoclonic seizures experienced by the subject prior to administration of the oligomer compound. In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the frequency of myoclonic seizures experienced by the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, compared to the frequency of myoclonic seizures experienced by the subject prior to administration of the oligomer compound.

[0141] Interictal epileptiform discharges (IEDs) are abnormal patterns of brain electrical activity that occur between seizures in patients with epilepsy (Smith et al., Elife January 20, 2022; 11:e73541. doi: 10.7554 / eLife.73541. PMID: 35050851; PMCID: PMC8813051). It has been reported that IEDs in children with idiopathic epilepsy can affect cognitive function and academic performance. (Cheng et al., BMC NeurologyJune 6, 2020; 20(1):233. doi: 10.1186 / s12883-020-01807-z. PMID: 32505173; PMCID:PMC7275426). IEDs can be non-invasively measured using electroencephalography (EEG), a technique that records electrical activity in the brain using electrodes placed on the scalp. This allows for real-time monitoring of changes in IED frequency without causing discomfort to the subject.

[0142] Unwilling to be bound by any particular theory, it is believed that intraepithelial edema (IED) can be used clinically, for example, to test the effects of various therapies on subjects with delirium encephalitis (DEE). For instance, IED can serve as an objective biomarker for the presence and severity of epileptic activity. By measuring the frequency and distribution of IED in the brain before and after drug treatment, the effectiveness of the drug in reducing epileptic activity can be monitored. It is also believed that changes in IED frequency and distribution can be detected before any significant changes occur in seizure frequency or other clinical signs. Therefore, IED can provide an early indication of the effectiveness of drug treatment for DEE in clinical trials and can be used to inform target engagement and dosing strategies. It is also believed that a reduction in IED frequency after drug treatment may be associated with improved seizure control and cognitive outcomes. Therefore, monitoring IED during clinical trials can provide valuable information about the potential long-term benefits of treatment.

[0143] In some embodiments, administration of the oligomer compound to a subject in need, in the context of this disclosure, results in a reduction in the frequency of IED in the subject compared to the frequency of IED in the subject prior to administration of the oligomer compound. In some embodiments, administration of the oligomer compound to a subject in need, in the context of this disclosure, results in a reduction in the frequency of IED in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% compared to the frequency of IED in the subject prior to administration of the oligomer compound. In some embodiments, a reduction in the frequency of IED in the subject is observed at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after initiation of administration of the oligomer compound. In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the frequency of the aEEG signal in the subject compared to the frequency of the amplitude integrated electroencephalogram (aEEG) signal in the subject prior to administration of the oligomer compound. In some embodiments, in the context of this disclosure, administration of the oligomer compound to a subject in need results in a reduction in the frequency of the aEEG signal in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% compared to the frequency of the aEEG signal in the subject prior to administration of the oligomer compound. In some embodiments, a reduction in the frequency of the aEEG signal in the subject is observed at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 6 weeks, at least 8 weeks, at least 10 weeks, at least 12 weeks, at least 14 weeks, or at least 16 weeks or more after the initiation of administration of the oligomer compound. In other embodiments, a decrease in the frequency of aEEG signals in subjects was observed within 24 hours after the start of administration of the oligomeric compound.

[0144] Examples of the present invention Example 1: A seamless clinical trial investigating the safety and efficacy of multiple doses of compound 1 in pediatric participants with early-onset SCN2A developmental and epileptic encephalopathy. This was a seamless, partially non-randomized, open-label, and partially randomized, placebo-controlled, double-blind clinical trial to investigate the safety, tolerability, pharmacokinetics, and efficacy of escalating doses of compound 1 in pediatric participants aged 2 to 18 years with early-onset SCN2A DEE. The trial was conducted in four parts: preliminary safety part 1 (open-label), dose escalation part A (double-blind), confirmatory part B (double-blind), and then an open-label extension in part C.

[0145] Part 1: Preliminary Safety Part A: Dosage escalation Part B: Confirmation Part C: Open Tag Extension Part 1: Preliminary Safety The purpose of Part 1 is to obtain clinical safety data that will provide further information for dose escalation in Part A. In this open-label, non-randomized part of the trial, at least four participants will be recruited and will receive 1 mg doses of compound 1 at ≥4-week intervals for up to 13 weeks.

[0146] The sponsor is continuously evaluating safety and available PK data, and conducting scheduled quarterly Data Monitoring Committee (DMC) reviews after each interim analysis, and ad hoc reviews as needed based on emerging safety data. Preliminary efficacy and safety in reducing seizures will be evaluated after four doses.

[0147] After the final dose, some participants in group 1 may be eligible to move to a long-term extension, subject to further FDA review and approval for the trial to continue, pending updated chronic toxicology data.

[0148] Part A: Dosage escalation Part A will be initiated upon completion of Part 1. The goal of Part A is to identify the cumulative dose of Compound 1, which has a favorable benefit-risk profile in reducing seizures, and this cumulative dose may be further assessed in Part B. Part A will consist of up to 16 participants. Initially, 8 treatment-naïve participants will be randomized 3:1 to receive either an escalating dose of Compound 1 or a placebo program. The first 4 participants must reach at least 4 weeks after their first dose before the study drug can be administered to other participants. For the first 4 doses, they will be administered at intervals of ≥4 weeks, and for subsequent doses, at intervals of ≥6 weeks. Dose escalation will be conducted within participants. The starting dose will be 1 mg, and subsequent dose increases will be ≤2-fold, following specific dose escalation criteria. The goal is to reach a cumulative dose of up to 42 mg, which is predicted to correspond to approximately 35% knockdown (KD), divided into 6 doses.

[0149] The sponsor will continue to assess safety and available PK data, and conduct scheduled quarterly DMC reviews, as well as ad hoc reviews as needed based on emerging safety data. Preliminary efficacy and safety of seizure reduction will be assessed during the period following the sixth dose administration, after up to eight participants have reached a cumulative dose of up to 42 mg or the corresponding placebo regimen.

[0150] The dosing regimen may be modified based on safety and efficacy analyses. The maximum tolerated dose (MTD) in this trial is defined as one dose level lower than the single or cumulative dose associated with two or more dose-limiting toxicities (DLTs) in Part A or an overall trial rate of 25%. Up to eight additional participants (Group 2, randomized to active or placebo in a 3:1 ratio) may be added to further evaluate the safety and efficacy of escalating doses of Compound 1. The starting dose for these additional participants will be at most the highest tolerated single dose previously administered. A second planned analysis assessing safety and efficacy during the time period following the sixth dose will be performed after up to eight participants have accumulated up to 100 mg. Following the final dose (or placebo procedure), participants will subsequently have the opportunity to enter Part C / open-label extension.

[0151] Part B: Confirmation Period Part B will employ a randomized, placebo-controlled design to further evaluate and confirm the safety and efficacy of the cumulative doses identified in Part A. Up to 40 treatment-naïve participants will be randomized, with no more than 75% receiving compound 1 compared to placebo (maximum randomization ratio of 3:1). The final sample size and randomization protocol will be further confirmed based on preliminary data and efficacy calculations from Part A.

[0152] In Part A, the cumulative dose and the maximum single dose will not exceed the corresponding MTD. The cumulative dose from Part A will be divided into ≤6 administrations of Compound 1 or placebo and will be administered at a frequency not exceeding once every 6 weeks. If tolerability issues occur, participants may be titrated to safely reach the cumulative dose identified in Part A.

[0153] The primary endpoint will be the frequency of seizures over the period following the sixth dose, assessed via a seizure diary. Therefore, participation in Part B will last for a maximum of 30 weeks. Following the final dose (or placebo procedure), participants will then have the opportunity to enter the open-label extension of the trial, Part C.

[0154] Part 1, Part A, and Part B each consist of three periods: screening period, intervention period (open-label in Part 1, double-blind in Part A and Part B), and follow-up period.

[0155] Screening period Prior to any clinical trial procedure, participants / caregivers will provide written informed consent and meet inclusion / exclusion criteria. Key assessments during screening will include medical and disease history, demographic data, weight, height and head circumference, physical examination (including a detailed neurological examination), clinical laboratory evaluation, magnetic resonance imaging (MRI) of the brain, vital sign measurements, 12-lead ECG, and review of concomitant medications / procedures.

[0156] During the baseline observation period (before the baseline medication visit) and into the EOT period, caregivers will maintain a daily seizure diary for at least 4 weeks, including days without visits. Other screening assessments may still be conducted during this 4-week period (and do not necessarily have to be completed before the start of the daily seizure diary). The eligibility review committee (ERC) will review and approve the eligibility of each participant before inclusion in the trial. The baseline long-duration vEEG will be completed within 4 weeks prior to the baseline medication visit.

[0157] Intervention Part 1 (Open-label intervention) Participants will arrive at the trial site on Day-1 for a baseline dosing visit. On Day 1, after eligibility is confirmed, they will receive Compound 1 via IT administration. Each participant will be hospitalized for at least 24 hours and at most 48 hours after dosing for a physical examination (including a detailed neurological examination), clinical laboratory assessment, vital sign measurements, a 12-lead ECG, and any other trial assessments during this visit. The relevant procedures and assessments, including Compound 1 administration, will be repeated approximately (but no more frequently than) every 4 weeks, for a maximum of 4 doses in total. The dosing frequency in Part 1 may be lower depending on the tolerability of the study drug.

[0158] Approximately two weeks after each administration of Compound 1, a home health visit and home vEEG will be conducted. The home health visit may be conducted at home (i.e., away from the study site) or at a clinic (at the study site), as decided by the participant and investigator. If any concerning adverse events (AEs) occur or the participant's examination changes, the investigator may, at their discretion, decide that the participant return to the clinic for an unscheduled visit for further evaluation.

[0159] Part A and Part B (double-blind intervention) Participants will arrive at the trial site on Day-1 for a baseline dosing visit. On Day 1, after eligibility is confirmed, they will receive either Compound 1 via IT administration or a placebo program according to a randomized schedule. Each participant will be hospitalized for at least 24 hours and at most 48 hours after dosing for a physical examination (including a detailed neurological examination), clinical laboratory assessment, vital sign measurements, a 12-lead ECG, and any other trial assessments during this visit. The corresponding procedures and assessments, including Compound 1 administration or the placebo program, will be repeated, with the first four doses in Part A at approximately (but not more frequently) every 4 weeks, and subsequent doses at approximately (but not more frequently) every 6 weeks, and in Part B, at approximately (but not more frequently) every 6 weeks.

[0160] Approximately two weeks after each administration of Compound 1 or placebo procedure, a home health visit and home vEEG will be conducted. The home health visit may be conducted at home (i.e., away from the study site) or at a clinic (at the study site), as decided by the participant and investigator. If any concerning adverse events (AEs) occur or the participant's examination changes, the investigator may, at their discretion, decide that the participant return to the clinic for an unscheduled visit for further evaluation.

[0161] Safety follow-up period During the 6-month follow-up period, home health visits and home vEEGs will be conducted. Home health visits may be conducted at home (i.e., away from the study site) or at the clinic (at the study site), as decided by the participant and investigator. If any concerning adverse events (AEs) occur or if a participant's examination changes (as reported by caregivers or noted during the home health visit), the investigator may, at their discretion, decide that the participant return to the clinic for an unscheduled visit for further evaluation. A final visit to the clinic will be conducted at the end of the trial assessment.

[0162] Follow-up may be extended based on assessments at the end-of-study (EOS) visit and the investigator’s best clinical judgment. If deemed necessary, extended follow-up will include assessment of the presence of potential long-term and developmental effects.

[0163] Part C: Open Tag Extension Part C, the participant component, is an open-label extension of the trial that will assess the safety and durability of compound 1's effects on seizures and other outcome measures over a maintenance dosing regimen of up to 2 years. This open-label extension will be available to any patient previously exposed to compound 1 or transferred from a trial of active compound 1.

[0164] After Part 1 Following the final dose in Part 1, participants may be eligible to transition to a long-term extension in Part C, which will begin ≥6 weeks after the final dose in Part 1 and, if later, after FDA approval for dosing in Part C. Part C will have an initial titration period to allow for safe attainment of the maintenance dose. The starting dose during the titration period will not exceed the MTD in Part A, and the precise titration protocol will be determined after the DMC reviews the interim analysis results from Part A. During the titration period, participants will receive four doses of Compound 1 at ≥4-week intervals, followed by maintenance doses at ≥12-week intervals. All doses in Part C will be administered non-blinded to all participants transitioning from Part 1.

[0165] If interim analysis results for Part A are not available within 6 weeks of the completion of Part 1 and / or FDA approval for inclusion in Part C is not obtained within the same timeframe, participants may continue to receive 1 mg of compound 1 at intervals of ≥6 weeks as early dosing in Part C, prior to the initiation of the titration period in Part C. This interim dosing may be initiated ≥6 weeks after the final dose in Part 1 and may continue until FDA approval is obtained for dosing in Part C, with the titration protocol for this part determined based on the interim analysis results from Part A.

[0166] After part A or part B Participants in Parts A and B will be eligible for Part C. Part C will have an initial titration period to allow participants who previously received placebo in Parts A or B to safely reach the maintenance dose of Compound 1 and avoid study unblinding. During the titration period, participants who received placebo in Parts A or B will receive four escalating doses of Compound 1 at ≥4-week intervals, with the fourth titration dose planned as the MTD of Parts A and B. Participants who received the active agent in Parts A or B will receive the MTD of Compound 1 at the start of the titration (dose 1) and at the end (dose 4); doses 2 and 3 of the titration protocol for these participants will include the placebo procedure. After the initial titration, all participants will receive the maintenance dose of Compound 1 at ≥12-week intervals. Participants transferred from Parts A or B will receive their first three titration doses in Part C in a blinded manner; all other doses in Part C will be administered unblinded.

[0167] The highest dose administered in Part C is at most the maximum tolerated single dose of Parts A and B. This dose level may be changed as Parts A and B progress. Dosing every 12 weeks is expected to be sufficient to maintain KD levels. Therefore, after titration, dosing will be spaced at intervals of at least 12 weeks and at most 2 years in total. Participants may receive lower doses or lower frequencies based on their tolerability.

[0168] Follow-up periods may be extended based on assessments at the EOS visit and the investigator’s best clinical judgment. If deemed necessary, extended follow-up will include assessment of the presence of potential long-term and developmental effects.

[0169] Efficacy evaluation Seizure Diary During the clinical trial, information on participants' seizures and daily concomitant medication use was collected using electronic devices (e.g., tablets / phones, watch apps, and / or other devices). Diaries were completed daily before the baseline administration visit, during the baseline observation period (after the screening visit), for at least 28 days, and for the remainder of the clinical trial. The baseline observation period diaries served as a eligibility check and established a baseline. In addition to spontaneous reporting, prompts were used to ensure sufficient data collection. Diaries were completed as frequently as possible by the same caregiver. Daily seizure diary data collected within the screening window as part of an ongoing observational trial can be used; duplication is not necessary.

[0170] Video EEG Within the limits permitted by local regulations, vEEG will be performed by trained technicians throughout the trial to record brainwave activity and assess changes over time. Long-duration vEEGs will be conducted at home or in an institution, ideally with at least 12 hours of continuous recording, capturing both awake and sleep periods. As part of the ongoing observational trial, vEEGs collected within the screening window according to this protocol need not be repeated during the screening period.

[0171] Bailey's Infant Development Scales - Third Edition (Baley-3) The Bailey-3 is a standardized neurodevelopmental assessment tool used by clinicians to evaluate key areas of early childhood development in individuals between 16 days and 42 months of age. These areas include adaptive behavior, cognition, language, motor function (gross and fine motor skills), and socio-emotional development. Bailey-3 assessments are recorded on video to the extent permitted by local regulations.

[0172] Childhood Sleep Disorders Scale The Parent-Reported Sleep Disorders in Children (SDSC) is a 27-item scale that is rated on a 5-point Likert scale and is designed to categorize sleep disorders in children. In addition to the total score, the tool provides the following 5 sub-scores: sleep onset and maintenance disorder, sleep-disordered breathing, arousal disorder or sleep-wake transition disorder, excessive sleepiness disorder, and sleep hyperhidrosis.

[0173] Quality of Life Scale - Disability (QI-Disability) QI-Disability is a parent-reported measure of quality of life for children with intellectual disabilities. It is a reliable and effective measure of quality of life across the spectrum of intellectual disabilities. It has the potential to allow for a clearer identification of support needs and measurement of responsiveness to interventions.

[0174] Abnormal Behavior Checklist, Version 2 (ABC-2) The ABC-2 is a rating scale assessed by clinicians that measures the severity of a range of problem behaviors commonly observed in individuals with intellectual disabilities.

[0175] Clinical Global Impression - Severity (CGI-S) and Clinical Global Impression - Improvement (CGI-I) CGI was developed for use in NIH-funded clinical trials of individuals with mental health disorders. CGI provides an overall assessment of improvement over a specified time period. CGI comprises two 7-point Likert scales: the CGI-S scale and the CGI-I scale. CGI will use the domains / symptoms experienced by participants with SCN2A-DEE as a reference. Clinicians will use CGI-S to assess the severity of participants' SCN2A-DEE symptoms at baseline (Day 1). Clinicians will use CGI-I to assess changes in SCN2A-DEE symptoms relative to baseline.

[0176] Staff Global Impression - Severity (CgGI-S) and Staff Global Impression - Improvement (CgGI-I) These scales are similar to CGI-S and CGI-I. Caregivers will use CgGI-S to assess the severity of participants' SCN2A-DEE symptoms at baseline (Day 1). Caregivers will use CgGI-I to assess changes in SCN2A-DEE symptoms relative to baseline.

[0177] Results of Part 1: Preliminary Safety In Part 1, participants received compound 1 intrathecally at intervals of ≥4 weeks for up to 13 weeks. The incidence and severity of adverse events during treatment were assessed, and preliminary efficacy and safety were evaluated after 4 doses.

[0178] As shown in Table 1 below, four subjects participated in part 1 of the trial.

[0179] Table 1 Subject demographics Each subject received 1 mg of compound 1 every 4 weeks or monthly. Figure 1 The diagram illustrates the administration of the drug to the subject.

[0180] The subjects did not exhibit any clinically significant abnormalities in vital signs, physical signs, or neurological signs during the examination.

[0181] Table 2 below shows the summary values ​​of the subjects' seizure diary data.

[0182] Table 2 Summary values ​​of epileptic seizure diary data Figure 2 It is a bar graph showing the median change in seizure frequency relative to 28-day baseline after 3 doses. Figure 2 The results shown indicate that even after one dose, compound 1 exhibited efficacy in reducing epileptic seizures.

[0183] Figure 3 It is a bar chart showing the percentage of seizure-free days for each patient in each dosing period after 3 doses, calculated as the number of seizures in the days between dosings. Figure 3 The results shown indicate that the number of seizure-free days increased significantly compared to baseline, with improvement observed after one dose.

[0184] Figure 4 Small figure A is a box plot, which shows the daily seizure frequency of subject 2001 after 3 doses, divided by the dosing period (28 days).

[0185] Figure 4 Small figure B is a box plot, which shows the daily seizure frequency of subject 2002 after 3 doses, divided by the dosing period (28 days).

[0186] Figure 4 The small figure C is a box plot, which shows the daily seizure frequency of subject 2003 after 3 doses, divided by the dosing period (28 days).

[0187] Figure 4 The small figure D is a box plot, which shows the daily seizure frequency of subject 2004 after 3 doses, divided by the dosing period (28 days).

[0188] Figure 5 Small figure A is a graph showing the daily seizure frequency of subject 2001 during each dosing period after 3 doses.

[0189] Figure 5Small Figure B is a graph showing the daily seizure frequency of subject 2002 during each dosing period after 3 doses.

[0190] Figure 5 Small figure C is a graph showing the daily seizure frequency of subject 2003 during each dosing period after 3 doses.

[0191] Figure 5 Small figure D is a graph showing the daily seizure frequency of subject 2004 during each dosing period after 3 doses.

[0192] Table 3 below shows the summary data of the seizure diaries of Subject 2001 after 3 doses.

[0193] Table 3 Pooled data on epileptic seizures in 2001 subjects.

[0194] Table 4 below shows the frequency data of seizure types in subject 2001.

[0195] Table 4 Data on the frequency of seizure types in subject 2001 after two doses.

[0196] Table 5 below shows the summary data of the subject's seizure diary after 3 doses in 2002.

[0197] Table 5 Pooled data on epileptic seizures in subjects in 2002.

[0198] Table 6 below shows the frequency data of seizure types in subjects 2002.

[0199] Table 6 Data on the frequency of seizure types in subject 2002 after two doses.

[0200] Table 7 below shows the summary data of the subject's seizure diary after 3 doses in 2003.

[0201] Table 7 Pooled data on epileptic seizures in subjects in 2003.

[0202] Table 8 below shows the frequency data of seizure types in subjects in 2003.

[0203] Table 8Data on the frequency of seizure types in subjects 2003 after two doses.

[0204] Table 9 below shows the summary data of the subjects' seizure diaries from 2004.

[0205] Table 9 Pooled data on seizures in subjects 2004 after 3 doses.

[0206] Table 10 below shows the frequency data of seizure types in subjects in 2004.

[0207] Table 10 Data on the frequency of seizure types in subject 2004 after two doses.

[0208] The vEEG score for each subject was determined at baseline and after each dosing period. In the vEEG scoring system, a normal vEEG score = 0, and a pathological vEEG score greater than 0, with a worst score of 11. For subject 2004, no change in vEEG score was observed throughout the dosing period, while for subjects 2001, 2002, and 2003, increases in vEEG scores were observed, as shown in Table 11 below.

[0209] Table 11 VEEG scores of subjects after two doses during each dosing period.

[0210] It should be noted that the vEEG scoring system has limitations. Specifically, the vEEG score is highly influenced by many variables and represents a snapshot of a single day. The vEEG scoring system has not been validated, therefore caution is required when interpreting the results.

[0211] During the study, subjects 2001 and 2004 experienced serious adverse events unrelated to the study drug. Subjects 2001, 2002, and 2004 also experienced non-serious adverse events of mild or moderate severity. All TEAEs resolved.

[0212] Figure 6 Small graph A is a bar chart showing the mean and median changes in seizure frequency relative to baseline for the four subjects. The results represent the overall percentage reduction relative to baseline observed in the four subjects over four 28-day time periods.

[0213] Figure 6Small plot B is a bar chart showing the percentage change in the mean and median of seizure-free days relative to baseline for the four subjects. The results represent the overall relative percentage increase in the proportion of seizure-free days for the four subjects.

[0214] Safety assessments after four doses showed that compound 1 was well tolerated with no drug-related adverse events (AEs). Specifically, no treatment-associated adverse events (TEAEs) or severe adverse events (SAEs) were associated with compound 1, and all TEAEs resolved or subsided. Assessments of physical and neurological examinations, vital signs measurements, and electrocardiogram (ECG) parameters, for example, did not show clinically significant changes. Apart from one subject reporting elevated WBC counts, no clinically significant changes were observed in clinical laboratory results. Three subjects experienced any TEAE, of which three had non-serious TEAEs and two had any serious TEAEs. There were ten isolated TEAEs, of which five were non-serious and five were any serious TEAEs. Any serious TEAEs included infections, which were common in this subject population.

[0215] Conclusion of Part 1 Preliminary results indicate that compound 1 achieved a significant and sustained reduction in seizures at a dose level of 1 mg, demonstrating unexpected benefit in all treated participants. Compound 1 was also well tolerated with no drug-related adverse events. Therefore, these preliminary results demonstrate the tolerability of compound 1 and its unprecedented efficacy in early-onset SCN2A-DEE.

[0216] Following administration of four doses of compound 1, participants achieved a median reduction of 43% in seizures relative to baseline, and an increase in the number of seizure-free days, achieving a median relative increase of 48% in the number of seizure-free days relative to baseline, on top of the best available standard of care. Participants receiving treatment were 1.6 times more likely to experience seizure-free days than those not receiving treatment. No TEAEs or SAEs were considered to be associated with the study drug, and all TEAEs resolved / resolved.

[0217] Compound 1 has the potential to be the first disease-modifying therapy for early-onset SCN2A GoF (gain-of-function) DEE.

[0218] Example 2: Using compound 1 to treat early-onset cervical cancer SCN2A Developmental and epileptic encephalopathy: First patient report in preterm infants with refractory status epilepticus Patient 1: A premature infant (29+4 weeks gestation; birth weight 1400g) was diagnosed as a carrier of pathogenic [virus] through prenatal exome sequencing. SCN2AMutation. The identified pathogenic SCN2A variant is c.3986C>A p. (Ala1329Asp). The infant presented with status epilepticus (SE), such as... Figure 7 As shown. The infant has experienced persistent epileptic seizures since birth, as confirmed by continuous EEG readings similar to SE, and a history of intrauterine epilepsy and joint contractures.

[0219] Figure 7 Representative aEEG traces are shown, illustrating the clinical course of the subjects in the first few weeks after birth. Specifically, Figure 7 Small figure A shows a representative aEEG trace in the subject, which shows a typical zigzag pattern similar to the EEG state in the first week. Figure 7 Small figure B shows a representative aEEG trace in the subjects, showing a reduction in seizures after several loading doses of phenytoin (arrow) in the third week. Figure 7 Small figure C shows a representative aEEG trace, indicating that the reduction in seizures is unsustainable because the state pattern recurs even at phenytoin levels >40 μg / mL. The seizures are subclinical or motor seizures.

[0220] like Figure 7 As shown, anti-seizure treatment revealed that high-dose sodium channel blockers (SCBs) had only a partial effect and insufficient control of seizures. The eligibility for treatment with compound 1 was evaluated using computer-simulated protein structure modeling and in vitro electrophysiological studies, aiming to determine GoF status and guide dosing strategies.

[0221] result Variant characterization and GoF confirmation Voltage-clamp experiments confirmed the structural modeling predictions that the pathogenic p. Ala1329Asp variant interferes with the binding of inactivating motifs, which will induce GoF through impaired inactivation and sustained current increase. To assess the effect of this variant on the intrinsic excitability of neurons, dynamic action potential clamp (DAPC) experiments were performed, showing a significant increase in action potential firing and a significant decrease in base strength across the entire input range compared to WT.

[0222] Figure 8 The location of the mutation in the A1329D Nav1.2 channel is shown. Specifically, Figure 8 Figure A shows a side view and an intracellular view of the 3D structure of Nav1.2, highlighting the transmembrane segments S4 and S5 (S4-5) in domain III. DIII The A1329 residue is located in the intracellular linker between the cells. It also indicates four domains (DI-DIV), an inactivation gate, and a β2 subunit. Figure 8Small Figure B shows S4-5 before and after computer-simulated mutagenesis. DIII Enlarged view of the region (top, WT; bottom, A1329D). The D1329-F1489 interaction may affect the binding of the IFM inactivation motif to its receptor pocket, resulting in inactivation delay and persistent current.

[0223] Figure 9 The biophysical characteristics of the A1329D variant and its effect on neuronal excitability relative to WT are shown. Figure 9 In the mean ± SEM, the data are presented as mean ± SEM. Compared to WT, P < 0.05. Specifically, Figure 9 Small figure A shows the sodium current (I Na Density-voltage relationship (illustrated voltage scheme). Representative I Na The trace is shown on the left. Figure 9 Small figure B shows the continuous inward movement of I. Na - Voltage relationship. Representative I caused by -10 mV depolarization. Na The trace is shown on the left. Figure 9 The small figure C shows the voltage dependence of activation. Figure 9 The small figure D shows the voltage dependence of deactivation. Figure 9 The small figure E shows I Na The time-dependent inactivation process on membrane potential. Representative WT and A1329D INa traces induced by -25 mV and -5 mV voltages are shown on the left. Figure 9 The small figure F shows the input-output relationship of the WT and A1329D variants.

[0224] The results demonstrated the safety of compound 1 and its time-related association with a reduction in epileptic seizures. After confirming GoF status, treatment with compound 1 was initiated when the patient was 1 month and 2 weeks old. A total of 15 doses were reported. The first 6 doses administered over 17 weeks were (1 mg, 0.5 mg, 1 mg during the first 5 weeks; then 4 mg, 8 mg, and 8 mg at approximately 4-week intervals). The total cumulative dose of compound 1 administered over 23 weeks was 22.5 mg, and the total cumulative dose of compound 1 administered over 28 weeks and 5 days was 30.5 mg. The total cumulative dose administered after 12 doses was 70.5 mg. The total cumulative dose administered after 15 doses was 94.5 mg of compound 1. Dosing was determined by the clinician and included escalation and reduction of the drug. A summary of patient 1's dosing is presented in Table 12 below: Table 12. Dosing regimen for Patient 1 Figure 10The clinical course of patients and its impact on seizures after the introduction of compound 1 treatment are illustrated. Specifically, Figure 10 Inset A shows the patient's clinical course, including the high-dose SCB and the introduction of compound 1. A related decrease in seizure frequency is shown (bottom). Figure 10 Small figure B is a bar graph showing the number of seizures per hour for each drug level of phenytoin (PHT) and carbamazepine (CBZ). A total of 7 compounds were administered at one intrathecal dose (30.5 mg total dose). Figure 10 Small figure C shows the aEEG trace 1 day before the first administration of compound 1, which shows the peak seizure frequency ( Status epilepticus ). Figure 10 Small figure D shows the aEEG trace 1 week after the first administration of compound 1. Figure 10 Small figure E shows the aEEG trace 7 weeks after the first administration of compound 1. Figure 10 Small figure F shows the aEEG trace 10 weeks after the first administration of compound 1.

[0225] Figure 10 The data shown in the small graph DF indicates modulation and reduction of seizure activity (usually closely related to SCB administration in time). It should also be noted that the seizure exacerbation shown in the aEEG trace between July 2nd and 9th was due to urosepsis and the associated decrease in SCB plasma levels.

[0226] A 5-week-old brain MRI revealed T1 hyperintensity, periventricular thinning, enlarged lateral ventricular protrusions, and periventricular medullary occlusion, in addition to germinal matrix and periventricular leukomalacia, which may be associated with periventricular hemorrhagic infarction, indicating prior brain injury. A large dose of ASM was administered immediately after birth and adjusted as deemed necessary by the attending physician throughout the treatment period, but the patient consistently showed an inadequate response and remained in refractory status epilepticus from birth until the administration of compound 1.

[0227] Compound 1 treatment in combination with best standard of care ASM was well tolerated, with no severe or serious drug-related adverse events within 16 months or 70 weeks up to a cumulative total dose of 94.5 mg.

[0228] To date, over a 70-week period, patients have been administered a total of 15 doses of Compound 1 (1, 0.5, 1, 4, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8, 8 mg), starting at 6 weeks postnatally. Dosage levels were selected by the attending physician based on continuous assessment of the infant's disease status during hospitalization. Compound 1 has continued to be well tolerated, and no drug-related serious adverse events (SAEs) have been reported throughout the treatment period.

[0229] Importantly, no adverse events (AEs) were observed at the highest single dose of 8 mg (equivalent to 0.8 mg of WT NHP, with a total cumulative exposure of 3.05 mg). After six doses administered over 25 weeks and a cumulative exposure of 22.5 mg, the CSF concentration of compound 1 was determined to be 1.51 ng / mL. The achieved exposure demonstrated the safety and tolerability of compound 1 in infants weighing 2 kg at the time of the first dose. The potential benefits of compound 1 became apparent shortly after the first administration, with status epilepticus intermittently interrupted for 8 days after the first dose and eventually discontinued upon continued administration. Following the first 4 mg administration of compound 1, the patient stabilized, allowing for the first discharge from the intensive care unit. A reduction in seizure frequency of more than 50% was observed during follow-up assessments, with significant reductions in both seizure frequency and severity throughout the treatment period. Seizure frequency remained stable with continued administration and was maintained after gradual reduction of phenytoin at 14 months of age, with no neurodevelopmental deterioration at 18 months of age. Compound 1 was well tolerated, and no severe or serious adverse events were reported.

[0230] Patient 2: Patient 2 is an 8-year-old patient diagnosed with SCN2A-related acquired DEE. The patient has a history of treatment-resistant seizures, global brain atrophy, overall developmental delay, frequent eye movements, and severe dystonia when awake.

[0231] The patient received a total of 10 doses over a period of approximately 9 months at intervals of approximately monthly (approximately 3–4 weeks in this case), with the highest dose to date being 5 mg and a cumulative exposure of 22 mg. No drug-related adverse events were reported, and the procedure and administration were well tolerated. A summary of patient 2's dosing is presented in Table 13 below: Table 13. Dosing regimen for patient 2 Prior to the administration of compound 1, the patient experienced urinary calcification, possibly secondary to ethosuximide, and previous attempts to discontinue the drug had resulted in worsening facial myoclonus and inability to eat. Two weeks after the second dose of compound 1, ethosuximide was reduced by 0.5 mL per week, and facial myoclonus resolved during waking hours.

[0232] Furthermore, after the second dose, significantly less nystagmus was reported, muscle tone greatly improved, and botulinum toxin administration was discontinued. Additionally, after dose 2, a dramatic reduction in seizures was reported, and previous complete tonic-clonic seizures manifested as mild tongue and jaw movements (reportedly the way previous tonic-clonic seizures began), but the tongue movements did not progress to tonic-clonic seizures. The nursing team further reported that compared to before treatment with compound 1, when the patient was more agitated and exhibited more crying and screaming, after dose 2, the patient appeared happy and calm. After dose 2, mild hand movements, previously unseen, were observed in the patient, and she was reported to have moved her arm to greet visitors. School teachers also observed that the patient was more alert than before treatment. Daily seizure counts are not currently available; however, 24-hour EEGs performed between doses 2 and 3 showed significantly fewer clinical and electrocardiographic seizures; multifocal and generalized epileptic discharges remained abnormal.

[0233] Compound 1 is generally well tolerated during administration. Furthermore, according to caregivers and medical staff providing support to patients, several significant improvements in quality of life have been reported, including: ● Family members report a decrease in the intensity of tonic-clonic seizures and improvements in attention and vocalization. Family members also report that the patient smiles more frequently. ● Family members reported that the patient was more comfortable in the wheelchair and generally had a higher tolerance for sensory stimuli. Therefore, they started going to restaurants; ● The occupational therapist reported an improvement in range of motion and discontinued the use of botulinum toxin. ● Speech therapists were able to provide fluids that did not require thickening and reported improvements in gaze communication and alertness; Digestion improved significantly, and the use of suppositories could be discontinued.

[0234] Patient 3: Patient 3 is a patient from Example 1 (ID number 2001) and was permitted to continue using compound 1. A summary of continued dosing for patient 3 is presented in Table 14 below: Table 14. Dosing regimen for patient 3 Patient 3 continued to tolerate compound 1 well.

[0235] Patient 4: Patient 4 is from Case 1 (ID 2004) and was permitted to continue using compound 1. A summary of continued dosing for Patient 4 is presented in Table 15 below: Table 15. Dosing regimen for patient 4 Patient 4 continued to tolerate compound 1 well.

[0236] in conclusion: The results of the first patient study indicate that compound 1 is the first disease-modifying therapy for the treatment of early-onset GoF SCN2A-DEE, and early clinical experience with its use in combination with SCBs has shown safety and a time-related association with a reduction in seizures, including the cessation of previously refractory SE.

Claims

1. A method for reducing the frequency of seizures experienced by a subject with SCN2A-related conditions, the method comprising administering an effective amount of an oligomeric compound to the subject, wherein: The SCN2A-related diseases are caused by gain-of-function mutations in the SCN2A gene; The oligomer contains a 6-10-4 MOE spacer having the sequence CCACGACATATTTTTCTACA (SEQ ID NO: 3) (from 5' to 3'); Each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside; The internucleotide bonds between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleotide bonds, while the internucleotide bonds between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are thiophosphate internucleotide bonds; and Each cytosine is 5-methylcytosine.

2. The method of claim 1, wherein the oligomeric compound is administered at a dose of about 0.1 mg to about 20 mg.

3. The method of claim 1, wherein the oligomeric compound is administered in doses of about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, or about 20 mg.

4. The method of claim 1, wherein the oligomeric compound is administered in a dose of about 0.5 mg, about 1 mg, about 4 mg, about 8 mg, about 12 mg, or about 15 mg.

5. The method of claim 4, wherein the oligomeric compound is administered at a dose of about 1 mg.

6. The method according to any one of claims 1 to 5, wherein the oligomeric compound is applied about once a month.

7. The method according to any one of claims 1 to 6, wherein the epileptic seizure is selected from the group consisting of: focal motor seizures, tonic seizures, generalized tonic-clonic seizures, and myoclonic seizures.

8. The method according to any one of claims 1 to 7, wherein the administration of the oligomer compound reduces the average number of daily seizures experienced by the subject over a 28-day period compared to the average number of daily seizures experienced by the subject prior to administration of the oligomer compound.

9. The method according to any one of claims 1 to 8, wherein the administration of the oligomer reduces the number of seizures experienced by the subject over a 28-day period by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to the number of seizures experienced by the subject prior to administration of the oligomer.

10. A method of treating a subject suffering from SCN2A-related conditions, the method comprising administering an oligomeric compound to the subject at a dose of about 0.1 mg to about 20 mg, wherein: The SCN2A-related diseases are caused by gain-of-function mutations in the SCN2A gene; The oligomer contains a 6-10-4 MOE spacer having the sequence CCACGACATATTTTTCTACA (SEQ ID NO: 3) (from 5' to 3'); Each of nucleosides 1-6 and 17-20 (from 5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxy nucleoside; The internucleotide bonds between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleotide bonds, while the internucleotide bonds between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are thiophosphate internucleotide bonds; and Each cytosine is 5-methylcytosine.

11. The method of claim 10, wherein the oligomeric compound is administered in doses of about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 2.5 mg, about 3 mg, about 3.5 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, or about 20 mg.

12. The method of claim 11, wherein the oligomeric compound is administered in a dose of about 0.5 mg, about 1 mg, about 4 mg, about 8 mg, about 12 mg, or about 15 mg.

13. The method of claim 12, wherein the oligomeric compound is administered at a dose of about 1 mg.

14. The method according to any one of claims 10 to 13, wherein the oligomeric compound is applied about once a month.

15. The method according to any one of claims 10 to 14, wherein the administration of the oligomeric compound reduces the frequency of seizures experienced by the subject compared to the frequency of seizures experienced by the subject prior to administration of the oligomeric compound.

16. The method of claim 15, wherein the administration of the oligomer compound reduces the average daily number of seizures experienced by the subject during the 28-day period compared to the average daily number of seizures experienced by the subject during the 28-day period prior to administration of the oligomer compound.

17. The method according to any one of claims 10 to 16, wherein the administration of the oligomer reduces the number of seizures experienced by the subject over a 28-day period by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, or at least about 85% compared to the number of seizures experienced by the subject prior to administration of the oligomer.

18. The method according to any one of claims 10 to 14, wherein the administration of the oligomer compound increases the percentage of seizure-free days experienced by the subject in each 28-day period compared to the percentage of seizure-free days experienced by the subject in each 28-day period prior to the administration of the oligomer compound.

19. The method according to any one of claims 15 to 18, wherein the epileptic seizure is selected from the group consisting of: focal motor seizures, tonic seizures, generalized tonic-clonic seizures, and myoclonic seizures.

20. The method according to any one of claims 1 to 19, wherein the subject is a human.

21. The method of claim 20, wherein the subject is between 2 and 18 years of age.

22. The method of claim 20, wherein the subject is between 0 months and 24 months.

23. The method of claim 22, wherein the subject is a newborn.

24. The method of claim 23, wherein the newborn is a premature newborn.

25. The method according to any one of claims 1 to 24, wherein the SCN2A-related condition is SCN2A developmental and epileptic encephalopathy (SCN2A DEE).

26. The method of claim 25, wherein the SCN2A-related condition is early epileptic epileptic encephalopathy (EE).

27. The method according to any one of claims 1 to 26, wherein the gain-of-function mutation in the SCN2A gene is selected from the group consisting of: L210Q, A263V, E430A, R1882Q, G879R, Q1479H, V423L, G1593R, K1502N, V1601L, G211D, S1780I, D343H and A1329D.

28. The method of claim 27, wherein the gain-of-function mutation is A1329D.

29. The method according to any one of claims 1 to 28, wherein the oligomeric compound comprises a modified oligonucleotide represented by the following chemical symbols: m C es m C eo A eo m C eo G eo A eo m C ds A ds T ds A ds T ds T ds T ds T ds T ds m C ds T e o A es m C es A e (SEQ ID NO: 3), where: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside internucleotide bond, and o = phosphate diester nucleoside bond.

30. The method of claim 29, wherein the oligomeric compound is a modified oligonucleotide represented by the following chemical structure: (SEQ ID NO: 3) or its salt.

31. The method of claim 30, wherein the modified oligonucleotide is a sodium or potassium salt.

32. The method of claim 31, wherein the modified oligonucleotide is a sodium salt.

33. The method of claim 32, wherein the modified oligonucleotide is represented by the following chemical structure: (SEQ ID NO: 3).

34. The method according to any one of claims 1 to 33, wherein the oligomer is administered as part of a pharmaceutical composition comprising the oligomer and a pharmaceutically acceptable diluent or carrier.

35. The method of claim 34, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).

36. The method of claim 35, wherein the pharmaceutically acceptable diluent is aCSF.

37. The method according to any one of claims 1 to 36, wherein the oligomeric compound is administered intrathecally.

Images