Application of SNP (Single Nucleotide Polymorphism) molecular marker located on porcine chromosome 5 and related to porcine white stillbirth

Abstract

The invention discloses application of an SNP molecular marker located on a pig chromosome 5 and related to a pig white stillbirth fetus, the site of the SNP molecular marker is rs332293471, and the genotype of the SNP molecular marker is GG, GA or AA. The SNP molecular marker provided by the invention is remarkably related to the white stillbirth character of the pig, the white stillbirth morbidity of the pig with the genotype of AA or GA of the SNP molecular marker is remarkably lower than that of the pig with the genotype of GG, and the white stillbirth morbidity can be reduced and the breeding efficiency of the sow can be improved by eliminating the pig with the genotype of GG of the SNP molecular marker.

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding technology and relates to the application of SNP molecular markers located on chromosome 5 of pigs that are associated with porcine white stillbirths. Background Technology

[0002] White stillbirth is a significant phenotype in porcine reproductive disorder syndrome (PRDS), specifically referring to piglets that are full-term in gestation but die at birth, exhibiting a pale and lifeless appearance. In production, white stillbirth not only directly causes piglet mortality and is a direct factor affecting the number of live births, but also increases the sow's energy expenditure and can lead to uterine inflammation due to prolonged labor. Therefore, reducing the incidence of white stillbirth is crucial for improving the number of piglets weaned per sow per year (PSY) and the overall health of the herd.

[0003] In the field of genetic breeding, the improvement of the stillbirth trait has long faced challenges. The occurrence of this trait involves a complex interaction of multiple factors, including fetal development, the maternal uterine environment, and the parturition process. Phenotypic recording heavily relies on meticulous and accurate parturition monitoring and is easily affected by environmental factors such as sow parity, body condition, nutrition, and parturition management. This results in low accuracy and slow genetic progress for traditional pedigree- and phenotype-based selection methods. Current production interventions mainly focus on mitigating the trait through improved management measures such as midwifery and environment, but fail to address the underlying genetic basis. In studies of the stillbirth trait, the traditional view often considers it a maternal effect trait, primarily influenced by the sow's genetic background. However, from the perspective of perinatal medicine and genetic epidemiology, stillbirth essentially reflects the individual fetal survival ability during parturition, directly caused by differences in fetal tolerance to stresses such as hypoxia and umbilical cord compression. Therefore, using stillbirth fetuses as cases and normally surviving individuals as controls, and directly analyzing the association between the fetal genotype and this birth outcome, is a reasonable and direct research strategy for locating genetic loci affecting fetal survival ability.

[0004] With the advancement of modern breeding technology, combining molecular genetic methods with marker-assisted selection (MAS) and genome-wide association study (GWAS) to genetically analyze and select for this trait, directly screening dominant alleles affecting survival ability from the fetal perspective, or guiding precise mating of boars and sows (avoiding high-risk genotype combinations), can effectively reduce the incidence of stillbirths at the herd level and accelerate the genetic progress of high-reproductive-performance pig herds. Summary of the Invention

[0005] The main objective of this invention is to provide an application of a SNP molecular marker located on chromosome 5 of pigs that is associated with porcine leukopenia.

[0006] According to one aspect of the present invention, an application is provided for detecting a product containing a molecular marker of a SNP located on chromosome 5 of pigs that is associated with porcine leukemic stillbirth, the application comprising at least one of the following (1) to (4): (1) Identify the characteristics of stillborn piglets; (2) Prepare products for identifying the characteristics of stillborn piglets; (3) Genetic improvement of pigs, based on eliminating pigs with the SNP molecular marker genotype GG, in order to reduce the incidence of stillbirth in pigs; (4) Prepare a product for assisting in the genetic improvement of pigs. This product is based on the identification of SNP molecular markers and genotypes to assist in the genetic improvement of the stillbirth trait in pigs.

[0007] The SNP molecular marker provided by this invention is located on chromosome 5 of pigs and is significantly associated with the trait of white stillbirth in pigs. Its site is rs332293471, which corresponds to the G>A mutation at 65336416 bp on chromosome 5 of the International Pig Reference Genome 11.1. The genotype of the SNP molecular marker is GG, GA or AA.

[0008] The SNP molecular markers provided by this invention are significantly correlated with the incidence of stillbirth in pigs with white pus. Specifically, pigs with genotypes AA and GA have a significantly lower incidence of stillbirth in pigs with genotype GG than those with genotype GG. By selecting pigs with genotypes AA or GA based on their SNP molecular markers and culling pigs with genotype AA, the incidence of stillbirth in pigs with white pus can be reduced, thus improving reproductive efficiency. Furthermore, during mating, it is important to avoid simultaneously using boars and sows with genotype GA to prevent the generation of GG-type individuals with a high incidence of stillbirth in pigs with white pus. In some embodiments, products for detecting SNP molecular markers located on chromosome 5 of pigs that are associated with porcine leukopenia stillbirth may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers located on chromosome 5 of pigs that are associated with porcine leukopenia stillbirth.

[0009] In some embodiments, the reagents for detecting SNP molecular markers associated with porcine leukopenia on chromosome 5 may include at least one of the following: primers or probes for detecting SNP molecular markers associated with porcine leukopenia on chromosome 5.

[0010] In some implementations, the pig is a Large White pig.

[0011] In some embodiments, the primers used to detect SNP molecular markers associated with porcine stillbirths on chromosome 5 of pigs include an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer can specifically amplify a fragment containing the single nucleotide polymorphism at position 201 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to detect whether the single nucleotide at position 201 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 65336416 bp on chromosome 5 of the International Pig Reference Genome Version 11.1, is G or A.

[0012] In some embodiments, the kit for detecting SNP molecular markers located on porcine chromosome 5 associated with porcine stillbirth may include primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, as well as dNTPs, DNA polymerase, and Mg 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0013] According to a second aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular markers located on chromosome 5 of pigs that are associated with porcine white stillbirths; (2) Select individuals with SNP molecular marker genotypes of AA or GA and eliminate individuals with genotype GG to reduce the incidence of stillbirth.

[0014] In some implementations, in step (1), the pig is a breeding pig in the core breeding pig herd.

[0015] In some implementations, in step (1), the breeding pig is a Large White pig.

[0016] In some implementations, step (1), determining the genotype of the SNP molecular marker located on chromosome 5 of pigs that is associated with porcine white stillbirth, includes the following steps: Whole-genome DNA was extracted from breeding pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplified products were sequenced, and the genotype of the SNP molecular markers associated with porcine white stillbirth located on chromosome 5 of the pig was determined based on the sequencing results.

[0017] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention verifies the effect of the SNP molecular marker rs332293471, which is located on the nucleotide sequence of pig chromosome 5 and is associated with pig white stillbirth, on the trait of pig white stillbirth. This helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the trait of pig white stillbirth and reduce the economic losses of enterprises. (2) This invention provides a method for genetic improvement of pigs, which can accelerate genetic progress and shorten generation intervals. If all GG-type individuals with the SNP molecular marker rs332293471 that affects stillbirth in pigs can be selected into AA or GA-type individuals, the incidence of stillbirth in pigs will be greatly reduced, the reproductive efficiency of sows will be improved, and the economic benefits of breeding pigs will be effectively improved. Attached Figure Description

[0018] Figure 1 This is a genome-wide association study (GWAS) plot of the stillbirth trait on chromosome 5 in Large White pigs; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents -log P value. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0020] Example 1: Identification and Validation of SNP Molecular Markers Associated with the White Stillbirth Trait in Pigs (1) Experimental pig herd The experimental pig population used in this invention consisted of 1643 Large White pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., all of which were core members of the division, with detailed pedigree records. The 1643 Large White pigs included 847 piglets, and for each piglet, 738 maternal and 58 sire Large White pigs. Among the piglets, there were 139 stillborn piglets and 708 healthy piglets.

[0021] (2) Phenotypic measurement The identification criteria for stillborn piglets with white skin are as follows: The piglet's skin is uniformly pale white or dark yellow, without fresh bloodstains or purple spots, the body is soft and relaxed, there is no rigor mortis, and it is often accompanied by a pale, protruding tongue. The body surface is relatively clean, sometimes with a layer of dry amniotic membrane attached, and there is no putrid odor. If multiple characteristics are met simultaneously, it is determined to be a stillborn piglet that died in the uterus before parturition. Tail samples from piglets that gave birth within 24 hours, stillborn piglets with white skin, and corresponding ear samples from the parent pigs are collected strictly according to the identification criteria.

[0022] (3) Extraction of porcine genomic DNA Whole-genome DNA was extracted from tail or ear tissue samples collected from each Large White pig individual using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.

[0023] (4) Genotyping of pig whole genome variation DNA samples were subjected to next-generation sequencing by Beijing Novogene Technology Co., Ltd., and the sequencing results were in FASTQ format.

[0024] First, GATK v4.0.2.1 software was used to generate a dict file based on the pig reference genome (Sscrofa11.1). Second, BWA-MEM-0.7.12 software was used to correlate FASTQ data reads onto the pig reference genome. Third, SAMtools v1.9 software was used to generate a bam file. Fourth, Sentieon software (version 202010) was used for variant detection. During this process, "--algo LocusCollector", "--algo Realigner", "--algoQualCal", "--algo Haplotyper", and "algo GVCFtyper" were used to ultimately generate a VCF file containing data from the parents, normal piglets, and stillborn white piglets. The "VariantFiltration" function of GATK v4.0.2.1 was used to filter SNPs, with the default parameters being: "QD<2.0, FS>60.0, SOR>3.0, MQ<40.0". The MQRankSum was <12.5, and ReadPosRankSum was <-8.0. In the fourth step, due to the low quality and limited coverage of the sequencing data from stillborn white piglets, direct use might result in numerous genotype omissions or misclassifications. To improve data completeness and accuracy, SHAPEIT5v1.0 software was used to perform haplotype phase analysis on the VCF files of the parents, normal piglets, and stillborn white piglets, with parameters set to "hmm-ne 100", "pbwt-mdr 0.1", and "pbwt-mac 0". Then, using high-quality phase data from the parents' Large White pigs as a reference panel, impute5 v1.1.5 software was used to fill in the genotypes of the stillborn white piglet phase data, with parameters set to "--b 300", "--ne 100", "--pbwt-mac 0", and "--pbwt-mdr 0.1". This step effectively completed the genotype information of the stillborn white piglet samples, improving data usability and the reliability of subsequent analyses. Finally, PLINK v1.9 was used to perform quality control on the obtained genotype data, removing variant sites with a detection rate of <90% and a mimor allelfrequency (MAF) of <5%, as well as variant sites located at unknown locations and on sex chromosomes. The remaining 12,032,425 variant sites and 847 piglet samples were used for subsequent data analysis.

[0025] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis is then performed using GCTA software, with the first three principal components used as covariates to correct for population structure. Sex and parity are used as covariates to control for the influence of non-genetic factors on phenotype. GWAS analysis is then performed using a mixed linear model in GEMMA software. This invention uses the Bonferrini method to set a significance threshold, setting the genomic-level threshold to 0.05 divided by the number of effective variant sites, i.e., 4.2E-09 (0.05 / 12032425).

[0026] GWAS analysis results are as follows Figure 1 As shown. from Figure 1 It is known that in Large White pigs, there is a SNP locus on chromosome 5 that is significantly associated with the stillbirth trait, and the strongest associated SNP is 5_65336416_G_A (rs332293471, P = 1.27×10 -9 The nucleotide at position 201 in SEQ NO.1 corresponds to the G>A mutation at position 65336416 bp on chromosome 5 in International Pig Reference Genome Version 11.1.

[0027] (6) Analyze the association between different genotypes and the incidence of stillbirth in pigs to verify the effect of the SNP molecular marker 5_65336416_G_A on the trait of stillbirth in pigs.

[0028] The results are shown in Table 1.

[0029] As shown in Table 1, the incidence of stillbirth with white fetuses differed significantly among different genotypes of the SNP molecular marker 5_65336416_G_A, indicating that this molecular marker significantly affects the incidence of stillbirth with white fetuses in pigs. The incidence of stillbirth with white fetuses can be reduced and the reproductive efficiency of breeding pigs can be improved by assisted selection of this SNP site in pigs.

[0030] Furthermore, the incidence of stillbirth in AA and GA individuals was significantly lower than that in GG individuals. P The genotype <0.01 indicates that GG type is a susceptible genotype for stillbirth with white puppies. Stillbirth with white puppies leads to a decrease in the number of live piglets born to sows, a decline in reproductive efficiency, and an increase in breeding costs, directly affecting the economic benefits of livestock production enterprises. AA and GA genotype individuals have low morbidity rates; therefore, in the breeding process, it is necessary to gradually cull GG type breeding pigs and retain AA or GA type breeding pigs.

[0031] Table 1 Correlation analysis between SNP molecular markers and traits

[0032] (7) Effect analysis This invention provides a SNP molecular marker, 5_65336416_G_A, significantly associated with the trait of stillbirth with white pus in pigs. Using this SNP marker for marker-assisted selection, and gradually culling pigs with the GG genotype within the population, can significantly improve the productivity of breeding sows and increase the number of live piglets per litter. Specifically, if all individuals with the GG genotype of the SNP marker can be selected to become AA genotype individuals, the incidence of stillbirth with white pus in offspring will decrease by 27.3%. This will directly translate into an increase in the effective number of live piglets in the herd, a shorter breeding cycle, and a decrease in production costs, ultimately significantly improving the number of weaned piglets and the overall profitability of pig farms.

[0033] Example 2: Methods for genetic improvement of pigs The target fragment containing SNP sites significantly associated with the trait of white stillbirth is a 401 bp nucleotide sequence from chromosome 5, the specific nucleotide sequence of which is shown in SEQ ID NO:1, and the primer pairs for PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0034] SEQ ID NO:1 TTGCCCTCTGATGCACCAGGTTCTCAGGCCACTGTGGGCAAGTGACATTCTGAAAAAAACCTGTTATCCAGTCAGAAAGCCACCCCCCCCACCACACACACCACACACACACACACACCACACACCACACAGACCTCCACCCCTCCCTGTGCCTCTGTGCCTGTGAATCCCAAAGTGGGAACTGGAGGCAATTCCCT R CCACCACGGAATCTGAGATTCCCTCTAACATTGCCGCGGAGGCTGGGCCATCTGATGAAGGAAACCTCAGGGAGATGCTGCCCTCTTCTGGGAAACACGCAAAGAAAGACCCCAAAGAGCAGGTAATTCTCTGTAATTCTCCTGGCTGGATCCTGGAGATAGCCGAGAAAGGAGGTCCTGGATCGACTCACACAGAAGC.

[0035] The R marked in the sequence is the mutation site, which is A or G, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0036] Upstream primer-F: 5'-TTGCCCTCTGATGCACCAG-3' (SEQ ID NO:2); Downstream primer-R: 5'- GCTTCTGTGTGAGTCGATCCA-3' (SEQ ID NO:3).

[0037] The genetic improvement methods for pigs include the following steps: S1. Determine the genotypes of SNP molecular markers associated with the white stillbirth trait in pigs.

[0038] (1) Take ear tissue from pigs or tail tissue from piglets, extract the whole genome DNA of pigs using the standard phenol-chloroform method, and then perform quality testing and concentration determination on the extracted DNA.

[0039] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0040] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0041] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and the gene fragments were sequenced in both forward and reverse reactions. Based on the sequencing results, it was determined whether the single nucleotide at position 201 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, corresponding to position 65336416 bp on chromosome 5 of the International Swine Reference Genome Version 11.1, was A or G, thus determining the genotype of the SNP molecular marker in the pig to be tested.

[0042] S2. Select pigs with SNP molecular marker genotypes of AA or GA as parents for breeding, and eliminate pigs with genotype GG.

[0043] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of products that detect SNP molecular markers located on porcine chromosome 5 associated with porcine stillbirth (white fetuses), characterized in that, The SNP molecular marker is located at rs332293471, and the genotype of the SNP molecular marker is GG, GA, or AA. Among them, the incidence of stillbirth in pigs with genotype AA or GA is significantly lower than that in pigs with genotype GG. The application includes at least one of the following items (1) to (4): (1) Identify the characteristics of stillborn piglets; (2) Prepare products for identifying the characteristics of stillborn piglets; (3) Genetic improvement of pigs, based on culling pigs with the SNP molecular marker genotype GG to reduce the incidence of stillbirth in pigs; (4) Prepare a product for assisting in the genetic improvement of pigs, wherein the product is based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of the stillbirth trait in pigs.

2. The application according to claim 1, characterized in that, The product for detecting SNP molecular markers located on chromosome 5 of pigs that are associated with porcine leukopenia stillbirths includes at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pig in question is a Large White pig.

6. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers located on chromosome 5 of pigs that are associated with porcine white stillbirths; (2) Eliminate individuals with the SNP molecular marker genotype GG; The site of the SNP molecular marker is rs332293471.

7. The method for genetic improvement of pigs according to claim 6, characterized in that, In step (1), the method for determining the genotype of the SNP molecular marker located on chromosome 5 of pigs that is associated with porcine white stillbirth includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplified products were sequenced, and the genotype of the SNP molecular markers associated with porcine white stillbirth located on chromosome 5 of pigs was determined based on the sequencing results.

8. The method for genetic improvement of pigs according to claim 6 or 7, characterized in that, The pig in question is a Large White pig.

Images