A fertilizer for plant gene activation

Abstract

This application pertains to the fields of plant growth regulation and fertilizers, and provides a fertilizer for plant gene activation. The fertilizer comprises modified humic acid, chitosan, salicylic acid, an emulsifier, and water. This application modifies humic acid through a combination of sulfonation and pyrolysis, further enhancing the growth-promoting effect of the fertilizer, particularly significantly increasing the expression levels of key root growth genes.

Description

Technical Field

[0001] This application pertains to the fields of plant growth regulation and fertilizers. Specifically, this application provides a fertilizer for plant gene activation. Background Technology

[0002] Humic acid is a complex network polymer containing numerous functional groups and elements such as carbon, hydrogen, oxygen, nitrogen, sulfur, and other metals. It is primarily formed from the remains of plants and animals in water bodies under geological conditions and microbial activity. Common lignite and lean coal contain significant amounts of humic acid, making them one of the main sources of this humic acid.

[0003] Humic acid can improve soil properties, alter soil nutrient composition, and increase soil biological activity, and has been widely used in fertilizer preparation, desert greening, and the improvement of barren soils. To enhance the water solubility, adsorption / chelation properties, and growth-promoting properties of humic acid, existing technologies have employed methods such as oxidation, nitrification, sulfonation, halogenation, and microbial treatment to activate and modify it.

[0004] The applicant previously prepared plant growth activating fertilizers using ingredients such as humic acid, chitosan, salicylic acid, and fatty acids, which achieved good results in increasing yield and disease resistance in a variety of crops. Summary of the Invention

[0005] To further improve the effects of humic acid and the aforementioned fertilizers, this application provides a fertilizer for plant gene activation, comprising modified humic acid, chitosan, salicylic acid, emulsifier, and water.

[0006] Furthermore, the fertilizer is composed of 5-15 parts by weight of modified humic acid, 10-20 parts by weight of chitosan, 105 parts by weight of salicylic acid, 1-5 parts by weight of emulsifier 0203B, and 60-80 parts by weight of water.

[0007] Furthermore, the fertilizer is composed of 10 parts by weight of modified humic acid, 15 parts by weight of chitosan, 2 parts by weight of salicylic acid, 3 parts by weight of emulsifier 0203B, and 70 parts by weight of water.

[0008] Furthermore, the fertilizer also includes nitrogen, phosphorus, and potassium compound fertilizer.

[0009] The fertilizer for plant gene activation described in this application can be used in combination with nitrogen, phosphorus, and potassium (NPK) compound fertilizer. The application ratio can be adjusted by those skilled in the art based on factors such as crop type and soil quality. The NPK compound fertilizer can also be prepared into the fertilizer for plant gene activation, for example, but not limited to, providing separate solid NPK compound fertilizer packaging and suspension emulsion packaging within the overall packaging; or providing separate NPK compound fertilizer packaging and suspension emulsion packaging, with the instructions specifying their combined application.

[0010] Furthermore, the modified humic acid is sulfonated humic acid that has undergone pyrolysis.

[0011] Furthermore, the method for preparing the modified humic acid includes:

[0012] (1) Disperse lignite humic acid in a 4-6 w / v% potassium sulfite solution with 8-10 times the mass of humic acid; heat to 70-80℃ and stir continuously for 90-150 minutes; remove the solvent under reduced pressure to obtain sulfonated humic acid;

[0013] (2) Sulfonated humic acid is heat-treated at 250°C for 1-5 minutes in a nitrogen atmosphere to obtain modified humic acid.

[0014] Furthermore, the method for preparing the modified humic acid includes:

[0015] (1) Disperse lignite humic acid in 8 times the mass of humic acid in a 6 w / v% potassium sulfite solution; heat to 75°C and stir continuously for 120 minutes; remove the solvent under reduced pressure to obtain sulfonated humic acid with a sulfonation degree of 9.2-9.8%;

[0016] (2) Sulfonated humic acid was heat-treated at 250°C for 5 minutes in a nitrogen atmosphere to obtain modified humic acid.

[0017] Furthermore, the method for preparing the fertilizer includes: mixing the various components and grinding them to an average particle size of 2-3 micrometers.

[0018] On the other hand, this application provides the application of the above-mentioned fertilizer in promoting crop growth and / or increasing crop yield.

[0019] Furthermore, the crop in question is a member of the Solanaceae family.

[0020] Furthermore, the solanaceae crop mentioned is tomato.

[0021] The lignite humic acid in this application can be extracted and prepared using methods known in the art. The preparation methods for lignite humic acid include, but are not limited to: (A) crushing and sieving lignite to obtain fine lignite particles; (B) adding the fine lignite particles to a 305% w / v sodium hydroxide solution at 5-8 times their mass, heating to 60-80 degrees Celsius, and stirring continuously for 10-20 minutes; (C) allowing the mixture to stand, cool, and precipitate, and taking the upper layer of liquid; adding hydrochloric acid to the upper layer of liquid while stirring until a black precipitate is formed and completely precipitated; (D) filtering to obtain the precipitate, drying it, and obtaining lignite humic acid. Based on the applicant's verification using lignite humic acid from different origins and with different textures, the desired technical effects can be achieved by using the above modification methods.

[0022] This application modifies humic acid through sulfonation combined with pyrolysis, which further enhances its growth-promoting effect, especially significantly increasing the expression level of key genes for root growth. Attached Figure Description

[0023] Figure 1 The aboveground fresh weight of each group was compared in an experiment to promote the growth of tomato seedlings.

[0024] Figure 2 Comparison of underground fresh weight among different groups in the tomato seedling growth promotion experiment.

[0025] Figure 3 Comparison of seedling vigor index among different groups in the tomato seedling growth promotion experiment.

[0026] Figure 4 To compare the relative expression levels of HA1 and GRAS1 genes in different groups of the tomato seedling growth promotion experiment. Detailed Implementation

[0027] Example 1: Preparation of Humic Acid from Lignite

[0028] Lignite raw material: Lignite from Jiaozuo, Henan Province was used in the experimental stage (later, lignite from Linfen was used for verification).

[0029] Preparation of lignite humic acid: Lignite was crushed and passed through a 20-mesh sieve to obtain fine lignite particles; the fine lignite particles were added to a 3% w / v sodium hydroxide solution with a mass of 5 times the mass of the fine lignite particles, heated to 70 degrees Celsius, and stirred continuously for 15 minutes; the mixture was allowed to stand for 1 hour to cool and precipitate, and the upper liquid was collected; 10% w / v hydrochloric acid was added to the upper liquid while stirring until a black precipitate was formed and completely precipitated; the precipitate was filtered and dried to obtain lignite humic acid.

[0030] The basic properties of lignite and humic acid products are shown in Table 1:

[0031] Table 1. Basic Properties of Lignite Raw Materials and Humic Acid Products

[0032] Sample / Indicator Lignite Sample 1 (Jiaozuo) Lignite Sample 2 (Linfen) humic acid content 44.5% 48.7% Water content 23.1% 20.9% Fixed carbon content 24.5% 27.2% Total humic acid content of the product 72.5% 76.8% Product black humic acid content 66.2% 69.0% Product humic acid content 13.6% 7.5% Product fulvic acid content 20.2% 23.5%

[0033] The results showed that both products were of average quality humic acid, with the humic acid produced from Linfen lignite being of slightly better quality.

[0034] Example 2: Preparation and thermal decomposition of sulfonated humic acid

[0035] The humic acid prepared in Example 1 was dispersed in a 6 w / v potassium sulfite solution at 8 times the mass of the humic acid; the solution was heated to 75°C and stirred continuously for 120 minutes; the solvent was removed by vacuum evaporation. The degree of sulfonation of the tested product was 9.2-9.8%, and the wetting and suspension properties were significantly improved compared to the unsulfonated product.

[0036] Humic acid and sulfonated humic acid were heat-treated in a nitrogen atmosphere for a certain time (Shimadzu, DSC-60 thermal analyzer with nitrogen generator, heating rate of 25℃ / min, ventilation cooling) to obtain humic acid / sulfonated humic acid thermal decomposition products.

[0037] The results showed that when treated at 300℃ for more than 5 minutes, humic acid lost more than 15% of its weight. Considering the need to maintain the basic structure and efficacy of humic acid, the heat treatment parameters were set as shown in Table 2.

[0038] Table 2 Heat treatment parameters for each group

[0039] Group sulfonation temperature time 1 no — — 2 yes — — 3 no 250℃ 1 min 4 no 250℃ 5 min 5 no 275℃ 1 min 6 no 275℃ 5 min 7 yes 250℃ 1 min 8 yes 250℃ 5 min 9 yes 275℃ 1 min 10 yes 275℃ 5 min

[0040] In groups 10 and 6 (treated at 275℃ for 5 minutes), the weight loss rate still exceeded 10% and the product morphology changed significantly; the suspension performance of group 10 decreased significantly (the suspension rate of 1g:50mL decreased from about 80% to about 60%). Therefore, these two groups were excluded from subsequent actual planting experiments.

[0041] Example 3 Fertilizer Preparation

[0042] Take 10 parts by weight of humic acid, 15 parts by weight of chitosan, 2 parts by weight of salicylic acid, 3 parts by weight of emulsifier 0203B, and 70 parts by weight of water; mix and grind to an average particle size of 3 micrometers to obtain a plant gene-activating suspension emulsion.

[0043] The manufacturer of the nitrogen, phosphorus and potassium compound fertilizer (15-15-15) used in combination is Devodo.

[0044] Example 4: Tomato Seedling Growth Promotion Experiment

[0045] The experiment was conducted at Liufuding's own experimental greenhouse in Zhengzhou, Henan Province. The soil was conventional brown soil with good and uniform fertility and irrigation / drainage conditions. Each treatment zone had an area of ​​10m². 2 The spacing between plants is 0.5m × 0.8m.

[0046] The experimental tomato variety was the common "Pink Lady" large-fruited tomato. Seedlings were transplanted to the experimental site when they reached the four-leaf-one-heart stage (day 0). After a 5-day recovery period, plant gene-activating suspension emulsion (150-fold dilution, 0.03 kg per treatment area, applied as a root drench) and NPK compound fertilizer (200-fold dilution, 0.1 kg per treatment area) were applied every 10 days. NPK compound fertilizer was applied on days 5 and 15, and plant gene-activating suspension emulsion was applied on days 6 and 16. The specific treatment group settings are shown in Table 3.

[0047] Table 3. Experimental treatment group settings for promoting growth in tomato seedlings

[0048] Group Humic acid in plant gene-activating suspension A Untreated lignite humic acid (Table 2, Group 1) B Sulfonated lignite humic acid (Table 2, Group 2) C Table 2, Group 3 D Table 2, Group 4 E Table 2, Group 5 F Table 2, Group 7 G Table 2, Group 8 H Table 2, Group 9

[0049] On day 23, 10 plants from each zone were sampled for testing. Indicators included fresh and dry weight of aboveground and underground parts, and seedling vigor index ((stem diameter / 10 × plant height) × total plant dry weight). Further, 5 plants from each zone were sampled to detect key genes for root growth (reference: Research progress on the mechanism of humic acid promoting crop root growth, Humic Acid, 2019, Vol. 2). RNA was extracted using a commercial kit and reverse transcribed, then detected by RT-PCR. The expression levels of GRAS1 (upstream primer: TCTTCACGCGGACTCGTCAC, SEQ ID NO.1; downstream primer: CCCACTCAAAGGCGAACCA, SEQ ID NO.2) and HA1 / proton pump 1 (upstream primer: CGCGAGCTTCAATGGGCACA, SEQ ID NO.3; downstream primer: GCTCCCATCACGACACCAACAGT, SEQ ID NO.4) relative to agonist proteins (upstream primer: TTCCGTTGCCCAGAGGTCCT, SEQ ID NO.5; downstream primer: TCCCCTTTGAAATCCACATC, SEQ ID NO.4) were measured. NO.6).

[0050] Figures 1-3 The results showed that sulfonation effectively improved the growth-promoting effect of humic acid compared with direct use of lignite humic acid. After pyrolysis at a specific temperature (around 250℃, groups F and G), the growth-promoting effect of sulfonated humic acid can be further improved. Judging from the magnitude of the improvement, this growth-promoting effect cannot be explained solely from the perspective of promoting fertilizer utilization.

[0051] Figure 4 The results showed that pyrolyzed sulfonated humic acid had a significant activating effect on key genes for root growth, indicating that moderate pyrolysis can increase the amount of growth hormone-like components while maintaining the basic properties of humic acid. On one hand, this can explain... Figures 1-3 It has a significant growth-promoting effect, and on the other hand, it also provides a good foundation for the further growth and fruit setting of tomatoes.

[0052] The applicant further used the humic acid from Linfen lignite described in Example 1 for sulfonation and pyrolysis to achieve similar effects to Example 4 in tomato and spinach cultivation.

Claims

1. A fertilizer for plant gene activation, characterized in that, The fertilizer contains modified humic acid, chitosan, salicylic acid, emulsifier, and water.

2. The fertilizer according to claim 1, wherein the fertilizer is composed of 5-15 parts by weight of modified humic acid, 10-20 parts by weight of chitosan, 1-5 parts by weight of salicylic acid, 1-5 parts by weight of emulsifier 0203B, and 60-80 parts by weight of water.

3. The fertilizer according to claim 2, wherein the fertilizer is composed of 10 parts by weight of modified humic acid, 15 parts by weight of chitosan, 2 parts by weight of salicylic acid, 3 parts by weight of emulsifier 0203B, and 70 parts by weight of water.

4. The fertilizer according to claim 1, wherein the fertilizer further comprises a nitrogen-phosphorus-potassium compound fertilizer.

5. The fertilizer according to any one of claims 1-4, wherein the modified humic acid is sulfonated humic acid that has undergone pyrolysis.

6. The fertilizer according to claim 5, wherein the method for preparing the modified humic acid comprises: (1) Disperse the lignite humic acid in a 4-6 w / v potassium sulfite solution with 8-10 times the mass of humic acid; Heat to 70-80℃ and stir continuously for 90-150 minutes; remove the solvent under reduced pressure to obtain sulfonated humic acid; (2) Sulfonated humic acid is heat-treated at 250°C for 1-5 minutes in a nitrogen atmosphere to obtain modified humic acid.

7. The fertilizer according to claim 6, wherein the method for preparing the modified humic acid comprises: (1) Disperse the lignite humic acid in a 6 w / v potassium sulfite solution with 8 times the mass of humic acid; Heat to 75°C and stir continuously for 120 minutes; remove solvent under reduced pressure to obtain sulfonated humic acid with a sulfonation degree of 9.2-9.8%; (2) Sulfonated humic acid was heat-treated at 250°C for 5 minutes in a nitrogen atmosphere to obtain modified humic acid.

8. The fertilizer according to claim 1, wherein the method for preparing the fertilizer comprises: After mixing the components, grind them to an average particle size of 2-3 micrometers.

9. The use of the fertilizer according to any one of claims 1-8 in promoting crop growth and / or increasing crop yield.

10. The application according to claim 9, wherein the crop is a Solanaceae crop, preferably tomato.

Images