Use of wwp1 as a target biomarker for estrogen receptor positive breast cancer

Abstract

The application discloses application of WWP1 as an estrogen receptor positive breast cancer targeting biomarker. + The application can be used for evaluating ER + The application further provides a drug combination of a WWP1 inhibitor and a CDK4 / 6 inhibitor, which shows a strong synergistic antitumor effect in vitro and in vivo, can effectively overcome drug resistance and improve the tumor immune microenvironment. In particular in ER + The application provides a novel ER + The application provides an integrated solution for breast cancer prognosis evaluation and treatment, which has important clinical application value.

Description

Technical Field

[0001] This invention relates to the field of tumor molecular diagnostics and targeted therapy, and in particular to the application of WWP1 as a targeted biomarker for estrogen receptor-positive breast cancer. Background Technology

[0002] Breast cancer is the most common malignant tumor among women worldwide. Based on molecular characteristics, breast cancer can be divided into several subtypes, the most common of which is estrogen receptor-positive (ER). + Breast cancer accounts for more than 70% of all breast cancer cases. ER + Breast cancer cells rely on the activation of estrogen signaling pathways to promote tumor growth, thus their biological characteristics and clinical treatment strategies differ significantly from other subtypes (such as HER2-positive and triple-negative breast cancer). This is especially true in advanced ER... + In the treatment of breast cancer, endocrine therapy combined with cyclin-dependent kinase 4 and 6 (CDK4 / 6) inhibitors (such as palbociclib, ribociclib, and abecilibi) has become the first-line standard treatment, significantly prolonging patients' progression-free survival. CDK4 / 6 are key regulatory kinases for the transition from G1 to S phase of the cell cycle; inhibiting their activity can effectively block the proliferation of tumor cells.

[0003] However, although CDK4 / 6 inhibitors are effective in ER + Significant success has been achieved in the treatment of breast cancer, but many clinical challenges remain. Some patients exhibit primary resistance during initial treatment, and most, despite initial treatment success, eventually experience disease progression due to secondary resistance. The mechanisms of resistance are complex and diverse, involving Rb pathway bypass activation, abnormal cyclin expression, and compensatory activation of other proliferative signaling pathways (such as PI3K / AKT / mTOR). This is particularly true for ER... + For breast cancer patients, the complexity of drug resistance mechanisms makes accurately predicting biomarkers for CDK4 / 6 inhibitor response a major clinical challenge. Therefore, the lack of effective biomarkers makes it impossible to screen the most suitable patient population before treatment and also hinders precise intervention after drug resistance develops.

[0004] WWP1 (WW domain containing E3 ubiquitin protein ligase 1) is a HECT-type E3 ubiquitin ligase containing the WW domain, known to function as an oncogene in multiple tumor types. WWP1 participates in various important cell biological processes, such as signal transduction, cellular senescence, and apoptosis. However, WWP1 is also involved in breast cancer, particularly ER. +Whether breast cancer functions as an oncogene remains fully elucidated. Therefore, a deeper investigation into the role of WWP1 in ER is necessary. + The function of breast cancer and its role in CDK4 / 6 inhibitor resistance mechanisms are important for improving ER. + The treatment of breast cancer, overcoming drug resistance, and improving patient prognosis have important clinical significance and application value. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an application of WWP1 as a targeted biomarker for estrogen receptor-positive breast cancer. This invention targets ER... + Exploring novel biomarkers and therapeutic targets for breast cancer can provide insights for ER. + For breast cancer patients, especially those with drug resistance, it provides a tiered management and precision treatment strategy, offering entirely new treatment options.

[0006] In a first aspect, the present invention provides the following two uses of the WWP1 gene or its protein, which are achieved through the following technical solutions.

[0007] Application of a reagent or kit for detecting the expression level of the WWP1 gene or its protein in the preparation of a prognostic assessment product for estrogen receptor-positive breast cancer.

[0008] The use of a reagent or kit for detecting the expression level of the WWP1 gene or its protein in the preparation of products for predicting the efficacy of CDK4 / 6 inhibitors in estrogen receptor-positive breast cancer.

[0009] The above reagents or kits detect WWP1 gene amplification or WWP1 protein overexpression to indicate ER. + Poor prognosis in breast cancer patients, and / or indications of decreased sensitivity to or resistance to CDK4 / 6 inhibitor therapy.

[0010] Furthermore, the reagents for detecting the expression level of the WWP1 gene or its protein are selected from at least one of the following:

[0011] (a) WWP1 gene-specific probe for fluorescence in situ hybridization (Kanglu Biotechnology, #FP-506).

[0012] (b) WWP1 gene-specific primers for polymerase chain reaction;

[0013] (c) Antibody that specifically binds to WWP1 protein (Abcam, #ab43791).

[0014] Furthermore, the WWP1 gene-specific primers used for polymerase chain reaction are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0015] Forward primer: TGAACAGTGGCAATCTCAGCGG (SEQ ID NO.1);

[0016] Reverse primer: CTGGTGGCAAAGGTCCATAAGG (SEQ ID NO.2).

[0017] Secondly, the present invention provides a reagent kit, which is achieved through the following technical solution.

[0018] A kit for assessing the prognosis of estrogen receptor-positive breast cancer or predicting the sensitivity of estrogen receptor-positive breast cancer to CDK4 / 6 inhibitor therapy, comprising reagents for detecting WWP1 gene amplification status or WWP1 protein expression levels.

[0019] Furthermore, the reagent is selected from at least one of the following:

[0020] (a) WWP1 gene-specific probe for fluorescence in situ hybridization (Kanglu Biotechnology, #FP-506).

[0021] (b) WWP1 gene-specific primers for polymerase chain reaction;

[0022] (c) Antibody that specifically binds to WWP1 protein (Abcam, #ab43791).

[0023] Furthermore, the WWP1 gene-specific primers used for polymerase chain reaction are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0024] Forward primer: TGAACAGTGGCAATCTCAGCGG (SEQ ID NO.1);

[0025] Reverse primer: CTGGTGGCAAAGGTCCATAAGG (SEQ ID NO.2).

[0026] Thirdly, the present invention provides a third use of the WWP1 gene or its protein, which is achieved through the following technical solution.

[0027] Application of a reagent that inhibits the expression level of the WWP1 gene or its protein in the preparation of drugs for treating estrogen receptor-positive breast cancer.

[0028] Furthermore, estrogen receptor-positive breast cancer is characterized by WWP1 gene amplification or WWP1 protein overexpression.

[0029] Furthermore, the reagent used to inhibit the expression level of the WWP1 gene or its protein is a WWP1 inhibitor and / or a CDK4 / 6 inhibitor.

[0030] Furthermore, the WWP1 inhibitor is indole-3-carbinol (I3C); the CDK4 / 6 inhibitor is one or more of palbociclib, abemaciclib, and ribociclib.

[0031] Fourthly, the present invention provides a pharmaceutical composition for treating estrogen receptor-positive breast cancer, which is achieved through the following technical solution.

[0032] A pharmaceutical composition for treating estrogen receptor-positive breast cancer, comprising a WWP1 inhibitor and / or a CDK4 / 6 inhibitor.

[0033] Furthermore, the WWP1 inhibitor is indole-3-carbinol (I3C); the CDK4 / 6 inhibitor is one or more of palbociclib, abemaciclib, and ribociclib.

[0034] This application has the following beneficial effects:

[0035] This invention is the first to apply WWP1 gene amplification to estrogen receptor-positive (ER) cells. + Stratified management and treatment decision-making for breast cancer: WWP1 amplification status in FFPE tissues can be directly and visually detected and interpreted using rolling circle nucleic acid amplification combined with specific gene probes. The method is simple, compatible with pathological procedures, and suitable for kit-based formulation. Functional and animal experiments show that high WWP1 expression indicates poorer tumor biological behavior and poor prognosis, and is associated with poor response to CDK4 / 6 inhibitor therapy, making it a potential companion diagnostic indicator for pretreatment screening and efficacy prediction. Furthermore, this invention proposes an intervention strategy targeting WWP1. In mouse models, it has been demonstrated that the combination of the WWP1 inhibitor indole-3-carbinol (I3C) and a CDK4 / 6 inhibitor (such as Ribociclib) significantly inhibits tumor growth, thus providing a basis for ER treatment. + Breast cancer presents feasible sensitization combination regimens. In summary, WWP1 amplification can serve as a novel tumor marker for ER. + Molecular subtyping of breast cancer, prognostic assessment, and prediction of CDK4 / 6 inhibitor efficacy can also serve as potential therapeutic targets for clinical intervention, demonstrating clear clinical application prospects and practicality. Attached Figure Description

[0036] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0037] Figure 1 This is a diagram illustrating the mechanism by which WWP1 was identified as an important key gene at chromosome locus 8q21.3 in this invention. Specifically, a. genes with cis-effects among the protein-encoding genes at 8q21.3 are shown through two large public breast cancer databases; b. the effects of genes with cis-effects at 8q21.3 on the cell cycle are shown, with WWP1 exhibiting the strongest effect on the cell cycle.

[0038] Figure 2 This is a diagram showing the amplification of the WWP1 gene in estrogen-positive and estrogen-negative cells detected by the WWP1 gene detection probe constructed in this invention.

[0039] Figure 3 This invention uses fluorescence in situ hybridization (FISH) and hematoxylin-eosin staining to detect and demonstrate the morphological differences between WWP1 gene amplification (Amp) and wild-type (WT) tumors in local clinical breast cancer tissue samples.

[0040] Figure 4 This invention uses fluorescence in situ hybridization (FISH) and immunofluorescence techniques to detect and demonstrate the difference in the distribution of CD8 T cells in WWP1 gene amplified (Amp) and wild-type (WT) tumors in tissue microarrays.

[0041] Figure 5 This invention presents a graph showing the relationship between the WWP1 gene and patient survival, clinical stage, and prognosis. Specifically: a. Kaplan-Meier survival curves: In the TMA cohort, patients with WWP1 gene amplification (WWP1-Amp) had significantly shorter overall survival than those with wild-type WWP1 (WWP1-WT) (p<0.05); b. In the TMA cohort, the proportion of WWP1 gene amplification was higher in tumors at higher clinical stages (Stage III / IV); c. [The last sentence appears to be incomplete and possibly refers to a different data point or data point.] +In the cohort, WWP1 gene amplification was more prevalent in tumors at higher clinical stages (Stage III / IV); d. Compared to wild-type tumors, WWP1-Amp tumors showed a significantly higher proliferation index; e. In the TCGA public database cohort, WWP1 gene amplification was mainly enriched in the Luminal B subtype with poor prognosis; f. In the CBCGA public database cohort, WWP1 gene amplification was mainly enriched in the Luminal B subtype with poor prognosis.

[0042] Figure 6 In the PAM50 breast cancer subtyping of the TCGA breast cancer dataset, only in the Luminal subtype did the WWP1 gene copy number show a significant positive correlation with its mRNA and protein expression levels, confirming its cis-effect.

[0043] Figure 7 In the PAM50 breast cancer subtyping of the CBCGA dataset, only in the Luminal subtype did the WWP1 gene copy number show a significant positive correlation with its mRNA and protein expression levels, confirming its cis-effect.

[0044] Figure 8 This invention relates to the distribution of WWP1 in different estrogen-producing breast cancer cells, including: a. differences in the distribution of WWP1 copy number and expression level in 69 breast cancer cell lines; b. differences in the distribution of WWP1 expression level in single-cell transcriptomes; and c. verification of the distribution of WWP1 in different estrogen-producing breast cancer cells using Western blotting experiments.

[0045] Figure 9 This is a diagram showing the effect of WWP1 expression changes on cell proliferation in the in vitro experiments of this invention, including: a. Cell survival rate of WWP1 overexpressing cells; b. Cell survival rate of WWP1 knockdown cells; c. Cell colony formation of WWP1 overexpressing cells; d. Cell colony formation of WWP1 knockdown cells.

[0046] Figure 10 The present invention demonstrates that changes in WWP1 expression significantly affect the growth of subcutaneous tumors in estrogen-positive breast cancer during in vivo experiments; wherein, a. the results of the in vivo experiment at the endpoint of WWP1 overexpression and control group; b. the tumor growth curves during the in vivo experiment of WWP1 overexpression and control group; c. the tumor weight graph at the endpoint of the in vivo experiment of WWP1 overexpression and control group.

[0047] Figure 11The in vivo experiments of this invention showed that changes in WWP1 expression significantly affected the immune microenvironment of subcutaneous tumors of estrogen-positive breast cancer. Overexpression of WWP1 led to an increase in CD4 T cells, a decrease in CD8 T cells, and an increase in Treg cells in the tumor microenvironment.

[0048] Figure 12 This invention investigates the impact of WWP1 on patient prognosis and the underlying mechanism in a clinical cohort, wherein a. in TCGA ER + Breast cancer cohort and local TJMU ER + In a breast cancer cohort, altered WWP1 expression significantly affected the prognosis of estrogen-positive breast cancer patients; b. Cell proteomics analysis showed that WWP1 expression mainly affects cell cycle pathways and related genes.

[0049] Figure 13 This is a diagram illustrating the relationship between WWP1 and the cell cycle in this invention. Specifically: a. Western blotting revealed that knocking down WWP1 (shWWP1-S1 / S2) in MCF7 and T47D cells upregulated the expression levels of cell cycle repressors P21 and P27, while downregulating the expression levels of cell cycle kinases CDK2 and CDK6; b. Real-time quantitative PCR (RT-qPCR) detected mRNA levels in MCF7 cells showed that WWP1 knockdown significantly affected the mRNA level of P21 (gene name CDKN1A), but had no significant effect on the mRNA level of P27 (gene name CDKN1B), suggesting that WWP1 may regulate P21 at the post-transcriptional level; c. RT-qPCR was used to detect mRNA levels in T47D cells; d. MCF7 cells were treated with the transcriptional inhibitor actinomycin D (ActD), and P21 levels were detected at different time points. The remaining amount of mRNA was determined, and the results showed that overexpression of WWP1 significantly shortened the half-life (T1 / 2) of P21 mRNA and accelerated its degradation; e. T47D cells were treated with the transcription inhibitor actinomycin D, and the remaining amount of P21 mRNA was detected at different time points.

[0050] Figure 14This invention explores the specific mechanism by which WWP1 regulates P21 mRNA stability. Specifically: a. CPCAC proteomics analysis confirmed that RBMS2 is the differentially expressed protein most significantly affected by changes in WWP1 expression; b. Western blotting and cyclohexylimide (CHX) tracking experiments confirmed that overexpression of WWP1 leads to accelerated RBMS2 protein degradation; c. Western blotting and treatment with the proteasome inhibitor (MG132) confirmed that inhibiting RBMS2 protein ubiquitination leads to increased RBMS2 expression; de. Changes in WWP1 expression are accompanied by changes in RBMS2 expression and P21 protein; f. Co-IP experiments confirmed that WWP1 can bind to RBMS2 protein.

[0051] Figure 15 This invention uses the CCK-8 assay to determine cell viability. The results show that in multiple breast cancer cell lines, including MCF10A, MCF7, and T47D, overexpression of WWP1 significantly increases the half-maximal inhibitory concentration (IC50) of palbociclib. 50 This means inducing drug resistance; conversely, knocking down WWP1 via shRNA significantly reduces IC50. 50 Values ​​that enhance drug sensitivity;

[0052] Figure 16 This invention uses the CCK-8 assay to determine cell viability. The results show that in multiple breast cancer cell lines, including MCF10A, MCF7, and T47D, overexpression of WWP1 significantly increases the half-maximal inhibitory concentration (IC50) of abemaciclib. 50 This means inducing drug resistance; conversely, knocking down WWP1 via shRNA significantly reduces IC50. 50 Values ​​that enhance drug sensitivity;

[0053] Figure 17 This invention presents an in vitro synergistic effect analysis diagram of the WWP1 inhibitor indole-3-methanol and palbociclib. Specifically: a. In MCF7 cells, the synergistic effect of the WWP1 inhibitor indole-3-methanol (I3C) and the CDK4 / 6 inhibitor palbociclib at different concentration combinations was shown by a synergy heatmap; b. In WWP1 gene knockout (WWP1KO) cells, the synergistic effect of I3C and palbociclib disappeared, demonstrating the target-dependent nature of this synergistic effect.

[0054] Figure 18In a mouse subcutaneous xenograft model, the tumor size, tumor growth curve, and final tumor weight of the I3C + Ribo combination therapy group were significantly smaller than those of the single-drug treatment groups and the control group (Ctrl). (See figures: a. Tumor image; b. Tumor volume comparison; c. Tumor weight comparison; d. Mouse volume comparison).

[0055] Figure 19 This invention performs immunohistochemical analysis on tumor tissues, and the results show that combined treatment can significantly inhibit tumor cell proliferation. Among them, a. representative images of immunohistochemical detection of KI67 and WWP1 proteins; b. quantitative statistical results of immunohistochemical detection of KI67 and WWP1 proteins; Figure 20 This is a graph showing the relationship between the WWP1 gene and the efficacy of treatment with local CDK4 / 6 inhibitors. ab. Kaplan-Meier survival curves show that in the local CDK4 / 6 inhibitor treatment cohort (TJMUCIHCDK4 / 6i cohort), patients with higher WWP1 protein levels had shorter progression-free survival; while patients with WWP1 gene amplification (WWP1-Amp) had significantly shorter overall survival than those with wild-type WWP1 (WWP1-WT) (p<0.05); cd. Whether in the initial efficacy assessment or the best efficacy assessment, WWP1 gene amplification was associated with non-responsiveness to CDK4 / 6 inhibitors. Detailed Implementation

[0056] This invention provides a novel method applicable to ER + Biomarkers for breast cancer prognosis assessment and CDK4 / 6 inhibitor efficacy prediction, and to provide a new targeted synergistic treatment strategy.

[0057] This invention reveals for the first time that the amplification of the WWP1 gene or the overexpression of its protein is an ER + WWP1 is an independent risk factor for poor prognosis in breast cancer, particularly Luminal B breast cancer. More importantly, this invention reveals that WWP1 overexpression promotes cell cycle progression by regulating the WWP1–RBMS2–P21 signaling axis, which is a key mechanism leading to resistance of tumor cells to CDK4 / 6 inhibitors.

[0058] Based on the above findings, the present invention provides the following technical solution: First, the WWP1 gene or its protein serves as an ER. +Application of biomarkers for predicting breast cancer prognosis and CDK4 / 6 inhibitor efficacy. Patients with WWP1 amplification / overexpression have a worse prognosis and are more likely to be resistant to CDK4 / 6 inhibitors. Second, a kit for detecting WWP1, which can be used to detect WWP1 gene amplification or protein expression levels in clinical samples to assist in clinical decision-making. Third, a synergistic treatment strategy, namely the combined use of WWP1 inhibitors (such as indole-3-carbinol) and CDK4 / 6 inhibitors (such as palbociclib). This invention demonstrates that this combination therapy can produce a significant synergistic anti-tumor effect, effectively overcoming drug resistance mediated by WWP1 overexpression, and providing a basis for ER + This provides new treatment options for breast cancer patients, especially those with drug resistance.

[0059] Preferred embodiments of the present disclosure will be described in detail below with reference to the accompanying drawings. Before description, it should be understood that the terminology used in the specification and appended claims should not be construed as limited to its general and dictionary meaning, but rather should be interpreted based on the principle of allowing the inventors to appropriately define the terminology for the best interpretation, and based on its meaning and concept corresponding to the technical level of the invention. Therefore, the description herein is merely a preferred example for illustrative purposes and is not intended to limit the scope of the invention; thus, it should be understood that other equivalent implementations and modifications can be made without departing from the spirit and scope of the invention.

[0060] I. Experimental Methods

[0061] 1.1. Clinical Sample Collection and Database Information

[0062] (1) Clinical Samples: Tissue Microarray Cohort (TMA cohort): Purchased from Shanghai Xinchao, containing 129 primary breast cancer tissue samples. These samples were obtained from patients who underwent surgical resection between January 2001 and August 2004. Only 67 cases of breast cancer with positive hormone receptor tests were used for subsequent analysis (Table 1); Local Validation Cohort 1 (TJMU ER) +Cohort: This study collected tissue samples from 62 breast cancer patients at Tianjin Medical University Cancer Hospital. Among them, 30 patients were confirmed to be estrogen-positive by immunohistochemical detection and had transcriptome sequencing results (Table 2). Local Validation Cohort 2 (TJMUCIH CDK4 / 6i cohort): This study collected and screened pre-treatment tissue samples from 76 estrogen-positive breast cancer patients at Tianjin Medical University Cancer Hospital who had received CDK4 / 6 inhibitor therapy. All patients underwent tumor resection in the Department of Breast Oncology at our hospital and had not received adjuvant therapy such as chemotherapy or radiotherapy before surgery. All human tissue sample experimental protocols involved in this study were approved by the Ethics Committee of Tianjin Medical University Cancer Hospital (approval numbers: Ek2021143, Ek2023111, bc20260546), and all enrolled patients signed informed consent forms.

[0063] Table 1. Pathological information of patients in the TMA cohort

[0064]

[0065] Table 2. TJMU ER + Pathological information of cohort patients

[0066]

[0067] (2) Public databases: Download ER from The Cancer Genome Atlas (TCGA), Molecular Taxonomy of Breast Cancer International Consortium (METABRIC), and Chinese Breast Cancer Genome Atlas (CBCGA) databases. + Gene copy number variations (CNV), mRNA expression profiles (RNA-seq), protein expression profiles (RPPA), and corresponding clinical follow-up information of breast cancer patients.

[0068] 1.2. Cell lines and culture

[0069] Human ER + Breast cancer cell lines MCF7 and T47D, human breast epithelial cell line MCF10A, and mouse E0771 cell line were purchased from the American Type Culture Collection (ATCC). Cells were routinely cultured in DMEM or RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin in an incubator at 37°C and 5% CO2.

[0070] 1.3. Cell Model Construction

[0071] (1) Stable knockdown of WWP1: shRNA sequences targeting the WWP1 gene [shWWP1-S1:CATGGAATCTGTCCGAAATTT (SEQ ID NO.3), shWWP1-S2: ATTGCTTATGAACGCGGCTTT (SEQ ID NO.4)] and a negative control sequence [shScr: TTCTCCGAACGTGTCACGTAA (SEQ ID NO.5)] were designed and constructed into the pLKO.1 lentiviral vector. The virus was packaged and used to infect MCF7 and T47D cells. After selection with puromycin, a stable knockdown cell line of WWP1 was obtained.

[0072] (2) Stable overexpression of WWP1: The coding sequence of the WWP1 gene (NM_007013.4) was cloned into the pCDH lentiviral vector. A stable overexpression cell line of WWP1 was constructed through lentiviral infection and selection.

[0073] (3) WWP1 gene knockout: This technique was mainly performed by Proon (Tianjin) Technology Co., Ltd. The brief details of this method are as follows: Using CRISPR / Cas9 technology, sgRNA targeting the exon of the WWP1 gene was designed, WWP1 sg1: TCGGCAGGCTCAGATGCGAG (SEQ ID NO. 6). The gRNA and Cas9 protein were incubated to form an RNP, which was then electroporated into MCF7 target cells for double sgRNA fragment knockout. Clones were screened using ClonePlus technology, and clones that were positive by PCR were sequenced. After confirmation, the WWP1 knockout (WWP1KO) MCF7 cell line was obtained, followed by amplification and cryopreservation.

[0074] 1.4. Fluorescence in situ hybridization (FISH)

[0075] FFPE tissue sections were used. After dewaxing, hydration, and proteinase K digestion, the sections were co-incubated with a WWP1 gene-specific red fluorescent probe and a centromere control probe (CEP8, green fluorescence) (Kanglu Biotechnology, #FP-506) at 37°C. Cell nuclei were counterstained with DAPI. Signals were observed and counted under a fluorescence microscope. Gene amplification was defined as a WWP1 signal count / CEP8 signal count > 2.0 or the presence of clustered WWP1 gene signals.

[0076] 1.5. Drug susceptibility testing (IC50) 50 )

[0077] Cells were seeded at a density of 5000 cells / well in 96-well plates. The following day, medium containing gradient concentrations of CDK4 / 6 inhibitors (palbociclib, abecicilline) or WWP1 inhibitors (indole-3-methanol, I3C) was added. After 72 hours of culture, CCK-8 reagent was added and incubated for 2 hours. The absorbance was measured at 450 nm using a microplate reader. The half-maximal inhibitory concentration (IC50) was calculated using GraphPad Prism software. 50 Synergistic effect analysis was performed using Combenefit software.

[0078] 1.6. Western Blot

[0079] Total protein was extracted from cells using RIPA lysis buffer and quantified using the BCA method. Equal volumes of protein were subjected to SDS-PAGE gel electrophoresis and then transferred to a PVDF membrane. After blocking with 5% skim milk at room temperature for 1 hour, the membrane was incubated overnight at 4°C with the following primary antibodies (WWP1, P21, P27, CDK2, CDK4, CDK6, RBMS2, Tubulin). After washing with TBST, the membrane was incubated with horseradish peroxidase (HRP)-labeled secondary antibody at room temperature for 1 hour. Development and image acquisition were performed using an ECL chemiluminescence assay kit.

[0080] 1.7. Real-time quantitative PCR (RT-qPCR)

[0081] Total RNA was extracted from cells using TRIzol reagent and reverse transcribed into cDNA. Amplification was performed using SYBR Green Master Mix on an ABI 7500 real-time PCR system. GAPDH was used as an internal control gene, and a 2... -ΔΔCt The method calculates the relative expression level of genes.

[0082] 1.8. Co-immunoprecipitation (Co-IP)

[0083] Cells were lysed with IP lysis buffer, and the supernatant was collected. Anti-WWP1 antibody (Abcam, #ab43791) or IgG control was added, and the mixture was incubated overnight at 4°C with Protein A / G magnetic beads (Yamei Biotechnology, #YJ201). The next day, the magnetic beads were washed, the immune complexes were eluted, and the co-precipitated RBMS2 protein was detected by Western blotting.

[0084] 1.9. Animal xenograft tumor model

[0085] Female BALB / c nude mice aged 6-8 weeks were randomly assigned to groups. 2 × 10 6MCF7 cells were mixed with Matrigel and subcutaneously injected into the right axilla of nude mice. When the tumor volume reached approximately 100 mm³, intraperitoneal administration was initiated. The specific intervention protocols were as follows: Control group: intraperitoneal injection of an equal volume of physiological saline; I3C monotherapy group: intraperitoneal injection of indole-3-methanol (I3C) at a dose of 100 mg / kg; CDK4 / 6 inhibitor monotherapy group: intraperitoneal injection of ribociclib at a dose of 50 mg / kg; combination therapy group: simultaneous administration of I3C (100 mg / kg) and ribociclib (50 mg / kg). Administration was every 2 days via intraperitoneal injection for 20 consecutive days. During the administration period, the long diameter (L) and short diameter (W) of the tumor were measured every 2 days using electronic calipers, calculated using the formula V = (L × W). 2 Tumor volume was calculated and tumor growth curves were plotted. Mouse weight changes were weighed and recorded to assess drug toxicity. Mice were euthanized by cervical dislocation on day 20 after the last administration. Tumor tissue was completely dissected, weighed, and photographed. A portion of the tumor tissue was fixed in 4% paraformaldehyde for subsequent immunohistochemical analysis; a portion of fresh tissue was used for flow cytometry analysis of tumor-infiltrating lymphocytes. All animal experiments complied with animal ethics committee guidelines.

[0086] 1.10. Flow cytometry

[0087] Fresh tumor tissue was collected, minced, and digested with collagenase to prepare single-cell suspensions. Surface and intracellular staining was performed using appropriate fluorescent antibodies (CD45, CD3, CD4, CD8a, CD25, Foxp3). Detection was performed using a BD FACSCanto II flow cytometer, and data were analyzed using FlowJo software.

[0088] 1.11. Proteomics

[0089] This experimental method primarily uses MCF7 cells to analyze the effects of WWP1 protein knockdown at the protein level, mainly employing GSEA pathway enrichment analysis. Sample preparation was as follows: control and sh-WWP1 group cells were seeded in 6-well plates. Cells were collected after near-confluence growth of tumor cells. Cells were lysed using RIPA lysis buffer, and the samples were then sent to Wuhan Maiwei Metabolic Biotechnology Co., Ltd. for proteomics analysis. The analysis results were also provided by the company.

[0090] 1.12. Statistical Analysis

[0091] Data analysis was performed using SPSS 26.0, GraphPad Prism 9.0, and R 4.3.3 software. Quantitative data were expressed as mean ± standard deviation (Mean ± SD). Differences between groups were compared using independent samples t-tests or one-way ANOVA. Survival analysis was performed by plotting survival curves using the Kaplan-Meier method and conducting a log-rank test. Correlation between variables was analyzed using Pearson or Spearman correlation analysis. Associations of clinical characteristics were analyzed using χ² tests or Fisher's exact test. All statistical inferences were performed using two-tailed tests, with P < 0.05 considered statistically significant.

[0092] II. Experimental Results

[0093] 1. To confirm that WWP1 is a key gene affecting the cell cycle at the 8q21.3 locus on chromosome 8, this invention conducted gene screening and experimental analysis, revealing the crucial role of WWP1 in influencing the cell cycle (see [link to relevant documentation]). Figure 1 Furthermore, to confirm that WWP1 can serve as an ER... + This invention analyzed clinical samples and public databases to determine prognostic biomarkers for breast cancer. Using the fluorescence in situ hybridization (FISH) technique described in method 1.4, biomarkers were analyzed in ER... + Significant WWP1 gene amplification was detected in some tumors in breast cancer tissue microarray (TMA) samples (see [link]). Figures 2 to 4 To determine its clinical significance, survival analysis was performed using clinical follow-up data collected in Method 1.1. Results showed that the overall survival of patients in the WWP1 amplification group (WWP1-Amp) was significantly shorter than that of the wild-type group (WWP1-WT) (p=0.025, see [link]). Figure 5 a). For TMA ER + BRCA and TCGA ER + BRCA's clinical data analysis further confirmed that WWP1 gene amplification was more prevalent in patients with later clinical stages (Stage III / IV) (see [link]). Figure 5 (b, 5c). Meanwhile, tumors with WWP1 gene amplification exhibited a higher proliferation index (see...). Figure 5 d). Analysis of the TCGA and CBCGA public databases further confirmed that WWP1 gene amplification was mainly enriched in the Luminal B subtype, which has higher proliferative activity and a worse prognosis (see [reference]). Figure 5 e, 5f). The WWP1 gene copy number is highly positively correlated with its mRNA and protein expression levels in luminal tumors (see e, 5f). Figure 6 and Figure 7This confirms that gene amplification is the main cause of its protein overexpression. The above results indicate that WWP1 gene amplification is a major cause of ER... + WWP1 gene amplification status or protein expression level is an independent risk factor for poor prognosis in breast cancer patients and can be used to assess patient prognosis. Considering that WWP1 gene amplification has a cis-effect, i.e., leads to high WWP1 expression, this invention further investigated the distribution of WWP1 expression in estrogen subtypes of breast cancer. The results showed that WWP1 is mainly expressed in ER... + High expression in breast cancer ( Figure 8 ).

[0094] 2. To demonstrate that WWP1 expression level can serve as a key gene affecting the cell cycle and to elucidate its molecular mechanism, this invention conducted a series of in vivo and in vitro functional experiments. WWP1 overexpression cells constructed using method 1.3 significantly accelerated cell proliferation; conversely, knockdown of WWP1 significantly slowed cell proliferation (see [link to study]). Figure 9 WWP1-overexpressing and control cells were constructed based on E0771 cells and seeded subcutaneously into C57BL / 6 mice. In vivo experiments showed that WWP1 overexpression accelerated subcutaneous tumor growth. Figure 10 ), and accompanied by an immunosuppressive microenvironment characterized by increased Treg cell infiltration ( Figure 11 ). Through TCGA ER + BRCA and TJMU ER + Analysis of the BRCA clinical cohort confirmed that high WWP1 expression leads to ER + Breast cancer patients have a poor prognosis. Figure 12 a).

[0095] To elucidate its molecular mechanism, method 1.11 was used in the study. The results showed that knockdown of WWP1 caused downregulation of the cell cycle pathway. Figure 12 b). To further clarify the specific mechanism by which WWP1 regulates the cell cycle, steps 1.6, 1.7, and 1.8 were used in the study. The results showed that knocking down WWP1 significantly upregulated the protein level of the cell cycle repressor protein P21 (see [link to study]). Figure 13 a). Interestingly, its mRNA (CDKN1A) level also changed significantly (see Figure 13To investigate how WWP1 regulates p21 mRNA, further research confirmed that WWP1, as an E3 ubiquitin ligase, promotes the ubiquitination of the substrate protein RBMS2 and accelerates its degradation via the proteasome pathway. Western blotting experiments with the proteasome inhibitor (MG132) confirmed that blocking proteasome activity significantly increased RBMS2 protein expression, thus verifying that RBMS2 degradation depends on the WWP1-mediated ubiquitin-proteasome pathway (see [link to study]). Figure 14 Degradation of RBMS2 leads to the loss of its stabilizing effect on P21 mRNA, resulting in downregulation of P21 protein levels, ultimately leading to cell cycle dysregulation and drug resistance.

[0096] 3. To demonstrate whether WWP1 affects the efficacy of CDK4 / 6 inhibitors, this invention conducted in vitro pharmacodynamic experiments. The results showed that in ER... + In breast cancer cell lines MCF7 and T47D, WWP1-overexpressing cells constructed using method 1.3 were insensitive to the CDK4 / 6 inhibitors palbociclib and abexicillin, and exhibited faster cell growth; conversely, knockdown of WWP1 resulted in cells being more sensitive to the corresponding drugs and growing faster (see [link to relevant documentation]). Figure 15 and Figure 16 This result indicates that WWP1 expression level is negatively correlated with sensitivity to CDK4 / 6 inhibitors, and WWP1 overexpression is one of the causes of drug resistance. Furthermore, to demonstrate the effectiveness of the combination therapy strategy targeting WWP1, in vitro and in vivo pharmacodynamic experiments were conducted. In vitro synergistic effect analysis was performed using method 1.5. The results showed that the WWP1 inhibitor indole-3-carbinol (I3C) and palbociclib exhibited a strong synergistic killing effect in MCF7 cells. This synergistic effect disappeared in WWP1 gene knockout cells constructed using method 1.3 (see [link to method 1.3]). Figure 17 This demonstrates the target specificity of the combined effect. In the mouse xenograft tumor model established by Method 1.9, the combination therapy group of I3C and ribociclib showed significantly better tumor growth inhibition than the individual drug treatment groups and the control group (p<0.001, see [link]). Figure 18 Furthermore, the results showed that the combination therapy significantly reduced cell proliferation in tumor tissue (see [link to treatment]). Figure 19 The above results confirm that the combined use of WWP1 inhibitors and CDK4 / 6 inhibitors can be used as a treatment for ER. +This study describes an effective treatment option for breast cancer, particularly in patients with high WWP1 expression or resistance to CDK4 / 6 inhibitors. Furthermore, this application constructed a retrospective cohort of patients treated with local CDK4 / 6 inhibitors, collected pre-treatment samples, performed WWP1 protein immunohistochemical staining (IHC) and WWP1 gene amplification detection (FISH), and conducted initial and best-efficacy clinical assessments. The results showed that WWP1 amplification is associated with CDK4 / 6 inhibitor resistance (see [link to relevant documentation]). Figure 20 ).

[0097] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. The application of a reagent for detecting the expression level of the WWP1 gene or its protein in the preparation of products for predicting the efficacy of CDK4 / 6 inhibitors against estrogen receptor-positive breast cancer, characterized in that: The CDK4 / 6 inhibitor is either palbociclib or abecilib.

2. An application of a combination of a WWP1 inhibitor and a CDK4 / 6 inhibitor in the preparation of a drug for treating estrogen receptor-positive breast cancer, characterized in that: The WWP1 inhibitor is indole-3-methanol; the CDK4 / 6 inhibitor is palbociclib or ribociclib.

Images