A sue1 protein and its use in modulating the length of the mesocotyl or heat-responsive growth ability of a plant
By regulating the expression of SUE1 protein in rice mesocotyls, the problem of rice's hypersensitive elongation response under high-temperature conditions was solved, the elongation capacity of mesocotyls was improved, and the emergence rate and uniformity were enhanced, providing genetic resources and theoretical basis for breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-01-22
- Publication Date
- 2026-05-29
AI Technical Summary
There is a lack of research on the thermal response growth regulation mechanism of rice in the non-stress temperature range in the existing technology, especially in the seedling stage, where the elongation of the mesocotyl is highly dependent on the ambient temperature, resulting in an overly sensitive elongation response under high temperature conditions, which affects the emergence rate and uniformity.
This invention provides a SUE1 protein and its encoded nucleic acid. By regulating the expression level of the SUE1 protein through gene editing, transcriptional gene silencing, or post-transcriptional gene silencing, the expression level of the SUE1 protein can be increased or decreased, thereby improving or decreasing mesocotyl length or heat-responsive growth ability. This invention can be applied to rice breeding to improve its temperature adaptability.
By regulating the expression level of SUE1 protein, the elongation ability of rice mesocotyl under high temperature conditions is enhanced, thereby improving seedling emergence and uniformity, providing genetic resources and theoretical basis for breeding improvement.
Smart Images

Figure CN122103293A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding technology, and in particular to a SUE1 protein and its application in regulating the length of the mesocotyl or the heat-responsive growth ability of plants. Background Technology
[0002] Global warming has become one of the most significant environmental threats facing agricultural production. Studies show that the global average surface temperature is rising and is expected to continue to increase in the future. Temperature is one of the most important environmental factors affecting plant growth and development, finely regulating the entire plant life cycle.
[0003] Rice ( Oryza sativa Rice (L.) is a core crop for maintaining global food security, and its stable production plays a crucial role. However, rising temperatures have a significant negative impact on rice yields. Studies show that with the rise in global average temperature, after excluding interference from carbon dioxide concentration, fertilization effects, and other agronomic practices, the average yield of rice shows a downward trend. High temperatures not only affect the seed setting rate during the reproductive growth stage of rice but also affect the seedling stage, influencing seedling morphology and consequently the uniformity of the plant population and later yields.
[0004] Temperature affects rice throughout its entire growth cycle, from germination to maturity. Its response can be categorized into "heat-responsive growth" under non-stress conditions and "physiological damage" under extreme temperatures. Within the suitable temperature range for non-stress growth, rice exhibits active adaptive growth regulation; that is, as temperature increases, the growth rates of hypocotyl length, root length, and seedling height all increase—a process known as heat-responsive growth. However, when the temperature exceeds the physiological tolerance threshold, rice growth is inhibited, leading to irreversible physiological damage such as seedling wilting due to dehydration, pollen abortion, shortened grain-filling period, and decreased seed setting rate. Current research on rice's high-temperature response focuses primarily on stress damage caused by extreme temperatures, while studies on the molecular mechanisms by which rice achieves adaptive growth through morphological plasticity within non-stress temperature ranges are relatively scarce, especially during the seedling stage.
[0005] The mesocotyl, a key tissue connecting the seed base and coleoptile segment in rice seedlings, is the core organ determining the rice's ability to emerge from the soil. Rapid elongation of the mesocotyl helps seedlings break through the soil layer to receive sunlight, thus completing the crucial transition from heterotrophic to autotrophic growth. In modern direct-seeding rice technology, deep sowing is often used to enhance lodging resistance and avoid bird damage, which places higher demands on the mesocotyl length of the varieties.
[0006] However, mesocotyl elongation is highly dependent on ambient temperature. Under higher temperatures, rice mesocotyls typically undergo heat-responsive growth, promoting elongation to accelerate emergence. While this dramatic morphological change is beneficial for increasing emergence rate, it also reflects the plant's high sensitivity to temperature signals. To deeply understand this complex regulatory network, identifying and analyzing mutants with differentiated temperature response mechanisms is crucial. This is especially true for special genetic materials that are insensitive to temperature changes, such as mutants whose elongation response is sluggish or absent under high-temperature conditions where mesocotyls should elongate significantly. Such phenotypes often suggest that the mutant gene is a core positive regulator in the plant's heat signal perception or downstream growth command execution pathways.
[0007] Therefore, discovering and analyzing these key genes that can break the conventional temperature response pattern will not only help to elucidate the molecular mechanism of rice seedling thermal morphogenesis from the source, but also provide important genetic resources and theoretical basis for future molecular design breeding to precisely regulate the temperature sensitivity and plant type characteristics of crops, as well as to cultivate new rice varieties suitable for mechanized deep sowing. Summary of the Invention
[0008] To address the problems existing in the prior art, this invention provides a SUE1 protein and its application in regulating mesocotyl length or heat-responsive growth ability in plants.
[0009] In a first aspect, the present invention provides a SUE1 protein comprising any of the following amino acid sequences: i) The amino acid sequence as shown in SEQ ID NO.1; ii) An amino acid sequence with the same function obtained by substituting, inserting or deleting one or more amino acids as shown in i).
[0010] The amino acid sequence shown in SEQ ID NO.1:
[0011] Secondly, the present invention provides a nucleic acid for encoding the aforementioned SUE1 protein.
[0012] Furthermore, the nucleic acid includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.2; ii) A nucleotide sequence that encodes a protein with the same function, obtained by substituting, deleting or inserting one or more nucleotides as shown in i).
[0013] The nucleotide sequence shown in SEQ ID NO.2 (including the promoter and 3'UTR sequence [Lu Hao 1]) is as follows:
[0014] Thirdly, the present invention provides a biological material comprising: the aforementioned nucleic acid, wherein the biological material is selected from expression cassettes, vectors, cells, recombinant viral particles, tissues or organs.
[0015] The expression cassette of this invention includes a promoter, a coding sequence (corresponding to the nucleotide sequence of the aforementioned nucleic acid), and a termination signal for terminating the transcription process (e.g., including a terminator and a polyadenylation signal). It can also guide the cell to add a poly(A) tail to the end of the mRNA to increase mRNA stability and translation efficiency. Common examples include SV40 polyA and BGHpolyA. Furthermore, various elements can be added to the expression cassette, such as enhancers, introns, Kozak sequences, Shine-Dalgarno sequences, or selectable marker genes.
[0016] The vectors described in this invention include: plasmid vectors (extrachromosomal circular DNA molecules derived from bacteria or yeast), viral vectors (modified viruses that have had their pathogenicity and self-replication capabilities removed, but retain their ability to efficiently infect cells and deliver genetic material into cells), bacteriophage vectors, or artificial chromosome vectors (e.g., bacterial artificial chromosome BAC or yeast artificial chromosome YAC).
[0017] The transgenic cells described in this invention are cells whose genetic material has undergone stable artificial alterations, such as the introduction of the nucleic acids provided in this application. The transgenic cells described in this invention include animal cells, plant cells, or microbial cells, wherein the animal and plant cells do not have the potential to develop into a complete individual (and do not belong to any animal or plant species).
[0018] The recombinant viral particles described in this invention are in the form of virus-like particles, where a protein coat (viral capsid) encapsulates genetic material (such as the aforementioned nucleic acid). For example, the recombinant viral particles are prepared by transfecting the aforementioned viral vector and other helper plasmids into a packaging cell line (such as HEK293T cells), which will complete the expression and assembly of viral proteins and recombinant genes to obtain complete recombinant viral particles.
[0019] Those skilled in the art, having access to the nucleic acids disclosed in this application, are fully aware of the preparation methods of the aforementioned expression cassettes, vectors, transgenic cells, and recombinant viral particles based on existing technology. There are no technical obstacles involved, and therefore, expression cassettes, vectors, transgenic cells, and recombinant viral particles containing the aforementioned gene mutants are also within the scope of this invention.
[0020] Fourthly, the present invention provides a kit comprising the aforementioned SUE1 protein, or the aforementioned nucleic acid, or the aforementioned biological material.
[0021] Fifthly, the present invention provides the application of the aforementioned SUE1 protein, or the aforementioned nucleic acid, or the aforementioned biological material, or the aforementioned kit in regulating the mesocotyl length or heat-responsive growth ability of plants.
[0022] Furthermore, by reducing the expression level of the SUE1 protein or the aforementioned nucleic acid in the plant, the mesocotyl length or heat-responsive growth capacity of the plant is reduced, and / or by increasing the expression level of the SUE1 protein or the aforementioned nucleic acid in the plant, the mesocotyl length or heat-responsive growth capacity of the plant is increased.
[0023] Further, the expression level of the SUE1 protein or the nucleic acid is reduced by any one or more methods including gene editing, transcriptional gene silencing, or post-transcriptional gene silencing; and / or, Increase the expression level of the SUE1 protein or the nucleic acid by any of the following methods: (1) Increase the copy number of the nucleic acid; (2) Replace the promoter of the nucleic acid; (3) Add enhancers upstream or downstream of the nucleic acid; (4) Optimize the nucleotide sequence of the nucleic acid according to the host type; (5) Modify the SUE1 protein by adding a stabilizing tag or signal peptide.
[0024] Preferably, the gene editing includes: knocking out the nucleic acid using a CRISPR / Cas9, TALEN, or ZFN system; and / or, The transcriptional gene silencing includes: suppressing the expression of the nucleic acid using CRISPR interference or DNA methylation-mediated silencing; and / or, The post-transcriptional gene silencing includes: using RNA interference or antisense RNA to reduce the expression of the nucleic acid.
[0025] In a sixth aspect, the present invention provides the use of the aforementioned SUE1 protein, or the aforementioned nucleic acid, or the aforementioned biological material, or the aforementioned kit in any of the following: (1) Cultivating transgenic plants; (2) Plant variety improvement related to mesocotyl length or heat-responsive growth ability; (3) Improvement of plant germplasm resources.
[0026] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant; Preferably, the plant is a member of the genus *Oryza*. More preferably, the plant is rice.
[0027] The present invention has the following beneficial effects: This invention has screened and obtained a SUE1 protein that is related to the length of the mesocotyl or the heat-responsive growth ability of rice plants. By increasing the expression level of the SUE1 protein or the nucleic acid encoding the protein in rice plants, the length of the mesocotyl or the heat-responsive growth ability of rice plants can be increased, that is, the ability of rice plants to elongate their mesocotyls at high temperatures can be enhanced, thus giving them better soil-breaking ability.
[0028] The SUE1 protein and the nucleic acid encoding the protein provided by this invention can be used to cultivate rice varieties with high heat-responsive growth capabilities, which has important application value in the field of rice breeding. Attached Figure Description
[0029] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0030] Figure 1 This is provided by the embodiments of the present invention. sue1 Phenotypic identification results; where a is ZH11, eg1 , sue1 eg1 , sue1 Phenotypic results were obtained after 4 days of growth under two temperature conditions: a low ambient temperature of 25℃ and a high ambient temperature of 32℃. Arrows indicate the location of coleoptile nodes, and the scale bar is 1 cm. b represents the statistical data on mesocotyl length of materials with different genotypes and temperatures in a. Data are expressed as mean ± standard deviation (n ≥ 15). Tukey's test was used for analysis, and different letters indicate statistically significant differences. p <0.05); c represents the longitudinal section phenotype of cells in the middle of the mesocotyl of materials with different temperature and genotype combinations. Red boxes mark representative cells in each combination whose length and width are close to the mean. The scale bar is 100 μm. df represents the statistical values of cell length (d) and width (e) in c (n ≥ 150), and the calculated cell number (f, mesocotyl length / cell length, n = 3). Data are expressed as mean ± standard deviation. The Tukey test was used for analysis, and different letters indicate statistically significant differences (…). p <0.05).
[0031] Figure 2 This is provided by the embodiments of the present invention. SUE1 Gene localization and candidate gene identification results; where a is SUE1 Map-based cloning, where horizontal lines represent chromosomes and vertical lines represent molecular markers, in SUE1In the gene structure, black squares, white squares, and black lines represent exons, non-coding regions, and introns, respectively; b is the candidate gene annotated through the SMART website, obtaining a PWWP domain for 248-309 aa, an AT-hook domain for 468-480 aa, and a low-complexity domain shown in the pink box.
[0032] Figure 3 yes SUE1 Phenotypic analysis results of gene complementation vectors and gene knockout vectors; where a is SUE1 Genotype of T0 generation of gene-complementing material; b is SUE1 Genotype of T1 generation of gene knockout material; c represents the mesocotyl phenotype of gene complementation and gene knockout material, with arrows indicating the position of coleoptile nodes, and a scale bar of 1 cm; d represents the mesocotyl length statistics of c (n ≥ 20). Data are expressed as mean ± standard deviation. Tukey's test was used for analysis, and different letters indicate statistically significant differences. p <0.05).
[0033] Figure 4 Under high ambient temperature SUE1 The gene expression levels and the accumulation of their encoded proteins were both increased; where a represents the expression levels of ZH11 and its encoded protein under two temperature conditions of 25℃ and 32℃. sue1 In mesocotyl samples SUE1 Relative gene expression levels, expressed as mean ± standard deviation (n = 3), were analyzed using the Tukey test, with different letters indicating statistically significant differences. p <0.05); b is the analysis of protein accumulation levels of SUE1-GFP in transgenic plants at three time points after two constant temperature treatments at 25℃ and 32℃ and a temperature transfer experiment from 25℃ to 32℃. SUE1 tagged with GFP was used as the experimental group, and Actin was used as the internal control. The gray value of the protein band was measured using ImageJ software. The expression level of SUE1-GFP was first standardized by the corresponding Actin internal control band, and then the relative expression level was calculated based on the expression level under 25℃ conditions. Detailed Implementation
[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0035] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0036] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0037] Example 1: Isolation and genetic analysis of genes controlling rice's adaptation to high ambient temperature. This invention first uses rice eg1-2 Mutants (background: Zhonghua 11, ZH11) were used as materials for EMS (Ethylmethylsulfone) mutagenesis. Individual plants with normal mesocotyl length were screened from the M2 generation population to obtain... sue1 eg1 Double mutant. sue1 eg1 Separation from wild-type backcross sue1 Single mutant. Discovered. sue1 The mesocotyl length of the single mutant was similar at both low ambient temperature (25℃) and high ambient temperature (32℃), exhibiting a phenotype that was insensitive to temperature response. Figure 1 (ab). To further investigate whether the mesocotyl elongation is caused by cell division or cell elongation, resin section analysis was performed on wild-type and mutant mesocotyl cortical cells. The results showed... sue1 The mutant cell length was similar to that of the wild type, but the average cell number was significantly reduced, indicating that... sue1 The shortening of the mesocotyl in mutants is mainly due to reduced cell division. Figure 1 (cf).
[0038] In order to study the cause sue1 The molecular-level reasons for the phenotypic effect, this invention will address the ZH11 background. sue1 eg1-2 and eg1-2 Perform a backcross. F1 is similar. eg1-2 The phenotype initially indicates sue1 The encoded gene is recessive. Further analysis of the segregation ratio in the F2 generation, using a chi-square test, revealed phenotypic similarities in the F2 generation. eg1-2 and similar sue1 eg1-2 The segregation ratio of individual plants conformed to 3:1, indicating that sue1 eg1 Phenotypic recovery in this model is controlled by a single recessive nuclear-coding gene. Further investigation is being conducted using map-based cloning and resequencing to identify the controlling gene. sue1 Candidate genes for phenotype. This invention uses Japonica rice ZH11 background... sue1 eg1-2 Double mutant and ZF802 background of indica rice eg1 mutant eg1-1 Perform hybridization and screening sue1 eg1-2 × eg1-1Phenotypic similarity in the F2 generation of indica-japonica hybrids sue1 eg1-2 Map-based cloning was performed on single plants to locate candidate genes within a region of 22.38–23.56 Mb on chromosome 5. Further analysis of ZH11 and... sue1 eg1 Resequencing, to find a gene located within the target region. LOC_Os05g38810 A non-synonymous mutation site in the coding region, specifically a C>T mutation at exon 2191, changes the amino acid at position 731 from glutamine to a stop codon, leading to premature gene termination. Figure 2 (a) Since there are currently no reports on the function of this gene, this invention names it... SUE1 ( Su ppressor of e g1 Domain annotation of the protein encoded by this gene yielded a PWWP domain located at positions 248-309 of the protein. Figure 2 (b). However, since the mutation site in sue1 is located downstream of the PWWP domain, the mutation does not directly disrupt the domain sequence.
[0039] Example 2: SUE1 Construction of complementary vectors and rice genetic transformation From wild-type medium-flower 11 SUE1 The complete gene, which is the nucleotide sequence shown in SEQ ID No. 2 (including its own promoter sequence, genome sequence, and 3' untranslated region sequence), was amplified by DNA polymerase using PCR, and then ligated by restriction enzymes. pCAMBIA2300 At the multiple cloning site of the plasmid, a complementary vector was obtained. pSUE1::gSUE1 ( Figure 3 ). At the same time, SUE1 The coding region sequence is linked to a Ubiquitin promoter and a GFP fluorescent tag. pCAMBIA1300 plasmids were used to obtain complementary vectors. Ubi::SUE1-GFP ( Figure 3 ).
[0040] Transform the aforementioned constructed complementary carrier to E. coli Positive clones were selected using kanamycin in DH5α competent cells. Plasmids were extracted and sequenced to identify the clones in the vector. TOMS1 A sequence-complete positive clone was obtained, and then the plasmid of this positive clone was electrotransformed into EHA105 Agrobacterium competent cells (prepared using conventional methods, referring to *Plant Genetic Engineering*, Wang Guanlin and Fang Hongyun, Science Press, 2nd edition, 2004). Next, the successfully transformed clone was infected using Agrobacterium... sue1 Transgenic manipulation is performed on the recipient.
[0041] Example 3: SUE1 Phenotypic analysis of complementary transgenic plants To test SUE1 Can they complement each other? sue1 The phenotype of the positive plants obtained from the transgenic experiment in Example 2 was compared with that of the positive plants. sue1 eg1 / pSUE1::gSUE1, sue1 eg1 / Ubi::SUE1-GFP With ZH11, eg1 and sue1 eg1 Phenotypic comparison revealed that in both complementary materials, the mesocotyl was significantly elongated, exhibiting characteristics similar to... eg1 Similar phenotypes ( Figure 3 (a and cd). This result illustrates SUE1 It is the target gene that controls the mesocotyl elongation phenotype in the target mutant.
[0042] Example 4: Knockout SUE1 Genes can make the mesocotyl insensitive to high ambient temperatures. This invention utilizes conventional molecular biology and genetic manipulation methods (referencing *Plant Genetic Engineering*, Wang Guanlin and Fang Hongyun, Science Press, 2nd edition, 2004, prepared using conventional methods) to... CRISPR / Cas9 Gene editing technology (guidesequence: TGGGGGAGATGGTGGCGAGGAGG) constructed sue1 Two allelic mutants sue1-crispr-1 and sue1-crispr-2 They are respectively in SUE1 A 1 bp insertion and a 2 bp deletion following the 364th bp of the gene CDS both resulted in premature termination of the encoded protein. Figure 3 (b)
[0043] To test SUE1 The effects of loss of function on rice response to high ambient temperature were analyzed, and ZH11 was analyzed. eg1 , sue1 eg1 , eg1 / sue1-crispr-1 and eg1 / sue1-crispr-2 The mesocotyl phenotype. The results showed that two [types / phenotypes] were [related to] the eg1 The mesocotyls of the background gene knockout materials were significantly shortened and exhibited a phenotype that was insensitive to temperature changes. Figure 3 (middle bd).
[0044] This result indicates SUE1 It is a positive regulator of mesocotyl elongation and plays a promoting role in controlling the rice's response to high ambient temperatures.
[0045] Rice is one of the most important food crops, and its normal adaptive response to environmental temperature is the foundation for its normal growth, development, and maturation. This invention clones key factors controlling rice's adaptation to high environmental temperatures, providing important guidance for improving rice's adaptability to environmental temperature through rice genetic engineering and molecular breeding.
[0046] Example 4: Temperatures at different levels SUE1 Analysis of gene expression and the accumulation of its encoded proteins In order to determine SUE1 To determine how to respond to changes in ambient temperature, this invention first tested the results at 25°C and 32°C. SUE1 Gene expression levels. qRT-PCR analysis results showed that in the ZH11 mesocotyl... SUE1 Gene expression is induced by high ambient temperature, while sue1 In mutants, SUE1 Gene expression and temperature response were significantly reduced. Figure 4 (a)
[0047] Then, this invention utilizes transgenic complementary lines sue1 eg1 / Ubi::SUE1-GFP The protein levels of SUE1-GFP under both steady-state and dynamic temperature conditions were detected. The differences in protein accumulation between plants under isothermal conditions of 25℃ and 32℃ were compared, and the dynamic changes in protein accumulation at multiple time points after transfer from 25℃ to 32℃ were analyzed. The results showed that higher ambient temperatures significantly promoted SUE1 protein accumulation. Under isothermal conditions of 32℃, the protein accumulation level was significantly higher than that at 25℃. Furthermore, the SUE1 protein responded very rapidly to temperature; its protein accumulation level increased significantly one hour after the temperature transfer experiment and reached a level comparable to that of plants cultured at 32℃ after two hours.
[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A SUE1 protein, characterized in that, Includes any of the following amino acid sequences: i) The amino acid sequence as shown in SEQ ID NO.1; ii) An amino acid sequence with the same function obtained by substituting, inserting or deleting one or more amino acids as shown in i).
2. A nucleic acid, characterized in that, The nucleic acid is used to encode the SUE1 protein of claim 1.
3. The nucleic acid according to claim 2, characterized in that, The nucleic acid includes any of the following nucleotide sequences: i) The nucleotide sequence shown in SEQ ID NO.2; ii) A nucleotide sequence that encodes a protein with the same function, obtained by substituting, deleting or inserting one or more nucleotides as shown in i).
4. A biomaterial, characterized in that, include: The nucleic acid of claim 2 or 3, wherein the biological material is selected from expression cassettes, vectors, cells, recombinant viral particles, tissues or organs.
5. A reagent kit, characterized in that, The kit comprises the SUE1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biological material of claim 4.
6. The use of the SUE1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biomaterial of claim 4, or the kit of claim 5 in regulating the mesocotyl length or heat-responsive growth ability of plants.
7. The application according to claim 6, characterized in that, By reducing the expression level of the SUE1 protein or the nucleic acid of claim 2 or 3 in the plant, the mesocotyl length or heat-responsive growth capacity of the plant is reduced, and / or by increasing the expression level of the SUE1 protein or the nucleic acid in the plant, the mesocotyl length or heat-responsive growth capacity of the plant is increased.
8. The application according to claim 6 or 7, characterized in that, The expression level of the SUE1 protein or the nucleic acid is reduced by any one or more of the following methods: gene editing, transcriptional gene silencing, or post-transcriptional gene silencing; and / or, Increase the expression level of the SUE1 protein or the nucleic acid by any of the following methods: (1) Increase the copy number of the nucleic acid; (2) Replace the promoter of the nucleic acid; (3) Add enhancers upstream or downstream of the nucleic acid; (4) Optimize the nucleotide sequence of the nucleic acid according to the host type; (5) Modify the SUE1 protein by adding a stabilizing tag or signal peptide. Preferably, the gene editing includes: knocking out the nucleic acid using a CRISPR / Cas9, TALEN, or ZFN system; and / or, The transcriptional gene silencing includes: suppressing the expression of the nucleic acid using CRISPR interference or DNA methylation-mediated silencing; and / or, The post-transcriptional gene silencing includes: using RNA interference or antisense RNA to reduce the expression of the nucleic acid.
9. The use of the SUE1 protein of claim 1, or the nucleic acid of claim 2 or 3, or the biological material of claim 4, or the kit of claim 5, in any of the following: (1) Cultivating transgenic plants; (2) Plant variety improvement related to mesocotyl length or heat-responsive growth ability; (3) Improvement of plant germplasm resources.
10. The application according to any one of claims 6-9, characterized in that, The plant is a monocotyledonous plant or a dicotyledonous plant; Preferably, the plant is a member of the genus *Oryza*. More preferably, the plant is rice.