An antigenic epitope polypeptide and a paralichthys ovatus mucin mucus b specific antibody prepared therefrom
By screening for Muc5b antigenic epitopes in turbot using bioinformatics, preparing specific antibodies and developing corresponding detection tools, the problem of lack of specific recognition in fish mucosal immunity research has been solved, enabling precise detection of Muc5b and research on mucosal immune function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-29
- Publication Date
- 2026-05-29
AI Technical Summary
The lack of antibodies that specifically recognize fish Muc5b in current technologies has hindered the research progress on fish mucosal immune defense mechanisms and made it difficult to deeply understand the function of Muc5b in mucosal immunity and its role in disease development.
The antigenic epitopes of Muc5b from turbot were screened using bioinformatics analysis. After preparation and conjugation with a vector, the antibodies were immunized in New Zealand white rabbits to obtain specific antibodies. A matching kit was then used to detect the expression and distribution of Muc5b.
Antibodies that can specifically label Muc5b and Muc5b-positive mucus cells in turbot mucosal tissue have been successfully prepared, providing a key detection tool for assessing mucus cell density and distribution, evaluating the relationship between mucus secretion and fish health, and supporting research on fish mucosal immunity.
Smart Images

Figure CN122103301A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of immunobiological products technology, specifically relating to an antigenic epitope polypeptide and its preparation in turbot ( Paralichthys olivaceus Mucin Muc5b specific antibody. Background Technology
[0002] As an early immune barrier formed during biological evolution, the mucosal system of fish plays a crucial role in coping with the challenges of complex aquatic environments. The epithelial layer of fish organs such as gills, intestines, and skin is richly populated with goblet cells (mucus cells), which secrete mucus that forms a dynamically renewing protective hydrogel. This mucus layer possesses multiple functions, including physical lubrication, biochemical defense, and signal transduction. Its three-dimensional network structure contains effector molecules such as lysozyme, immunoglobulins, antimicrobial peptides, and lectins, effectively blocking the colonization and spread of pathogens on the epithelial surface and clearing pathogens through periodic shedding. Because fish are directly immersed in aquatic environments rich in microorganisms, the defensive function of their surface mucus is particularly important compared to terrestrial animals.
[0003] Mucins, as core structural components of mucus gel networks, can be divided into two main categories based on their molecular structure: transmembrane and gel-forming types. Muc5b is a typical representative of gel-forming mucins. Synthesized and secreted by mucous cells in the mucosal epithelium, its molecular conformation rearranges and rapidly hydrates and swells, forming a gel-like framework with a three-dimensional network structure. This framework not only endows mucus with suitable viscoelastic and rheological properties but also provides a platform for the action of various immunologically active molecules, enabling them to effectively clear pathogenic microorganisms adhering to glycan chains, thereby maintaining mucosal immune homeostasis. In mammals, the function of MUC5B has been extensively studied. Using specific antibodies as tools, researchers have revealed the core role of MUC5B in airway mucus clearance and mucosal barrier maintenance, and confirmed that its dysregulation is closely related to the occurrence and development of various diseases. For example, MUC5B expression is significantly upregulated in nasopharyngeal carcinoma tissues and participates in tumor immune escape by regulating the Wnt / β-catenin signaling pathway; in patients with pulmonary fibrosis, genetic variations in the promoter region of the MUC5B gene can significantly increase disease susceptibility. These findings make MUC5B an important target for disease diagnosis and treatment. In contrast, research on fish Muc5b is still in its early stages, lacking antibodies that specifically recognize fish Muc5b. This makes it difficult to conduct in-depth research on the tissue distribution, expression regulation, and functional mechanisms of Muc5b at the protein level. Related studies are mostly limited to biochemical analysis of glycan structures, severely hindering the progress of research on fish mucosal immune defense mechanisms. Therefore, developing highly efficient and specific fish Muc5b antibodies is of significant theoretical and practical value for a deeper understanding of the molecule's function in fish mucosal immunity and for exploring its role in disease development.
[0004] Flounder is an important and high-quality farmed fish in my country, but frequent diseases cause serious economic losses to the aquaculture industry. The mucosal immune system, as the first line of defense against pathogen invasion in fish, directly affects fish health and survival rates. This invention successfully cloned the Muc5b gene of flounder and prepared a highly efficient and specific antibody. This antibody can serve as a molecular probe to recognize flounder mucus cells and mucin, used to detect changes in mucin expression after disease infection, vaccination, or administration of immune enhancers and functional feeds, assess mucus cell density and distribution, and the relationship between mucus secretion and fish health. It provides a key detection tool for fish mucosal immunity research and quantitative indicators for evaluating the efficacy of novel fish mucosal preparations such as oral vaccines and immersion vaccines, as well as functional feeds. The development of this antibody will help establish a health monitoring technology for farmed fish based on mucosal barrier function, serving the practical needs of disease prevention and control in the flounder aquaculture industry. Summary of the Invention
[0005] This invention provides an antigenic epitope polypeptide and its preparation in turbot ( Paralichthys olivaceus The provided antibody, a specific antibody against mucin Muc5b, can specifically label Muc5b and Muc5b-positive mucus cells in turbot mucosa tissue. This provides an important tool for subsequent research on the immune response characteristics of turbot mucin and mucus cells, clarifying the molecular mechanism of mucus secretion disorders, elucidating the functional role of the mucus barrier in mucosal immunity and its connection with disease occurrence.
[0006] This invention first provides a B-cell antigenic epitope polypeptide for preparing a Muc5b-specific antibody against turbot, the specific amino acid sequence of which is NDKQRSKQCEDYQVV (SEQ ID NO:1).
[0007] The present invention also provides a derivative polypeptide of the antigenic epitope polypeptide, which is a polypeptide obtained by substituting, deleting, or adding one or more amino acids to the B cell antigenic epitope polypeptide with the amino acid sequence SEQ ID NO:1, and can also be used to specifically prepare a specific antibody against turbot Muc5b.
[0008] This invention also protects a coupled protein, which has a molecule for enhancing immune effects coupled to the 5′ or 3′ end of a B cell antigenic epitope polypeptide or a derivative thereof with the amino acid sequence SEQ ID NO:1.
[0009] As a specific example, the molecule used to enhance the immune effect is KLH (hemocyanin).
[0010] The present invention also provides a specific antibody, which is prepared by immunizing animals with the above-mentioned antigenic epitope polypeptide;
[0011] The animal described, as a specific example, is the New Zealand White Rabbit;
[0012] The method for preparing the specific antibody in this invention involves conjugating the B-cell antigen epitope of turbot Muc5b to a vector, immunizing New Zealand white rabbits, and then processing the serum to obtain the anti-turbot Muc5b specific antibody.
[0013] The application of the specific antibody against turbot Muc5b provided by this invention in the preparation of a reagent for identifying turbot mucin Muc5b.
[0014] The application of the specific antibody against turbot Muc5b provided by this invention in the preparation of reagents for studying Muc5b-positive mucin cell immune responses.
[0015] This invention also provides a kit for detecting or tracing Muc5b and Muc5b-positive mucin cells in paraffin or frozen sections of turbot, the kit comprising, in addition to specific antibodies:
[0016] 1) Antigen retrieval solution (0.01 M sodium citrate buffer, pH 6.0) is used to break the cross-links between the aldehyde fixative and the antigenic determinant under high temperature conditions, thereby exposing the antigenic epitope;
[0017] 2) 5% bovine serum albumin (BSA) blocking solution (prepared with 0.01 M PBS) is used to block non-specific binding sites on the slides and reduce non-specific adsorption;
[0018] 3) Cy3-labeled goat anti-rabbit IgG antibody (1:1000, diluted in 0.01 M PBS) was used to specifically recognize Muc5b-specific antibodies, showing Muc5b-positive cells;
[0019] 4) DAPI (1:2000, diluted in 0.01 M PBS) was used to stain cell nuclei.
[0020] The 0.01M sodium citrate buffer (pH 6.0) contains the following components: 3.8 mL of 0.1M citric acid solution and 16.2 mL of 0.1M sodium citrate buffer are mixed and then distilled water is added to a final volume of 200 mL.
[0021] The 0.01 M PBS (1 L, pH 7.4) contained the following components: 8.0 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, and 0.24 g KH2PO4, with the pH adjusted to 7.4 using HCl.
[0022] This invention discloses a specific antibody against the mucin Muc5b of turbot, its preparation method, and its applications. The invention obtains the turbot Muc5b gene using molecular cloning technology, identifies its B-cell antigenic epitopes through bioinformatics analysis, synthesizes antigens using these epitopes, and immunizes animals, successfully preparing a specific antibody against the turbot Muc5b protein. Verification results show that this antibody can specifically bind to the Muc5b protein and Muc5b-positive mucus cells in turbot mucosal tissue, achieving precise identification and localization of target cells. Based on this antibody, this invention can detect changes in Muc5b expression in turbot at both the gene and protein levels under disease occurrence or vaccine immunization stimulation, thus providing key technical support for studying the role of mucins in fish mucosal immunity. Furthermore, this antibody, as a specific molecular probe targeting Muc5b, has significant application prospects in the immunodiagnosis of turbot mucus diseases and the development of related detection reagents. Attached Figure Description
[0023] Figure 1 Phylogenetic tree of Muc5b molecules constructed using the neighbor-joining method;
[0024] Figure 2 Transmembrane sequence analysis of Muc5b from turbot;
[0025] Figure 3 : Sequence analysis diagram of the Muc5b signal peptide of turbot;
[0026] Figure 4 : Analysis diagram of the structural domains of the turbot Muc5b protein;
[0027] Figure 5 : Exon and intron distribution diagram of the turbot Muc5b molecule;
[0028] Figure 6 Secondary structure diagram of turbot Muc5b;
[0029] Figure 7 : Prediction map of B cell linear antigenic epitopes of Muc5b analyzed by IEDB software;
[0030] Figure 8 : Analysis of antigenic epitope parameters of the Muc5b molecule predicted by DNAStar software;
[0031] Figure 9 The tertiary structure model of the Muc5b protein molecule and the final selected antigenic peptide;
[0032] Figure 10 Western blot analysis of the binding of Muc5b specific antibody to the natural mucin of turbot intestine, where M represents the marker and NC represents the negative control;
[0033] Figure 11 Image showing the specific binding reaction of Muc5b-specific antibody to the mucin Muc5b in the gill, hindgut, skin, and olfactory sac (OS) of turbot using indirect immunofluorescence (40× objective). Neg (Negative) indicates a negative control using rabbit negative serum instead of Muc5b antibody. Wherein WGA: wheat germ lectin; IE: epithelial layer; LP: lamina propria; ML: mucus layer; Lu: intestinal lumen; EPI: epidermis; BC: gill cavity; LA: gill lamellae; NC: nasal cavity; OE: nasal mucosal epithelium. Detailed Implementation
[0034] This invention screened specific antigenic sites of turbot Muc5b through bioinformatics analysis, prepared turbot Muc5b antibodies accordingly, and successfully identified Muc5b-positive mucin cells and their secreted mucus at the tissue level using these antibodies. This lays the foundation for in-depth research on the functional characteristics of turbot mucin cells and evaluation of the level of mucus immune response in fish.
[0035] The objective of this invention is achieved through the following technical solution:
[0036] The gene sequence and amino acid sequence structure of the turbot Muc5b molecule were obtained through gene cloning. After bioinformatics verification and antigenicity analysis, amino acid sequences with high antigenicity were screened for peptide synthesis. The screened turbot Muc5b B-cell antigenic epitopes were conjugated to a vector, and New Zealand white rabbits were immunized. Serum was collected and processed to obtain anti-turbot Muc5b specific antibodies.
[0037] Enzyme-linked immunosorbent assay (ELISA) results showed that the specific antibody against the turbot Muc5b molecule could specifically bind to the corresponding synthetic peptide.
[0038] Western blot analysis showed that specific antibodies against the Muc5b molecule in turbot can specifically bind to the natural mucin in the intestinal mucus of turbot.
[0039] Indirect immunofluorescence labeling of turbot tissue sections was performed using the Muc5b antibody prepared according to this invention. The results showed that specific positive signals were detected in the gills, hindgut, skin, and olfactory sac. The signal was clearly distributed in the mucus layer and the cytoplasmic region of mucus cells, and appeared as scattered punctate distributions in the interstitial spaces around the cells.
[0040] This invention utilizes annotation information from the turbot genome database to obtain the CDS (coding region) sequence of the Muc5b gene. Specific amplification primers were designed for this CDS region, and cDNA synthesized from total RNA reverse transcribed from turbot tissue was used as a template for RT-PCR amplification. The PCR product was purified and ligated into the pMD19-T vector, transformed into DH5α competent cells, and positive clones were selected for bidirectional sequencing after colony PCR identification. Sequencing results showed that the obtained cDNA fragment was 1203 bp in length, completely consistent with the predicted CDS sequence of the turbot Muc5b gene, confirming the successful cloning of the turbot Muc5b gene CDS region fragment.
[0041] Bioinformatics analysis of the cloned Muc5b gene in this invention revealed 12 exons and 11 introns; it possesses four typical Mucin2_WxxW domains. SignalP and TMHMM analyses showed that Muc5b has a signal peptide in the N-terminus (amino acids 1-23) and lacks transmembrane and intracellular regions, confirming that Muc5b is a secretory protein. Phylogenetic analysis of the turbot Muc5b using the NJ method showed that turbot Muc5b clusters well with other bony fishes and with the European flounder (…). Platichthys flesus The species is most closely related, and this kinship aligns with its evolutionary direction. Indirect enzyme-linked immunosorbent assay (ELISA) results showed that the turbot Muc5b antibody specifically binds to the Muc5b antigen peptide. Immunoblot results showed that the turbot Muc5b antibody specifically recognizes the natural intestinal mucus protein, while rabbit negative serum (as a control) could not bind to the natural mucin Muc5b, demonstrating the good specificity of the prepared Muc5b antibody. Immunofluorescence assay results showed that the turbot Muc5b-specific antibody can recognize Muc5b-positive mucus cells in the gills, hindgut, skin, and olfactory sac, as well as the mucin Muc5b in the mucus layer.
[0042] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0043] Example 1: Gene cloning of the turbot Muc5b molecule
[0044] 1) Primer design for the conserved sequence of the Muc5b gene
[0045] The CDS region sequence of the turbot Muc5b protein, published on NCBI, was located. Specific amplification primers for this CDS region were designed using Primer Premier 5.0 software, and parameters such as primer dimer, hairpin structure, and annealing temperature were evaluated. The final primer pair (forward primer: AGACCTCCACTTATTCCTCACG; reverse primer: GACATGATCTGTGCAGAAACTCATC) was confirmed, and primer synthesis was performed by Qingke Biotechnology Co., Ltd.
[0046] 2) Amplification of the gene core fragment
[0047] Using cDNA synthesized from total RNA reverse transcribed from turbot tissue as a template, PCR amplification was performed using specific primers designed targeting the CDS region of the Muc5b gene. After the reaction, an appropriate amount of PCR product was electrophoresed on a 1.0% agarose gel, and the results were observed and recorded under a gel imaging system. The target fragment of the expected size was excised from the gel, purified, and ligated into the pMD19-T vector, which was then transformed into E. coli DH5α competent cells. After colony PCR identification, positive single colonies were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for bidirectional sequencing. The sequence results returned by sequencing were compared with known sequences in the NCBI database using BLAST to confirm the accuracy of the amplified product (1203 bp).
[0048] 3) Bioinformatics analysis of the Muc5b protein sequence of turbot
[0049] BLAST results showed that the Muc5b protein possesses a typical Mucin2_WxxW domain. A phylogenetic tree of the turbot Muc5b molecule was constructed using MEGA 5.0 software. Figure 1 Multiple sequence alignment analysis of the obtained turbot Muc5b protein sequence with sequences from other species was performed using DNAMAN software. The results showed that the turbot Muc5b molecule is similar to that of the European flounder (Platycodon grandiflorus). Platichthys flesus The Muc5b sequence has the highest homology.
[0050] Example 2: Screening for Muc5b antigenic peptide epitopes in turbot
[0051] (1) Analysis using the TMHMM website (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ) confirmed that the Muc5b protein lacks a transmembrane domain and an intracellular region, classifying it as a secretory protein. Figure 2 The signal peptide sequence of the Muc5b protein was analyzed using the Signal IP website (https: / / services.healthtech.dtu.dk / service.php?SignalP-5.0). The results showed that the first 23 amino acids from the end of the Muc5b protein constitute the signal peptide sequence. Figure 3 ).
[0052] (2) Analysis of the Muc5b protein domains showed that amino acids 28-111, 120-203, 215-298, and 307-391 fold into typical Mucin2_WxxW domains. Figure 4 ).
[0053] (3) The number of exons and introns in the Muc5b gene of turbot are 12 and 11, respectively. Figure 5 ).
[0054] (4) Analysis of the secondary structure of turbot Muc5b protein showed that the β-sheet and random coil sections of the secondary structure exhibited good immunogenicity and reactivity; α-helices accounted for 5.34%, extended chains for 3.07%, and random coils for 91.59%; the distribution of various structures in the amino acid sequence of turbot Muc5b is shown in the figure. Figure 6 .
[0055] (5) Analysis of the antigens of the Muc5b protein revealed that the B-cell linear antigenic site sequence of the Muc5b protein mainly consists of amino acid residues such as 5-60, 71-86, 115-151, 163-172, 206-308, and 310-338. Figure 7 ).
[0056] (6) The amino acid sequence of Muc5b from turbot was analyzed using DNAStar software. The main analytical parameters included hydrophilicity (Hydrophilicity Plot - Kyte-Doolittle), flexibility (Flexible Regions - Karplus-Schulz), antigenicity (Antigenic Index - Jameson-Wolf), and surface probability (Surface Probability Plot - Emini). Based on the above analysis, amino acid segments with a hydrophilicity index ≥0, a surface probability index ≥1, and an antigenicity index ≥0 were selected as potential epitopes in the β-turn and random coil regions. Figure 8 The appropriate antigenic epitopes in the Muc5b protein molecule of turbot can be identified.
[0057] The three-dimensional structure of the turbot Muc5b protein was predicted using the artificial intelligence tool AlphaFold3. Subsequently, the predicted model was optimized and rendered using PyMOL software, and mapped onto the corresponding crystal structure models to highlight its structural features. In the three-dimensional structure model, the identified antigenic epitopes were highlighted as spheres. This display method clearly indicates that they are located on the outer surface of the protein molecule, have good solvent accessibility, and are easily recognized and bound by antibodies. Figure 9 ).
[0058] Example 3: Preparation of Muc5b-specific antibody against turbot
[0059] (1) Determine the antigenic peptide site
[0060] The site of the antigenic peptide was finally determined based on the predicted data from Example 2. First, antigenic epitopes located in signal peptides, transmembrane regions, and intracellular regions were excluded. Second, antigenic epitope parameters and predicted potential linear B-cell antigenic epitopes were analyzed. Finally, antigenic epitopes located in random coil and β-turn regions of the secondary structure were analyzed to determine the specific location of the antigenic peptide. The three-dimensional structure of the turbot Muc5b protein molecule was constructed, and the turbot Muc5b antigenic peptide was finally selected. 281 NDKQRSKQCEDYQVV 295 Located on the surface of protein molecules, it can be used to prepare Muc5b-specific antibodies. The antigenic peptide was synthesized by the company and conjugated with hemocyanin; its purity was detected by mass spectrometry.
[0061] (2) Immunity
[0062] New Zealand white rabbits were immunized with a Muc5b antigen peptide-hemocyanin (KLH) conjugate complex to prepare specific polyclonal antibodies. A total of five immunizations were administered, including a primary immunization and four booster immunizations, each seven days apart. For the primary immunization, the immunogen was thoroughly emulsified with an equal volume of Freund's complete adjuvant; for the booster immunizations, the immunogen was emulsified with an equal volume of Freund's incomplete adjuvant. After emulsification, 100 μL was injected subcutaneously at six points on the rabbit's back and groin. Three days after the last immunization, whole blood was collected via cardiac sampling. The collected blood was allowed to stand at room temperature for 3 hours, then placed overnight at 4 °C. The following day, the blood sample was centrifuged at 8000 g for 15 minutes at 4 °C, and the supernatant was carefully collected and frozen at -80 °C to obtain the rabbit anti-Muc5b specific polyclonal antibody.
[0063] Example 4: ELISA determination of Muc5b antibody titer
[0064] (1) Adjust the antigen concentration to 50 μg / mL with PBS, add 100 μL to each well of a 96-well plate, and perform 3 replicates. The negative control is rabbit negative serum, and the positive control is encapsulated with irrelevant proteins and incubated with the uncoupled KLH Muc5b antigen peptide.
[0065] (2) Coat overnight at 4 ℃. The next day, discard the coating solution, add 100 μL PBST to the plate, shake and wash, repeat 3 times, 5 min each time. Finally, wipe the plate clean on filter paper, add 100 μL BSA solution, and block at 37 ℃ for 1.5 h.
[0066] (3) Repeat the washing process above, add 100 μL of specific antibody to each well, and incubate at 37 °C for 1 h.
[0067] (4) Wash three times with PBST, spin dry, add 100 μL of alkaline phosphatase-labeled secondary antibody, incubate at 37 °C for 1 h, and wash again.
[0068] (5) Add 100 μL of pNPP color development solution, develop color in the dark for 10 min, preheat the microplate reader for 30 min and then detect OD 405, 20 cycles.
[0069] The result showed that the Muc5b antibody titer was 1:16000.
[0070] Example 5: Identification of Muc5b-specific antibodies by Western blotting
[0071] (1) SDS-AGE electrophoresis
[0072] ① The previously extracted and purified flounder intestinal mucoprotein was added to a sample buffer containing sodium dodecyl sulfate in equal proportions, reduced at 95 °C for 30 min, and then iodoacetamide with a final concentration of 25 mM was added. The mixture was then incubated at room temperature in the dark for 1 h.
[0073] ② Add the sample treated in ① to each well, 10 µL of sample per well. Electrophoresis is performed at 100 V for 1 h until the blue band indicated by bromophenol blue reaches 2 / 3 of the gel. Remove the gel for transfer to a membrane.
[0074] ③ Cut a polyvinylidene fluoride (PVDF) membrane (0.45 μm pore size) the same size as the electrophoresis gel, activate it by soaking in methanol, and then transfer it to electrotransfer buffer (25 mmol / L Tris-Base, 192 mmol / L glycine, pH 8.3) for equilibration. Simultaneously, briefly equilibrate the electrophoretically extracted gel in the electrotransfer buffer. Prepare the transfer interlayer in the order of "sponge-filter paper-gel-PVDF membrane-filter paper-sponge," carefully removing air bubbles between each layer.
[0075] ④ Place the assembled transfer clamp into the electrotransfer cell, with the gel facing the negative electrode and the membrane facing the positive electrode. Set the electrophoresis constant current to 200 mA and perform protein electrotransfer for 5 h.
[0076] ⑤ After the transfer is complete, remove the PVDF membrane.
[0077] (2) Immunoblotting
[0078] ① Wash the PVDF membrane with PBS for 15 min, then block it in 5% BSA for 1 h at 37 ℃;
[0079] ② Wash three times with PBST, 5 min each time; add turbot Muc5b antibody and incubate at 37 ℃ for 1 h. Use rabbit negative serum as a negative control;
[0080] ③ Wash three times using the same method as ②;
[0081] ④ Place the PVDF membrane in a horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG secondary antibody solution (diluted to 1:50000) with appropriate amount of blocking solution or TBST, and incubate slowly with shaking in a constant temperature shaker at 37 ℃ for 1 h.
[0082] ⑤ Wash three times using the same method as in ②;
[0083] ⑥ Immerse the PVDF membrane in freshly prepared enhanced chemiluminescence substrate solution and incubate at room temperature in the dark for 1-2 minutes. Drain off excess liquid, wrap with transparent plastic wrap, and use a chemiluminescence imaging system to acquire images.
[0084] Western blot results showed ( Figure 10 The rabbit anti-turkey Muc5b polyclonal antibody prepared specifically binds to the natural mucin in the turbot intestine, showing a single, clear band at a relative molecular mass of approximately 110 kDa, while the negative control serum showed no colored band. Furthermore, this specific band exhibits the typical tailing phenomenon in mucin electrophoresis. The reasons for this are mainly twofold: firstly, the mucin undergoes varying degrees of glycosylation modification, leading to a non-uniform molecular weight; secondly, as a high-molecular-weight glycoprotein, the mucin experiences steric hindrance when passing through the pores of a polyacrylamide gel, resulting in a decreased migration rate.
[0085] Example 6: Indirect immunofluorescence identification of turbot Muc5b antibody
[0086] ① Sampling: After temporarily holding turbot (60±5g) for one week, take the gills, hindgut, skin and olfactory sac tissue of turbot, wash with phosphate buffer (0.01 M PBS, pH 7.4), blot dry with qualitative filter paper, gently place with tweezers into a foil box pre-filled with OCT embedding medium, adjust the position with dissecting needle, and freeze at -80 ℃.
[0087] ② Mount the tissue embedding block onto the sample holder of the cryostat, adjust the section thickness to 6 μm, and cut 5 tissue sections consecutively. Gently attach the sections to the cryostat using an adhesive slide. Immediately fix the sections in acetone pre-cooled at 4 ℃ for 15 min, remove them, and dry them thoroughly in a fume hood. Then transfer them to a -20 ℃ freezer for storage.
[0088] ③ Take the frozen sections from the -20 ℃ freezer and thaw them for 15 min. Wash them three times with PBST, shaking for 5 min each time. After drying, use an immunohistochemical pen to select the tissue, add 5% bovine serum albumin (BSA, prepared with 0.01 M PBS), and incubate in a humidified chamber at 37 ℃ for 1 h.
[0089] ④ Discard the blocking solution, slightly dry the sections, and add rabbit anti-turbot Muc5b serum (primary antibody) diluted 1:1000 with PBST (PBS containing 0.05% Tween-20), ensuring the antibody solution completely covers the tissue sections. Place the sections in a humidified chamber and incubate at 37 ℃ for 1 h. After incubation, discard the primary antibody and wash the sections three times with PBST on a shaker for 5 min each time to thoroughly remove unbound primary antibody.
[0090] ⑤ Use a spin spinner to dry the residual liquid on the slide. Use Cy3-labeled goat anti-rabbit IgG antibody (1:1000 dilution) as the secondary antibody, and simultaneously add 1:1000 PBS-diluted FITC-labeled wheat germ lectin (FITC-WGA) to stain the mucin. Evenly cover the sample and incubate in a humidified chamber at 37 ℃ for 45 min.
[0091] ⑥ Remove the slide and wash it three times with PBST for 5 minutes each time. Add DAPI (1:2000 dilution), incubate at room temperature for 15 minutes, and then wash as above.
[0092] ⑦ After drying, add anti-fluorescence quenching mounting medium in the dark, and then cover with a coverslip.
[0093] ⑧ Results observed under a fluorescence microscope.
[0094] Immunofluorescence assay results showed that the prepared rabbit anti-turbot Muc5b specific antibody could specifically bind to the natural mucin in the gills, hindgut, skin, and olfactory sac tissues of turbot, exhibiting a significant positive fluorescent signal. The fluorescent signal was mainly distributed on the surface of mucosal epithelial cells and within the cytoplasm of mucus cells, appearing as scattered or granular aggregates, and the mucus layer covering the epithelial surface could be clearly identified. Figure 11 To further verify the antibody's specificity, co-localization analysis of immunofluorescence and wheat germ agglutinin (WGA) was performed. WGA, as a probe capable of recognizing and binding to mucin glycosylation sites, is commonly used to label mucus substances. The results showed a high degree of co-localization between the immunofluorescence signal of the Muc5b antibody and the positive signal stained with WGA in mucosal tissue; that is, the two almost completely overlapped in the cytoplasm of mucus cells and the mucus layer on the epithelial surface. This distribution pattern not only further confirmed the antibody's specific recognition ability but also consistent with the biological functions of mucin in mucus cells—synthesis, storage, and secretion onto the mucosal surface. Using FITC-WGA-stained rabbit negative serum as a negative control, no non-specific fluorescence was observed in the Cy3 channel of the tissue sections, ensuring the reliability of the detection results.
[0095] The above results indicate that the Muc5b antibody prepared in this invention has good tissue reactivity and specificity, and can effectively locate the in situ distribution of Muc5b mucin in various mucosal tissues of turbot, thus possessing practicality for mucosal immunity-related research.
Claims
1. An antigenic epitope polypeptide, characterized in that, The antigenic epitope polypeptide comprises: 1) A polypeptide with the amino acid sequence SEQ ID NO:1; 2) A polypeptide obtained by substituting, deleting, or adding one or more amino acids to the polypeptide in 1).
2. A coupling protein, characterized in that, The coupled protein is the antigenic epitope polypeptide of claim 1 with a molecule for enhancing immune effects coupled to its 5′ or 3′ end.
3. The coupling protein as described in claim 2, characterized in that, The molecule in question is a KLH carrier protein.
4. A specific antibody, characterized in that, The specific antibody is prepared by immunizing animals using the antigenic epitope polypeptide of claim 1 or the conjugate protein of claim 2.
5. The specific antibody as described in claim 4, characterized in that, The animal in question is a New Zealand white rabbit.
6. The specific antibody as described in claim 4, characterized in that, The specific antibody is prepared by conjugating the antigenic epitope polypeptide of claim 1 to a carrier protein, immunizing New Zealand white rabbits, and then collecting serum.
7. The specific antibody as described in claim 6, characterized in that, The carrier protein mentioned is the KLH carrier protein.
8. The use of the specific antibody according to claim 4 in the preparation of a reagent for identifying Muc5b-positive mucinous cells of turbot.
9. A kit for detecting or tracing Muc5b-positive mucinous cells in turbot, characterized in that, The kit contains the specific antibody as described in claim 4.
10. The kit according to claim 9, characterized in that, The kit described is a paraffin or frozen section detection kit.
Citation Information
Patent Citations
Specific antibody of paralichthys olivaceus M cell marker molecule GP2 and application thereof
CN115785243A
Preparation and application of paralichthys olivaceus mucoprotein Muc5AC specific antibody
CN115785244A
Preparation and application of paralichthys olivaceus mucoprotein Muc2 specific antibody
CN116003562A
Tissue directed antibodies and methods of use thereof
CN121793982A
Transforming growth factor-related antibodies and uses thereof
WO2016073879A2