Dsrna of hyphantria cunea gene and application thereof
By designing dsRNAs for the LKB1, Foxo3, and ECR genes of the fall webworm and targeting and silencing their expression, the problems of pest resistance and ecological pollution in fall webworm control were solved, achieving efficient and environmentally friendly control of fall webworm.
Patent Information
- Application Number
- CN202610222729.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-24
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for controlling the fall webworm have problems such as increased insect resistance, environmental pollution from chemical pesticides, and imbalance of the ecosystem. Furthermore, they lack effective target genes for core pathways regulating energy metabolism and development.
We designed and applied dsRNAs of the LKB1, Foxo3 and ECR genes of the fall webworm to interfere with the insect's energy metabolism and developmental regulation pathways by targeting and silencing the expression of these genes. The dsRNAs were then injected into fall webworm larvae via abdominal injection.
It significantly disrupts the life activities of the fall webworm, prolongs pupation time, reduces pupation rate, provides a green and environmentally friendly control solution, and avoids adverse effects on non-target organisms.
Smart Images

Figure CN122104701A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, specifically to the dsRNA of the American white moth gene and its applications. Background Technology
[0002] American white moth Hypantria cunea (Drury) It is a major invasive alien pest in my country, and has occurred from time to time in some areas of the Beijing-Tianjin-Hebei region in recent years. It has a wide host range, feeds on plant leaves, and will have a certain impact on the growth of local trees, as well as causing some trouble to the maintenance of the ecological environment and people's production and life.
[0003] Currently, the control of the fall webworm still relies primarily on chemical pesticides. However, the long-term and extensive use of chemical agents has led to a series of prominent problems. Pests are rapidly developing resistance to pesticides, resulting in a gradual decline in control effectiveness year by year. This necessitates continuously increasing pesticide dosages or changing pesticide types, creating a vicious cycle. Furthermore, chemical pesticides have broad-spectrum toxicity, severely damaging non-target organisms such as beneficial insects and birds while killing pests, disrupting the balance of the ecosystem. Simultaneously, pesticide residues easily pollute soil, water bodies, and the atmosphere, affecting not only the quality and safety of crops but also posing a potential threat to human health.
[0004] With the development of molecular biology techniques, RNA interference (RNA) technology has gradually become a research hotspot in biological pest control due to its advantages such as strong targeting, environmental friendliness, and low likelihood of inducing drug resistance. Its core principle is to introduce double-stranded RNA (dsRNA) targeting key functional genes into pests, specifically silencing the expression of these target genes and interfering with the pest's growth, development, reproduction, and other life processes, ultimately achieving the goal of pest control. The key to the application of RNA interference technology lies in screening for functional genes that are crucial to the survival and reproduction of pests and whose sequences are conserved. Although there have been studies exploring RNA interference control targeting genes such as metabolic detoxification genes and neuropeptide genes in the fall webworm, there is still a gap in the screening of highly efficient target genes focusing on core pathways of energy metabolism and developmental regulation. Summary of the Invention
[0005] This invention proposes dsRNA of the American white moth gene and its application, which solves the problem of insufficient control of the American white moth in related technologies, and fills the gap in the field of RNA interference control for screening efficient target genes of the core pathways regulating energy metabolism and development of the American white moth.
[0006] The technical solution of the present invention is as follows: This invention proposes dsRNAs of genes from the American white moth, including at least one of LKB1 gene dsRNA, Foxo3 gene dsRNA, and ECR gene dsRNA; The nucleotide sequence of the LKB1 gene dsRNA is shown in SEQ ID NO.1; the nucleotide sequence of the Foxo3 gene dsRNA is shown in SEQ ID NO.2; and the nucleotide sequence of the ECR gene dsRNA is shown in SEQ ID NO.3.
[0007] As a further technical solution, when the dsRNA contains LKB1 gene dsRNA, the nucleotide sequence of the LKB1 gene is as shown in SEQ ID NO.4; When the dsRNA contains Foxo3 gene dsRNA, the nucleotide sequence of the Foxo3 gene is shown in SEQ ID NO.5; When the dsRNA contains ECR gene dsRNA, the nucleotide sequence of the ECR gene is shown in SEQ ID NO.6.
[0008] As a further technical solution, the primer sequences for synthesizing the LKB1 gene dsRNA of the American white moth are as follows: Forward primer: 5'-CAGGATATGTTGGAAGCAAG-3', as shown in SEQ ID NO.7; Reverse primer: 5'-GTACAGTTGGCCTTAGATCC-3', as shown in SEQ ID NO.8.
[0009] As a further technical solution, the primer sequences for synthesizing the Foxo3 gene dsRNA of the American white moth are as follows: Forward primer: 5'-GAACTAGCAGAGGTCGGGTTC-3', as shown in SEQ ID NO.9; Reverse primer: 5'-CTAGGCTTCTGTCAACCG-3', as shown in SEQ ID NO.10.
[0010] As a further technical solution, the primer sequence for synthesizing the dsRNA of the ECR gene of the American white moth is as follows: Forward primer: 5'-CCAACCAGTTCGTTTGGGTG-3', as shown in SEQ ID NO.11; Reverse primer: 5'-CTGGCTAGTAACCTACTG-3', as shown in SEQ ID NO.12.
[0011] As a further technical solution, the 5' ends of the primer sequences for synthesizing the LKB1 gene dsRNA of the American white moth, the Foxo3 gene dsRNA of the American white moth, and the ECR gene dsRNA of the American white moth are each independently linked to the T7 promoter.
[0012] The present invention also proposes an injection solution comprising the dsRNA of the aforementioned American white moth gene.
[0013] As a further technical solution, the dose of American white moth gene dsRNA in each 1 μL injection solution is 1~5 μg.
[0014] As a further technical solution, when the dsRNA is LKB1 gene dsRNA, the dose of LKB1 gene dsRNA in each 1 μL injection solution is 3 µg.
[0015] As a further technical solution, when the dsRNA is LKB1 gene dsRNA, the dose of ECR gene dsRNA in each 1μL injection solution is 3µg.
[0016] As a further technical solution, when the dsRNA is LKB1 gene dsRNA, the dose of Foxo3 gene dsRNA in each 1 μL injection solution is 5 µg.
[0017] The present invention also proposes the application of the dsRNA of the American white moth gene or the injection solution described herein in the prevention and control of the American white moth.
[0018] As a further technical solution, the control of the American white moth can be achieved by treating it with abdominal injection using the American white moth gene dsRNA or the injection solution.
[0019] The working principle and beneficial effects of this invention are as follows: Insect growth, development, and metabolic regulation depend on a sophisticated network of signaling pathways. The LKB1 gene, as a "cellular energy sensor," is a key upstream kinase in the AMPK pathway. Under energy stress, it can activate downstream signaling molecules to regulate cellular metabolism, autophagy, and stress resistance. The Foxo3 gene belongs to the FOXO transcription factor family and participates in core biological processes such as cell cycle, apoptosis, and oxidative stress. Its activity regulation is crucial for insects to adapt to environmental stress. The ECR gene (ecdysone receptor gene) is an arthropod-specific nuclear receptor that dominates key life processes such as molting, metamorphosis, and reproduction in insects. It is the core switch that regulates insect development.
[0020] This invention reveals for the first time the key roles and synergistic mechanisms of the LKB1, Foxo3, and ECR genes in regulating the energy metabolism and development of the fall webworm (L. esculentus) in the fall webworm. These three genes constitute the core regulatory pathway "LKB1→Foxo3→ECR," which is crucial for the fall webworm's energy metabolism and growth. Based on this, dsRNA molecules targeting these genes were designed. The LKB1 gene dsRNA can silence the expression of the fall webworm's LKB1 gene, the Foxo3 gene dsRNA can silence the expression of the fall webworm's Foxo3 gene, and the ECR gene dsRNA can silence the expression of the fall webworm's ECR gene. Injecting these dsRNAs into the fall webworm larvae and targeting and silencing any one of these genes can significantly interfere with their life activities, resulting in a longer pupation time and a lower pupation rate. This solves the technical problem of a lack of effective control targets for the fall webworm and demonstrates excellent control efficacy.
[0021] The dsRNA of this invention, as a nucleic acid molecule, can be rapidly degraded in the natural environment, leaving no residue or pollution. It specifically targets only the key functional genes of the fall webworm and has no adverse effects on non-target organisms. Compared with traditional chemical control methods, it has a greener and more environmentally friendly advantage, providing a brand-new core target molecule and practical control solution for green control technology. Attached Figure Description
[0022] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.
[0023] Figure 1 Figure 1 shows the interference experiment of dsHcLKB1, dsHcECR and dsHcFoxo3 on the fall webworm. In the figure, A is the interference experiment diagram of dsHcLKB1 on the fall webworm; B is the interference experiment diagram of dsHcECR on the fall webworm; C is the interference experiment diagram of dsHcFoxo3 on the fall webworm. Figure 2 Figure 1 shows the experimental results of optimal interference dose and optimal interference time for dsHcLKB1, dsHcECR and dsHcFoxo3. In the figure, A is the experimental result of the optimal interference dose of dsHcLKB1, B is the experimental result of the optimal interference time of dsHcLKB1; C is the experimental result of the optimal interference dose of dsHcECR, D is the experimental result of the optimal interference time of dsHcECR; E is the experimental result of the optimal interference dose of dsHcFoxo3, and F is the experimental result of the optimal interference time of dsHcFoxo3. Figure 3 A diagram showing the regulatory effects of RNA interference from HcLKB1, HcECR, and HcFoxo3 in the fat body of the American white moth on the proportion of energy molecules and the expression of pathway genes. In the figure, A shows the change in the ADP / ATP ratio in the fat body of the fall webworm after dsRNA interference with the HcLKB1, HcECR, and HcFoxo3 genes; B shows the change in the AMP / ATP ratio in the fat body of the fall webworm after dsRNA interference with the HcLKB1, HcECR, and HcFoxo3 genes; and C shows the effect of dsRNA interference with the relative expression levels of key metabolic and developmental genes in the fat body of the fall webworm. Detailed Implementation
[0024] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0025] Example 1 Total RNA extraction was performed according to the instructions for the Eastep™ Super Total RNA Extraction Kit: 1. Collect fat bodies of American white moths, and use fat bodies from every 10 moths as one tissue sample. Store the samples in a freezer at -80°C. 2. Solution preparation DNAse I: Mix 550 μL of nuclease-free water with lyophilized DNAse I powder and store at -20℃ to obtain DNAse I; TG-RNA lysis buffer: 1-Thioglycerol is mixed with RNA lysis buffer to obtain TG-RNA lysis buffer. The volume fraction of 1-thioglycerol in the TG-RNA lysis buffer is 2%. RNA washing solution: Mix 70 mL of anhydrous ethanol with 40 mL of undiluted RNA washing solution to obtain RNA washing solution; 3. Take 300 μL of TG-RNA lysis buffer into a 1.5 mL centrifuge tube, add the tissue sample stored at -80℃, place in an ice bath, and grind into a homogenate; 4. Add 300 μL of RNA dilution buffer to the homogenate, mix thoroughly by pipetting repeatedly, and let stand at room temperature for 5 minutes to obtain tissue lysate; 5. Pre-cool the high-speed centrifuge to 4°C, mix the tissue lysate thoroughly, place it in the high-speed centrifuge, centrifuge at 13000g for 5 minutes, and collect the supernatant into a centrifuge tube; 6. Add 0.5 times the volume of the supernatant to the centrifuge tube with anhydrous ethanol, and quickly pipette 25 times to obtain a mixture that is pale blue, turbid and has white foam. 7. Transfer the mixture to a centrifuge column, centrifuge at 13000g for 1 minute and discard the filtrate. Add 600μL of RNA washing buffer, centrifuge at 13000g for 45 seconds and discard the filtrate. 8. Prepare the DNase I incubation solution according to the kit instructions. The composition and amount of DNase I incubation solution are shown in Table 1 below. Table 1
[0026] 9. Add 50 μL of DNase I incubation solution to the center of the adsorption membrane and incubate at room temperature for 15 minutes; 10. Add 600 μL of RNA washing buffer, centrifuge at 13000g for 45 seconds, and discard the filtrate; 11. Add 600 μL of RNA washing buffer, centrifuge at 13000g for 45 seconds, discard the filtrate, reposition the centrifuge column onto the collection tube, and centrifuge at 13000g for 2 minutes; 12. Transfer the centrifuge column to the elution tube, add 100 μL of nuclease-free water to the center of the centrifuge column membrane, let stand at room temperature for 2 minutes, centrifuge at 13000g for 1 minute, and store at -80℃ to obtain the RNA sample; 13. The RNA concentration in the RNA sample was detected using a micro-spectrophotometer. The result was: RNA concentration was 674.32 ng / μL.
[0027] Example 2 cDNA synthesis was performed according to the instructions for the FastKing gDNA Dispelling RT SuperMix kit: 1. Thaw the above RNA sample on ice as template RNA; thaw 5×FastKing-RT SuperMix and RNase-Free ddH2O at 20℃, and place them on ice immediately after thawing. Before use, vortex each solution to mix well, centrifuge, and collect the liquid remaining on the tube wall. Note: The following procedures shall be performed on ice; 2. Prepare the reverse transcription reaction system. The components and amounts used in the reverse transcription reaction system are shown in Table 2 below: Table 2
[0028] 3. Perform the reverse transcription reaction according to the steps in Table 3 below to obtain reverse transcribed cDNA.
[0029] Table 3
[0030] Example 3 A method for synthesizing dsRNAs of GFP, LKB1, Foxo3, and ECR, comprising the following steps: 1. Conserved regions of cDNA sequences were identified and silenced fragments were determined using CDsearch on the National Center for Biotechnology Information (NCBI) website. Corresponding primers were designed, and dsRNA primers were synthesized by adding the T7 promoter sequence to the 5' end of the upstream and downstream primers, respectively. Among them, the dsRNA primers for the GFP gene were designed as a control group. The primer sequences for dsRNA are shown in Table 4 below. Table 4
[0031] 2. Amplify the interfering region sequence using primers without the T7 promoter, and prepare a 20µL PCR reaction system according to the reagents and reagent usage amounts in Table 5 below: Table 5
[0032] The prepared PCR reaction system was thoroughly mixed and placed in a PCR instrument. The reaction program was set as follows: 94℃, 3 minutes; 94℃, 30 seconds; 55℃, 30 seconds; 72℃, 30 seconds; 35 cycles; 72℃, 5 minutes; PCR product I was obtained. A 1% agarose gel was prepared for electrophoresis detection of PCR product I. The DNA marker band was compared to confirm that it was a single band. The nucleotide sequences of the LKB1 gene (SEQ ID NO.4), Foxo3 gene (SEQ ID NO.5), and ECR gene (SEQ ID NO.6) were obtained by sequencing. 3. Resynthesize the primers with the T7 promoter to prepare the PCR product, i.e., the primer combination is: T7F&R, T7R&F. The PCR reaction system and reaction process are the same as in step 2 to obtain the PCR product. 4. To verify the PCR product obtained in step 3, a 1% (w / v) agarose gel was prepared for electrophoresis. The DNA marker bands were compared, and the PCR product showed a single band. The PCR product was then directly purified using the following method: A1. Mix equal volumes of PCR products and binding solution; A2. Place the SV microcentrifuge column from the kit onto the collection tube; A3. Add the mixed liquid to the SV micro centrifuge column and let it stand at room temperature for 1 minute; A4. Centrifuge at 16000g for 1 minute using a high-speed centrifuge; A5. After centrifugation, add the liquid back into the SV microcentrifuge column and let it stand at room temperature for 1 minute. Then repeat step A4 to increase the yield. A6. Add 700µL of membrane washing buffer, centrifuge at 16000g for 1 minute using a high-speed centrifuge, and discard the waste liquid; A7. Add 500µL of membrane washing buffer, centrifuge at 16000g for 1 minute using a high-speed centrifuge, and discard the waste liquid; A8. Replace the SV microcentrifuge column into the collection tube and place it in a high-speed centrifuge at 16000g for 2 minutes to remove residual anhydrous ethanol. A9. Place the SV microcentrifuge column into a centrifuge tube, add 30µL ddH2O, let stand at room temperature for 2 minutes, then centrifuge at 16000g for 1 minute, collect the liquid and record it as DNA solution. A10. The concentration of DNA in the above DNA solution was detected using a micro spectrophotometer. The results are as follows: The DNA template concentrations obtained from GFP-T7 primer amplification were as follows: the DNA concentration corresponding to primer combination T7F&R was 230 ng / µL, and the DNA concentration corresponding to primer combination T7R&F was 230 ng / µL. The DNA template concentration detection results obtained by LKB1-T7 primer amplification were as follows: the DNA concentration corresponding to primer combination T7F&R was 190 ng / µL; the DNA concentration corresponding to primer combination T7R&F was 190 ng / µL. The DNA template concentrations obtained from Foxo3-T7 primer amplification were as follows: the DNA concentration corresponding to primer combination T7F&R was 338 ng / µL; the DNA concentration corresponding to primer combination T7R&F was 305 ng / µL. The DNA template concentrations obtained from ECR-T7 primer amplification were as follows: the DNA concentration corresponding to primer combination T7F&R was 713 ng / µL; the DNA concentration corresponding to primer combination T7R&F was 662 ng / µL. 5. dsRNA synthesis A1. Take the DNA solution from step A10 above, and use the DNA in the DNA solution as a linear DNA template to prepare a 20µL T7 kit according to the steps in Table 6 below: Table 6
[0033] A2. Incubate in a water bath at 37°C for 5 hours to obtain ssRNA; A3. dsRNA extension: Mix the ssRNA obtained by primer combination T7F&R and the ssRNA obtained by primer combination T7R&F together, vortex to mix, and heat in a metal bath at 70°C for 10 minutes to obtain dsRNA solution I. A4. Removal of DNA template and ssRNA: Add 199 μL of enzyme-free water to 1 μL of RNase A Solution to obtain RNase A Solution dilution. Add 2 μL of RNase A Solution dilution and 2 μL of RQ1 RNase-free DNase to dsRNA solution I. Incubate in a metal bath at 37°C for 30 minutes to obtain dsRNA solution II. A5. Purification of dsRNA: Add 0.1 volume of 3 mol / L sodium acetate (pH 5.2) and 1 volume of isopropanol, place on ice for 5 minutes, transfer to dsRNA solution II, centrifuge at 4°C and 16000g for 10 minutes, discard the supernatant, wash the precipitate with 0.5 mL of 70% ethanol nuclease-free aqueous solution, dry at room temperature for 15 minutes, dissolve in 30 μL of nuclease-free water to obtain dsRNA solution; A6. Take 1 μL of dsRNA solution and test the concentration using a micro spectrophotometer. Name the dsRNA of the LKB1 gene as dsHcLKB1, the dsRNA of the ECR gene as dsHcECR, and the dsRNA of the Foxo3 gene as dsHcFoxo3. The concentration of dsGFP in the dsGFP solution is 4500 ng / µL; The concentration of dsHcLKB1 in the dsHcLKB1 solution is 6000 ng / µL; The concentration of dsHcFoxo3 in the dsHcFoxo3 solution was 10652 ng / µL; The concentration of dsHcECR in the dsHcECR solution was 9849.6 ng / µL.
[0034] Example 4 The experiment on the interference of dsRNA on the fall webworm included the following steps: The dsHcLKB1 solution, dsHcFoxo3 solution, dsHcECR solution and dsGFP solution prepared in Example 3 were diluted with water to a concentration of 2 μg / µL. Then, 1 µL of the 2 μg / µL dsRNA solution was injected into the final instar larvae of the American white moth that had just molted. The experimental group used dsRNA solutions of dsHcLKB1, dsHcECR, and dsHcFoxo3, respectively, while the control group used dsRNA solution of dsGFP. After injection, the larvae were placed in rearing boxes and fed normally. Forty-eight hours after injection, the larvae from different groups were divided into three groups of 30 each, and the larvae were induced to pupate by starvation. The number of pupae was counted and plotted daily. The experimental results are shown below. Figure 1 As shown.
[0035] Figure 1 Figure 1 shows the interference effect of different dsRNAs on the fall webworm. Figure 1 Data shows that interfering with the LKB, ECR, or Foxo3 genes prolongs the pupation time of the fall webworm and reduces the pupation rate. This proves that these three genes are key functional genes for the fall webworm to complete the normal pupation process. Silencing any one of these genes can directly block or delay the metamorphosis of the pest from larva to pupa, thus achieving the control of the fall webworm.
[0036] Example 5 The experimental method for determining the optimal interference level and optimal interference time includes the following steps: 1. The dsHcLKB1 solution, dsHcFoxo3 solution and dsHcECR solution prepared in Example 3 were diluted with water to obtain concentrations of 1 μg / µL, 2 μg / µL, 3 μg / µL, 4 μg / µL and 5 μg / µL respectively; 2. Select newly molted final-instar larvae of the fall webworm and inject 1 μL of the above-mentioned diluted dsHcLKB1 solution, dsHcFoxo3 solution, and dsHcECR solution into them via abdominal injection. After injection, the larvae were placed in a rearing box and fed normally. At 12h, 24h, 36h, and 48h after injection, total RNA was extracted from the fat body tissue of the larvae and reverse transcribed into cDNA. The RNA interference efficiency was evaluated by RT-qPCR technology. 3. Prepare the qRT-PCR reaction solution on ice according to the reaction system in Table 7 below: Table 7
[0037] 4. Add the reaction solution to a 96-well fluorescent quantitative plate, seal with sealing film, and centrifuge to mix. 5. Place the 96-well plate in a CFX96 real-time PCR instrument and use the two-step reaction program as shown in Table 8 below: Table 8
[0038] 6. Data Analysis: Using 2 -ΔΔCqThe relative expression level of the target gene was calculated using the method described above, and the internal reference gene HcEF1-α was used to correct the expression level of the target gene. The primer sequence of the internal reference gene HcEF1-α is as follows: Forward primer (5'-3'): TTATCGTCGCTGCTGGTACT, as shown in SEQ ID NO.23 of the sequence listing; Reverse primer (5'-3'): GAGGTGTGAAAGCGAGCAGAG, as shown in SEQ ID NO.24 of the sequence listing.
[0039] Experimental results: Figure 2 Figure showing the experimental results for the optimal interference dose and optimal interference time for different dsRNAs; Figure 2 middle, Figure 2 Data from -A and 2-B indicate that the optimal interference dose of dsHcLKB1 is 3µg and the optimal interference time is 48h. Figure 2 Data from -C and 2-D indicate that the optimal interference dose for dsHcECR is 3 µg and the optimal interference time is 48 h. Figure 2 Data from -E and 2-F indicate that the optimal interference dose of dsHcFoxo3 is 5 µg and the optimal interference time is 48 h.
[0040] Example 6 Validation of the hierarchical relationship of metabolic regulatory pathways includes the following steps: ELISA was performed using the corresponding kit (Shanghai Yuanju Company) (AMP / ADP / ATP were all measured using the ELISA kit).
[0041] 1. Take out all kit components (including standards, detection antibodies, enzyme labels, etc.) and equilibrate at room temperature for 20 minutes; dilute the concentrated wash buffer 20 times with deionized water to obtain the working solution; 2. Preparation of test samples: Add an appropriate amount of physiological saline to the tissue and crush it. Centrifuge at 3000 rpm for 10 minutes and take the supernatant to obtain the test sample. 3. Standard plate loading: Add 50 μL of different concentrations of standard to each well. Add 10 μL of the sample to be tested to each well, followed by 40 μL of the sample diluent. Do not add any to the blank wells. Except for the blank wells, add 100 μL of horseradish peroxidase (HRP) labeled streptavidin to each well. Seal the reaction wells with sealing film and incubate at 37°C in the dark for 60 min. 4. Washing the plate: Discard the liquid, pat dry on absorbent paper, fill each well with working solution, let stand for 1 minute, shake off the working solution, pat dry on absorbent paper, and repeat the washing process 5 times. 5. Color development: Add 50 μL each of substrate A and B to each well and react at 37°C in the dark for 15 min; 6. Termination of reaction: Add 50 μL of stop solution to each well; the solution will immediately change from blue to yellow. 7. Plate reading: Use an ELISA reader to measure the absorbance (OD value) at a wavelength of 450 nm. 8. Standard curve plotting: Plot the standard concentration on the x-axis (logarithmic scale) and the OD value on the y-axis, fit a 4-parameter logarithmic curve, and calculate the sample concentration based on the standard curve equation; 9. The RNA interference efficiency was evaluated using RT-qPCR technology, with the qRT-PCR procedure being the same as in Example 4; The results are as follows Figure 3 As shown.
[0042] RNA interference experiments targeting key genes (HcLKB1, HcECR, and HcFoxo3) validated the hierarchical relationship of this metabolic regulatory pathway. Figure 3 The figure shows the regulatory effects of RNA interference of HcLKB1, HcECR, and HcFoxo3 in the fat body of the American white moth on the energy molecule ratio and pathway gene expression. The figure indicates that ADP and AMP levels did not change significantly after gene interference (Figures A and B), suggesting that these genes may be located downstream of the energy sensing pathway; fat body gene expression profiling analysis (… Figure 3 C) The upstream and downstream relationships of each gene in the regulatory network were further clarified. Therefore, environmental stress signals may be sensed by energy molecules such as AMP / ADP, and then sequentially activate LKB1 kinase, Foxo transcription factor, and ECR receptor, ultimately coordinating adaptive changes in energy metabolism and developmental processes. The hierarchical relationship of LKB1, Foxo3, and ECR in the regulatory network was clarified, verifying the pathway hypothesis of "energy stress → LKB1 → Foxo3 → ECR". Abnormal function of any of the LKB1, Foxo3, and ECR genes will lead to disorder of insect life activities.
[0043] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. The dsRNA of the American white moth gene, characterized in that, Including at least one of the LKB1 gene dsRNA, Foxo3 gene dsRNA and ECR gene dsRNA; The nucleotide sequence of the LKB1 gene dsRNA is shown in SEQ ID NO.1; the nucleotide sequence of the Foxo3 gene dsRNA is shown in SEQ ID NO.2; and the nucleotide sequence of the ECR gene dsRNA is shown in SEQ ID NO.
3.
2. The dsRNA of the American white moth gene according to claim 1, characterized in that, When the dsRNA contains LKB1 gene dsRNA, the nucleotide sequence of the LKB1 gene is as shown in SEQ ID NO.4; When the dsRNA contains Foxo3 gene dsRNA, the nucleotide sequence of the Foxo3 gene is shown in SEQ ID NO.5; When the dsRNA contains ECR gene dsRNA, the nucleotide sequence of the ECR gene is shown in SEQ ID NO.
6.
3. The dsRNA of the American white moth gene according to claim 2, characterized in that, The primer sequences for synthesizing the LKB1 gene dsRNA are as follows: Forward primer: 5'-CAGGATATGTTGGAAGCAAG-3', as shown in SEQ ID NO.7; Reverse primer: 5'-GTACAGTTGGCCTTAGATCC-3', as shown in SEQ ID NO.
8.
4. The dsRNA of the American white moth gene according to claim 2, characterized in that, The primer sequences for synthesizing the Foxo3 gene dsRNA are as follows: Forward primer: 5'-GAACTAGCAGAGGTCGGGTTC-3', as shown in SEQ ID NO.9; Reverse primer: 5'-CTAGGCTTCTGTCAACCG-3, as shown in SEQ ID NO.
10.
5. The dsRNA of the American white moth gene according to claim 2, characterized in that, The primer sequences for synthesizing the ECR gene dsRNA are as follows: Forward primer: 5'-CCAACCAGTTCGTTTGGGTG-3', as shown in SEQ ID NO.11; Reverse primer: 5'-CTGGCTAGTAACCTACTG-3', as shown in SEQ ID NO.
12.
6. An injection solution, characterized in that, Includes the dsRNA of the American white moth gene as described in any one of claims 1 to 5.
7. The injection solution according to claim 6, characterized in that, The dose of dsRNA of the American white moth gene in each 1 μL of the injection solution is 1~5 μg.
8. The injection solution according to claim 7, characterized in that, When the dsRNA is LKB1 gene dsRNA, the dose of LKB1 gene dsRNA in each 1 μL of the injection solution is 3 µg. When the dsRNA is ECR gene dsRNA, the dose of ECR gene dsRNA in each 1 μL injection solution is 3 µg; When the dsRNA is Foxo3 gene dsRNA, the dose of Foxo3 gene dsRNA in each 1 μL injection solution is 5 µg.
9. The use of the dsRNA of the fall webworm gene according to any one of claims 1 to 5 or the injection solution according to any one of claims 6 to 8 in the control of fall webworm.
10. The application according to claim 9, characterized in that, Control of the American white moth can be achieved by treating it with the American white moth gene dsRNA or the injection solution via abdominal injection.