A method for improving feed utilization efficiency of yellow catfish by changing biological rhythm
By knocking out the rbmx gene in yellow catfish using CRISPR/Cas9 gene editing technology, designing specific sgRNAs, and screening homozygous mutants, the problem of improving feed utilization efficiency in traditional breeding methods has been solved, resulting in a significant improvement in feed utilization efficiency and green aquaculture for yellow catfish.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies cannot quickly and effectively improve the feed utilization efficiency of yellow catfish through traditional breeding methods, and molecular marker-assisted selection is limited by natural genetic variation, making it difficult to achieve breakthrough improvements in traits.
By specifically knocking out the rbmx gene in yellow catfish using CRISPR/Cas9 gene editing technology, designing specific sgRNAs and modifying yellow catfish using a gene editing system, we obtained mutant alleles with loss of rbmx gene function and screened out homozygous yellow catfish mutants with high feed utilization efficiency.
It significantly improved the feed utilization efficiency of yellow catfish, increasing the number of female and male individuals by approximately 17.8% and 20.2% respectively, reducing aquaculture costs, decreasing aquaculture pollution, and promoting the green development of the industry.
Smart Images

Figure CN122104719A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of yellow catfish genetic breeding technology, specifically to a method for improving the feed utilization efficiency of yellow catfish by altering biological rhythms, and more specifically, to a mutant allele of the yellow catfish rbmx gene, a yellow catfish mutant containing the allele, an sgRNA for the yellow catfish rbmx gene, a primer set for detecting the yellow catfish rbmx gene knockout target, and a method for preparing yellow catfish with high feed utilization efficiency. Background Technology
[0002] Yellow catfish (Pelteobagrus fulvidraco) is a distinctive freshwater economic fish species in my country, highly popular in the market due to its delicious flesh, lack of intramuscular bones, and rich nutritional value, leading to continuous expansion of its aquaculture scale. Under intensive aquaculture models, feed costs account for over 65% of total costs, becoming a key bottleneck restricting the improvement of the industry's economic efficiency. Therefore, feed utilization efficiency (i.e., the ratio of feed consumption to body weight gain), as a core indicator for measuring aquaculture efficiency, has become an urgent need for genetic improvement in the industry's development.
[0003] Currently, improving feed efficiency in aquaculture mainly relies on traditional selective breeding and optimized feeding management. Traditional breeding methods depend on phenotypic selection, which is not only time-consuming and costly for complex traits like feed utilization efficiency, but also offers limited genetic gain. While marker-assisted selection technology can improve breeding accuracy, it is still limited by naturally occurring genetic variations within the population, making it difficult to achieve breakthrough improvements in traits.
[0004] In recent years, the emergence of genome editing technologies (such as CRISPR / Cas9) has provided a powerful tool for the precise and rapid creation of new animal germplasm. This technology can directly create genetic material with superior traits by specifically knocking out or modifying target genes. However, successfully applying genome editing technology to the genetic improvement of fish feed efficiency still faces significant challenges: firstly, it requires the precise identification of functional genes that play a core regulatory role in fish feed utilization metabolic pathways; secondly, for specific genes, it is necessary to design efficient editing strategies and obtain specific mutation types that are stably inherited and have significant positive phenotypic effects. Currently, although some studies have explored the functions of genes related to growth and metabolism, successful cases of systematically and significantly improving fish feed utilization efficiency through editing a single gene are still relatively scarce, and the underlying molecular mechanisms and feasible breeding techniques need further in-depth exploration.
[0005] Therefore, developing a breeding method based on precise editing of key functional genes that can rapidly create new yellow catfish germplasm with significantly improved feed utilization efficiency is of great significance for breaking through industry bottlenecks and promoting cost reduction, efficiency improvement, and sustainable development in aquaculture. Summary of the Invention
[0006] In view of this, the purpose of this application is to provide a method and product for improving feed utilization efficiency in yellow catfish by altering biological rhythms. This application utilizes CRISPR / Cas9 gene editing technology to specifically knock out the rbmx gene in yellow catfish, obtaining a specific mutant allele that leads to the loss of function of the rbmx gene. Based on this, this application provides a method for preparing a yellow catfish mutant containing the said mutant allele, a specific sgRNA for achieving this knockout, and its preparation and application. The yellow catfish mutant obtained in this application exhibits significantly improved feed utilization efficiency compared to wild-type individuals, providing a new germplasm resource and breeding method of significant industrial value for the efficient and green aquaculture of yellow catfish.
[0007] Therefore, this application provides at least the following technical solutions:
[0008] Firstly, this application provides a mutant allele of the rbmx gene in yellow catfish, including rbmx. +5 rbmx +11 At least one of them, wherein
[0009] rbmx +5 Gene; nucleotide sequence as shown in SEQ ID NO:2;
[0010] rbmx +11 Gene; nucleotide sequence as shown in SEQ ID NO:3.
[0011] The mutant allele of the above-mentioned yellow catfish rbmx gene undergoes the following mutation in the wild-type reference sequence (SEQ ID NO: 1) of the yellow catfish rbmx gene:
[0012] For rbmx +5 The gene, in which "GGC" is mutated to "AAA" at position 17-19 bp in the wild-type reference sequence (SEQ ID NO: 1) of the rbmx gene, and the nucleotide sequence formed by inserting "AGCTT" after "AAA";
[0013] For rbmx +11 The gene, the nucleotide sequence formed by the mutation of “CCT” to “GAA” at position 19-21 bp in the wild-type reference sequence (SEQ ID NO: 1) of the rbmx gene, and the insertion of “AGCTTCTCATC” at position 26-27 bp.
[0014] Secondly, this application provides a yellow catfish mutant whose genome includes mutant alleles as shown in SEQ ID NO:2 or SEQ ID NO:3.
[0015] In some preferred embodiments, the mutant alleles in the yellow catfish mutant are homozygous.
[0016] Thirdly, this application provides an sgRNA for knocking out the yellow catfish rbmx gene, the target nucleotide sequence of which is GGCCTGGGAAGCTTTTCATCGG (SEQ ID NO: 4).
[0017] Fourthly, this application provides a primer set for detecting the rbmx gene knockout target site in yellow catfish, wherein the sequence of the rbmx gene knockout target site in yellow catfish is shown in SEQ ID NO: 4, and the primer set includes:
[0018] Upstream primer (rbmx-FP): GAAATCGCCAGCAGCATCC (SEQ ID NO:5);
[0019] Downstream primer (rbmx-RP): CTCAATAGCAAGCCCCACCA (SEQ ID NO:6).
[0020] Fifthly, this application provides a method for preparing yellow catfish with high feed utilization efficiency, such as... Figure 2 As shown, it includes the following steps:
[0021] (a) Introduce a gene editing system containing the sgRNA and Cas9 protein described in the third aspect into yellow catfish fertilized eggs; (b) Hatch and obtain F0 generation individuals, and mate the F0 generation individuals with wild-type yellow catfish to obtain F1 generation;
[0022] (c) Using the primer set described in the fourth aspect, screening from the F1 generation for genomes containing the mutations described in the first aspect.
[0023] Heterozygous individuals with alleles;
[0024] (d) The heterozygous individuals are mated to obtain F2 generation individuals, and the individuals described in the first aspect are selected from the F2 generation individuals.
[0025] Individuals with homozygous mutant alleles are the yellow catfish with high feed utilization efficiency.
[0026] In some preferred embodiments, in step (a), the amount of the gene editing system injected into each yellow catfish fertilized egg is 1-3 nL, wherein the working concentration of the sgRNA is 200-400 ng / μL.
[0027] In a sixth aspect, this application provides an intermediate material for the breeding of yellow catfish, which is a heterozygous yellow catfish obtained by step (c) of the method described in the fifth aspect, whose genome contains the mutant allele shown in SEQ ID NO:2 or SEQ ID NO:3.
[0028] Seventhly, this application provides the application of the mutant allele described in the first aspect, the yellow catfish mutant described in the second aspect, or the method described in the fifth aspect in the breeding of yellow catfish varieties with high feed utilization efficiency.
[0029] Compared with the prior art, this application has at least the following advantages:
[0030] 1. This application is the first to reveal and verify that the rbmx gene is a key factor regulating feed utilization efficiency in yellow catfish. By designing specific sgRNAs targeting the knockout site of this gene's coding region, precise knockout of the target gene was achieved, eliminating the reliance on natural variation in traditional breeding. The technical approach is clear and highly targeted. Experiments have shown that the homozygous mutant yellow catfish constructed in this way exhibits significantly improved feed utilization efficiency compared to the wild-type control (approximately 17.8% and 20.2% higher in females and males, respectively), providing a successful example for directly improving such complex economic traits through molecular breeding.
[0031] 2. This application provides a standardized “gene editing-screening-homozygosity” method, which can obtain new germplasm of homozygous yellow catfish mutants with stable traits in the F2 generation, overcoming the shortcomings of traditional breeding methods that are long-cycle and inefficient, and the mutant genotype can be stably inherited by offspring.
[0032] 3. This application edits specific target sites of the rbmx gene to obtain rbmx. +5 and rbmx +11 The two mutated alleles, without the introduction of any exogenous genes, avoid the risks associated with transgenic technology. Furthermore, this application provides the specific sgRNA for achieving this knockout, a set of detection primers for identifying the mutant, and a complete breeding process, forming a reproducible and easily operable complete technical system.
[0033] 4. The yellow catfish mutant bred using the technology described in this application can directly reduce feed costs during the aquaculture process due to its improved feed utilization efficiency. Simultaneously, higher feed utilization efficiency helps reduce uneaten feed and nitrogen and phosphorus emissions at the source, which is of positive significance for mitigating aquaculture water pollution and promoting the green development of the industry. Attached Figure Description
[0034] Figure 1 Comparative analysis of protein sequences of yellow catfish with those of model organisms zebrafish, medaka, and mice.
[0035] Figure 2The entire process of constructing homozygous knockout yellow catfish for gene editing systems.
[0036] Figure 3 A schematic diagram illustrating the target site location, mutation sequence identification, and protein structure disruption of the rbmx gene knockout in yellow catfish. Figure 3 A is a schematic diagram of the target sequence location for rbmx gene editing; 3B shows the sequence alignment of two main mutation types; 3C is a schematic diagram of how mutations lead to premature termination of protein translation.
[0037] Figure 4 The results of agarose gel electrophoresis of male yellow catfish.
[0038] Figure 5 This is the standard operating procedure for feed utilization efficiency (FCE) testing experiments.
[0039] Figure 6 Wild type and rbmx − / − Comparison of FCE results between male and female mutant yellow catfish.
[0040] Figure 7 For liver circadian rhythm-related genes in WT and rbmx − / − Comparison of expression results within the group.
[0041] Figure 8 For liver metabolism-related genes in WT and rbmx − / − Comparison of expression results within the group. Detailed Implementation
[0042] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0043] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.
[0044] To better understand this teaching and without limiting its scope, all figures and other numerical values used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.
[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. Before a detailed description of this application, the following definitions are provided to better understand it.
[0046] 1. rbmx gene: refers to the gene encoding RNA-binding motif protein X in the yellow catfish (Pelteobagrus fulvidraco). The rbmx gene is based on its publicly available information in the National Center for Biotechnology Information (NCBI) database, with a unique gene identifier of Gene ID: 113635604. This application uses the predicted mRNA sequence of one of its transcript variants (X1) as the operational basis, with the RefSeq accession number XM_027135130.2. In the reference transcript XM_027135130.2, its protein-coding region (CDS) is located at nucleotides 164 to 1300 of the mRNA sequence, specifically as follows:
[0047]
[0048] 2. Mutant alleles: These refer to two specific mutation forms of the rbmx gene in yellow catfish. Among them, "rbmx" +5 "This indicates that the allele has a net 5-base-pair insertion / deletion mutation at the target site compared to the wild-type CDS reference sequence (SEQ ID NO: 1); "rbmx +11 This indicates a net increase of 11 base pairs. The specific DNA sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
[0049] rbmx +5 Gene sequence (SEQ ID NO: 2):
[0050]
[0051] For rbmx +5 The gene, in which "GGC" is mutated to "AAA" at position 17-19 bp in the wild-type reference sequence (SEQ ID NO: 1) of the rbmx gene, and then "AGCTT" is inserted after "AAA" to form the nucleotide sequence.
[0052] rbmx +11 Gene sequence (SEQ ID NO:3):
[0053]
[0054] For rbmx +11 The gene, the nucleotide sequence formed by the mutation of “CCT” to “GAA” at position 19-21 bp in the wild-type reference sequence (SEQ ID NO: 1) of the rbmx gene, and the insertion of “AGCTTCTCATC” at position 26-27 bp.
[0055] 3. Target sequence: refers to a specific sequence located on the rbmx gene DNA of yellow catfish, which can be specifically recognized by the designed sgRNA through the base complementary pairing principle, and guide the Cas9 protein to cleave at this location. In this application, the target sequence is: GGCCTGGGAAGCTTTTCATCGG (SEQ ID NO: 4).
[0056] 4. Homozygotes and Heterozygotes: In this application, in the genome of diploid yellow catfish, if the rbmx genes on a pair of homologous chromosomes are both identical mutant alleles (e.g., both are rbmx), +5 If an individual carries the mutated allele on one chromosome and the other carries the wild-type allele, then that individual is called a homozygote for that mutated allele; if only one chromosome carries the mutated allele and the other carries the wild-type allele, then that individual is called a heterozygote.
[0057] 5. Feed utilization efficiency: In this application, this refers to the core indicator for evaluating the growth performance of yellow catfish. The calculation formula is: Feed utilization efficiency = (Total weight at the end of the experiment - Total weight at the beginning of the experiment) / Total feed intake. The higher this value, the more efficient the fish is in converting feed into body weight.
[0058] 6. F0, F1, and F2 generations: These refer to individuals from different consecutive generations in the breeding process described in this application. Specifically, F0 generation refers to individuals directly microinjected into the CRISPR / Cas9 system; these are chimeras, meaning their somatic cells and germ cells may contain different genotypes. F1 generation refers to the first generation offspring produced by mating F0 generation individuals with wild-type yellow catfish; through screening, heterozygous individuals carrying the target mutant allele can be obtained. F2 generation refers to the second generation offspring produced by mating selected F1 generation heterozygous individuals. Through screening, homozygous individuals carrying the target mutant allele can be obtained, i.e., the yellow catfish mutant with high feed utilization efficiency described in this application.
[0059] The technical solution of this application and the technical effects achieved will be described in detail below through more specific embodiments.
[0060] Example 1: Identification and analysis of the rbmx gene in yellow catfish
[0061] 1. Source of experimental materials
[0062] Experimental fish: Healthy, sexually mature yellow catfish parent fish were obtained from the Experimental Animal Center of Huazhong Agricultural University and temporarily housed in the recirculating aquaculture system of the Institute of Hydrobiology, Chinese Academy of Sciences (water temperature 25±1℃, dissolved oxygen ≥5 mg / L, photoperiod 14L:10D).
[0063] 2. Gene Sequence Acquisition and Identification
[0064] (1) Obtain the predicted mRNA sequence of the yellow catfish rbmx gene (Gene ID: 113635604) from the NCBI database (accession number: XM_027135130.2).
[0065] (2) Based on this sequence, design specific primers to clone its complete full-length CDS sequence (SEQ ID NO: 1), wherein:
[0066] Upstream primer (located in 5'UTR): rbmx-F: GTCCTTACAGTTGACTATGGCGGA (SEQ ID NO: 5);
[0067] Downstream primer: rbmx-R:CATCAAAGTCCATCTCAGTA (SEQ ID NO: 6); The above primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and purified by PAGE.
[0068] (3) Yellow catfish liver tissue was taken, total RNA was extracted using Trizol reagent (Thermo Fisher Scientific), and reverse transcribed into cDNA using PrimeScript RTreagent Kit (Takara).
[0069] (4) Using the above cDNA as a template, perform PCR amplification with the above primers. The PCR reaction system (20 μL) consists of: 10 μL of 2×PCR Mix, 0.5 μL each of forward and reverse primers (10 μM), 1 μL of cDNA template, and 8 μL of ddH2O. The PCR reaction program is as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 60 ℃ for 60 s, 72 ℃ for 30 s, for a total of 35 cycles; 72 ℃ for 5 min.
[0070] (5) After the PCR product was purified by agarose gel electrophoresis, it was sequenced for verification. The obtained sequence was compared with the database sequence to confirm that it was the CDS sequence of the yellow catfish rbmx gene (as shown in SEQ ID NO: 1, corresponding to positions 164-1300 of XM_027135130.2). The encoded protein sequence is as follows: Figure 1 As shown, Figure 1The main purpose was to compare and analyze the protein sequences of yellow catfish with those of model organisms such as zebrafish, medaka, and mice, examining their protein homology and domain similarity. The yellow catfish protein showed high homology with the rbmx proteins of zebrafish, medaka, and other model organisms.
[0071] Example 2: CRISPR / Cas9 target design and sgRNA preparation
[0072] 1. Target design and validation
[0073] By copying the amino acid sequence of the yellow catfish rbmx gene to the NCBI Conserved Domain Database (CDD) website, the positions of three important domains of the rbmx protein were predicted, corresponding to amino acid positions 7-86, 168-223, and 330-378, respectively, and CDD sequence positions of 21-258 bp, 504-669 bp, and 990-1134 bp.
[0074] Based on the coding sequence (CDS) of the yellow catfish rbmx gene, a specific knockout target was designed located within the first exon. This target is located at nucleotides 17-38 in the CDS (counting from the start codon ATG), corresponding to amino acids 6-13 of the protein sequence. The designed target sequence is: GGCCTGGGAAGCTTTTCATCGG (SEQ ID NO:4).
[0075] 2. Preparation of sgRNA in vitro transcription template
[0076] (1) Design sgRNA template primers for in vitro transcription. The upstream primer rbmx-sgRNA-F contains the T7 promoter sequence and a guide sequence complementary to the target sequence; the downstream primer is the universal sequence sgRNA-R, and the specific information is as follows:
[0077] rbmx-sgRNA-F: GTAATACGACTCACTATAGGGCCTGGGAAGCTTTTCGTTTTAGAG
[0078] CTAGAAATAGC (SEQ ID NO: 7)
[0079] sgRNA-R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 8).
[0080] (2) sgRNA amplification (LA-PCR method)
[0081] Using the commonly used laboratory sgRNA backbone plasmid pUC19-gRNA as a template, the validated gRNA solution was diluted with RNase-free water to a final concentration of 10-50 ng / μL. Amplification was performed using a LA-PCR (Long and Accurate PCR) system to obtain sufficient DNA template for subsequent experiments.
[0082] A single PCR reaction volume (25 μL) consists of: 2.5 μL dNTPs, 2 μL LA PCR Buffer, 0.5 μL each of forward and reverse primers, 0.25 μL LA enzyme, 0.5 μL template, and ddH2O to a final volume of 25 μL.
[0083] PCR reaction program: pre-denaturation 94 ℃, 4 min; denaturation 94 ℃, 30 s, annealing 58 ℃, 30 s, extension 72 ℃, 30 s, 35 cycles; final extension 72 ℃, 10 min; 12 ℃, 1 min;
[0084] Four parallel reactions were set up to obtain sufficient PCR products. The PCR products from the four tubes were mixed to a total volume of 100 μL. 5 μL of the mixture was added to 1 μL of 6× Loading Buffer and analyzed by electrophoresis on a 1% (w / v) agarose gel. After confirming a single band (about 100 bp), the PCR products were excised from the gel and recovered. The gel was then washed with 20 μL of RNase-free water into a 1.5 mL RNase-free tube.
[0085] 3. In vitro transcription and purification of sgRNA
[0086] (1) Using the TranscriptAid T7 High Yield Transcription Kit (ThermoScientific), the purified PCR product was used as a template for in vitro transcription reaction and incubated at 37 °C for 2 hours.
[0087] (2) After the reaction was completed, the transcription product was purified by lithium chloride precipitation and dissolved in RNase-free water.
[0088] (3) The concentration of sgRNA was determined using Nanodrop, and its integrity was checked by agarose gel electrophoresis. The qualified sgRNA was aliquoted and stored at -80 °C for later use. The final working concentration was 1000-1500 ng / μL.
[0089] 4. sgRNA sequence verification
[0090] By performing reverse transcription (RT-PCR) and sequencing on the above transcripts, it was confirmed that the actual sequence of the obtained sgRNA was completely consistent with the theoretical RNA sequence deduced from the target sequence of SEQ ID NO: 4 using the above complementarity principle. This verification step ensured the correctness and validity of the sgRNA.
[0091] Through the above design, preparation, and verification process, a functional rbmx-sgRNA molecule was finally obtained. This sgRNA consists of a target-specific guide sequence and a conserved sgRNA backbone sequence covalently linked. This embodiment successfully prepared and defined an sgRNA molecule that specifically targets the rbmx gene of yellow catfish. The sequence characteristic of this sgRNA is that its 5' end contains a guide sequence that is inversely complementary to SEQ ID NO: 4.
[0092] Example 3: Obtaining F0 generation chimeras via microinjection of fertilized eggs
[0093] 1. Preparation of fertilized eggs
[0094] (1) Selectively mature yellow catfish parent fish were used to obtain fertilized eggs through artificial spawning and dry fertilization. (2) The fertilized eggs were evenly spread in a culture dish containing ovarian fluid and placed on the microscope stage.
[0095] 2. Microinjection (1) Prepare the injection mixture on ice: Gently mix 2 μL of the above-prepared rbmx-sgRNA (1200 ng / μL) with 0.5 μL of Cas9 protein (Invitrogen) to make the final working concentration of sgRNA approximately 300 ng / μL. (2) Using a PLI-100 microinjection system (Harvard), inject the mixture quantitatively into the animal pole cytoplasm of the fertilized egg. The injection volume for each fertilized egg is 2 nL (see Figure 2 (3) A total of about 300 fertilized eggs were injected. After the injection, the fertilized eggs were transferred to aerated water at 22-24 ℃ for incubation to obtain F0 generation chimeric fry.
[0096] Example 4: Mutant Screening and Genetic Breeding
[0097] This embodiment provides a method for screening and genetic breeding of yellow catfish mutants. The specific procedure is as follows: Figure 2 conduct.
[0098] 1. F0 generation mutation efficiency detection
[0099] (1) Randomly select 10 hatched F0 generation fry and extract their genomic DNA.
[0100] (2) Detection primers: rbmx-FP:SEQ ID NO:5, rbmx-RP:SEQ ID NO:6.
[0101] (3) PCR amplification was performed using genomic DNA as a template. The PCR products were directly sent to Sanger sequencing. It was found that the sequencing peaks of wild-type fish were single peaks in the upstream and downstream regions of the target site; if overlapping peaks appeared in the sequencing peaks of CRISPR / Cas9 edited experimental fish in the region near the target site, it was preliminarily determined that a knockout had occurred at the target site.
[0102] (4) To determine the specific mutation type, the PCR product was cloned into the pMD-18T vector (Takara Corporation, Japan), transformed into E. coli cells (Trans5α clonal competent cells, Beijing TransGen Biotech Co., Ltd.), and 10 single clones were randomly selected for sequencing. Comparative analysis showed that the target mutation efficiency of the injection group was 100%, and a variety of insertion / deletion (Indel) mutation types were obtained.
[0103] 2. Screening and propagation of F1 generation heterozygous mutants
[0104] (1) The above-mentioned F0 generation fish were raised to sexual maturity (about 12 months) and mated with wild-type (WT) yellow catfish to obtain multiple family F1 generations.
[0105] (2) When the F1 generation fry grow to 3 months old, a small amount of fin rays are cut off to extract DNA. PCR amplification, cloning and sequencing analysis are performed using the primers shown in SEQ ID NO: 5 and 6.
[0106] (3) By analyzing the sequencing results, F1 generation individuals with effective heterozygous mutations in the rbmx gene were screened out.
[0107] In this embodiment, a total of 18 valid mutant individuals were screened, which included two main types of frameshift mutations. Figure 3 This invention demonstrates the CRISPR / Cas9 knockout target designed for the yellow catfish rbmx gene, the two main mutation types obtained, and their disruptive effects on the Rbmx protein structure. For example... Figure 3 As shown in the figure, Figure A shows the location of the target sequence for gene editing, Figure B shows the specific mutation sequence that occurs after gene knockout, and Figure C shows the disruption of the Rbmx protein structure after the rbmx gene is destroyed, leading to the appearance of a stop codon, which in turn causes protein translation to be interrupted, ultimately resulting in the loss of Rbmx protein function. The figure shows that the two mutation types are as follows:
[0108] Type I (named rbmx) +5The mutation involves an 8 bp insertion followed by a 3 bp deletion at the target site. The specific sequence is shown in SEQ ID NO: 2. Compared with the wild-type reference sequence, rbmx... +5 The nucleotide sequence formed by mutating “GGC” to “AAA” at position 17-19 bp in the wild-type reference sequence (SEQ ID NO: 1) of the rbmx gene and inserting “AGCTT” after “AAA”;
[0109] Type II (named rbmx) +11 The mutation involves a 14 bp insertion followed by a 3 bp deletion at the target site. The specific sequence is shown in SEQ ID NO: 3. Compared with the wild-type reference sequence, rbmx... +11 The nucleotide sequence formed by mutating “CCT” to “GAA” at positions 19-21 bp in the wild-type reference sequence (SEQ ID NO: 1) of the rbmx gene and inserting “AGCTTCTCATC” at positions 26-27 bp.
[0110] 3. Obtaining homozygous mutants in the F2 generation
[0111] (1) From the above F1 generation heterozygous mutants, individuals with well-developed gonads were selected and self-crossed to obtain wild-type (WT) and two heterozygous (rbmx) individuals. + / − ) and 2 homozygotes (rbmx) − / − (A large number of F2 generation groups)
[0112] (2) Genotyping of the F2 generation was performed. Homozygotes carrying the same type of effective mutation in both alleles of the rbmx gene were successfully screened using PCR and sequencing. − / − ), including rbmx +5 homozygotes and rbmx +11 Homozygous yellow catfish.
[0113] In this embodiment, a mutant yellow catfish with the loss of rbmx gene function was successfully constructed using a gene editing system.
[0114] Example 5: Mutant Phenotypic Validation - Feed Utilization Efficiency Assessment
[0115] 1. Experimental Design and Feeding Management
[0116] (1) Select healthy wild-type (WT) and rbmx from the F2 generation. +11 homozygote (rbmx) − / − (2) When the fry are 35 days old, sex identification primers are used to sequence and distinguish between males and females. The specific primer information is as follows:
[0117] sex-F:GATTGTAGAAGCCATCTCCTTAGCGTA (SEQ ID NO: 9);
[0118] sex-R: CATGTAGATCACTGTACAATCCCTG (SEQ ID NO: 10).
[0119] Using the yellow catfish genome as a template, amplification was performed using the primers described above. The PCR reaction system consisted of: 10 μL of PCR Mixture (2×), 1 μL of F primer (10 μM), 1 μL of R primer (10 μM), 1.0 μL of DNA template, 8.0 μL of ddH2O, and a total volume of 20 μL. The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5 min; 35 cycles: 95 ℃ for 30 s, 60 ℃ for 60 s, and 72 ℃ for 30 s; and storage at 4 ℃.
[0120] The PCR products were subjected to agarose gel electrophoresis, as follows: Figure 4 As shown, male individuals have 2 bands, while female individuals have 1 band.
[0121] (3) At 45 days of age, male and female individuals with the same genotype were randomly divided into 3 duplicate groups, with 30 individuals in each group.
[0122] All experimental groups were kept under identical rearing conditions: 250 L recirculating aquaculture glass tanks, water temperature 25±1 ℃, dissolved oxygen >6 mg / L, and photoperiod 14L:10D. (4) Feed the fish with Jiasheng yellow catfish formulated feed (crude protein ≥40%). Feed them daily at 10:00 and 18:00 until they are satiated, and accurately record the total amount of feed given to each group each day. The feeding cycle is 45 days. Figure 5 As shown.
[0123] 2. Data Acquisition and Calculation
[0124] (1) At the beginning and end of the experiment, all experimental fish were anesthetized and weighed, and the initial weight (IBW) and final weight (FBW) were recorded.
[0125] (2) Calculate the following indicators:
[0126] Total weight gain (BWG) = FBW - IBW;
[0127] Total feed intake (TFI) = total dry weight of feed fed during the experiment;
[0128] Feed utilization efficiency (FCE) = BWG / TFI.
[0129] 3. Experimental Results
[0130] Experimental results are as follows Figure 6 As shown in the figure. It can be seen from the figure that, compared to the wild-type (WT) group, the homozygous mutant of the rbmx gene (rbmx...) − / − Feed utilization efficiency was significantly improved in female rbmx. Statistical results showed that: − / − The mutant strain had an average FCE approximately 20.2% higher than WT females; male rbmx − / − The mutant had an average FCE that was approximately 17.8% higher than that of WT males. These results indicate that knocking out the rbmx gene can significantly improve feed utilization efficiency in yellow catfish.
[0131] Example 6 Molecular Mechanism Analysis - Analysis of Liver Biological Rhythms and Metabolic Gene Expression
[0132] This embodiment investigates the potential mechanism by which rbmx gene knockout improves feed utilization efficiency by analyzing gene expression in the liver tissue of experimental fish.
[0133] 1. Sample Collection and RNA Extraction: After the feeding experiment concluded, samples were collected daily at a fixed time (e.g., 10:00 AM). Samples were taken from the WT group and the rbmx group respectively. − / − liver of the group
[0134] Visceral tissue was immediately flash-frozen in liquid nitrogen and stored at -80 °C. Total RNA was extracted using RNAiso Plus and reverse transcribed into cDNA.
[0135] 2. Quantitative Real-Time PCR (RT-qPCR) Analysis (1) Design of core genes for liver circadian rhythms (such as per3, cry3a) and key genes for growth and metabolism (such as...) in yellow catfish.
[0136] Specific primers for igf1ra (ghra) were used. β-actin was used as an internal reference gene.
[0137] (2) The reaction was performed using iQ™ SYBR® Green Supermix (Bio-Rad) on a CFX96 Touch real-time quantitative PCR instrument (Bio-Rad). Reaction system (20 μL): 10 μL SYBR Green Mix, 0.5 μL each of forward and reverse primers (10 μM), 1 μL cDNA template, and 8 μL ddH2O. Reaction program: 95 ℃ for 5 min; 95 ℃ for 10 s, 60 ℃ for 20 s, 72 ℃ for 15 s, for a total of 40 cycles.
[0138] (3) Melting curve analysis: 65-95 ℃, increasing by 0.5 ℃ each time, maintaining for 6 s and collecting fluorescence signals. (4) Using β-actin as an internal reference gene, 2 -ΔΔCt The relative expression level of the target gene is calculated using this method.
[0139] 3. Results Analysis Figure 7 The graph shows the mRNA expression levels of the gene per3,cry3a, which is associated with the circadian rhythms of the yellow catfish liver.
[0140] It can be seen that the expression level changed significantly compared with wild type (WT), indicating that after the rbmx gene was knocked out, the expression level of rbmx was significantly reduced. − / − The circadian rhythms of the liver in mutant yellow catfish were affected.
[0141] Figure 8 The figure shows the mRNA expression levels of igf1ra and ghra, genes related to growth, metabolism, and feed utilization efficiency in the liver of yellow catfish. As can be seen from the figure, compared with the wild-type (WT), rbmx... − / − The gene expression in the group was significantly upregulated. These results indicate that knocking out the rbmx gene may positively regulate the expression network of growth and metabolism-related genes in the liver by affecting the circadian rhythm of yellow catfish, ultimately improving feed utilization efficiency.
[0142] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.
Claims
1. Mutant alleles of the yellow catfish rbmx gene, including at least one of the following: rbmx +5 Gene; nucleotide sequence as shown in SEQ ID NO:2; rbmx +11 Gene; nucleotide sequence as shown in SEQ ID NO:
3.
2. Yellow catfish mutants whose genomes include mutant alleles as shown in SEQ ID NO:2 or SEQ ID NO:
3.
3. The yellow catfish mutant according to claim 2, wherein the mutant allele is homozygous.
4. sgRNA, used to knock out the rbmx gene in yellow catfish, with its target nucleotide sequence shown in SEQ ID NO:
4.
5. A primer set for detecting the rbmx gene knockout target site in yellow catfish, wherein the sequence of the rbmx gene knockout target site in yellow catfish is shown in SEQ ID NO: 4, and the primer set includes: rbmx-FP: The nucleotide sequence is shown in SEQ ID NO:5; rbmx-RP: The nucleotide sequence is shown in SEQ ID NO:
6.
6. A method for preparing yellow catfish with high feed utilization efficiency, comprising the following steps: (a) Introducing a gene-editing line containing the sgRNA and Cas9 protein as described in claim 4 into yellow catfish fertilized eggs. system; (b) Hatching and obtaining F0 generation individuals, and mating the F0 generation individuals with wild-type yellow catfish to obtain F1 generation; (c) Using the primer set of claim 5, screen from the F1 generation for primers containing the genome of claim 1. Heterozygous individuals with mutated alleles; (d) Mating the heterozygous individuals to obtain F2 generation individuals, and selecting the individuals specified in claim 1 from the F2 generation individuals. Individuals with homozygous mutant alleles are obtained as the high feed utilization efficiency yellow catfish.
7. The method according to claim 6, wherein in step (a), the amount of the gene editing system injected into each yellow catfish fertilized egg is 1-3 nL, wherein the working concentration of the sgRNA is 200-400 ng / μL.
8. An intermediate material for breeding yellow catfish, which is a heterozygous yellow catfish obtained by step (c) of the method described in claim 6, whose genome contains the mutant allele shown in SEQ ID NO:2 or SEQ ID NO:
3.
9. The application of the mutant allele of claim 1, or the yellow catfish mutant of claim 2 or 3, or the method of claim 6 or 7 in the breeding of yellow catfish varieties with high feed utilization efficiency.