A method for detecting insertion / deletion marker of asic2 gene of shanbei white cashmere goat and application thereof
By designing primer pair P5 and using PCR amplification and electrophoresis techniques to detect ASIC2 gene insertion/deletion, the problem of early selection of growth traits in Shaanbei white cashmere goats was solved, enabling rapid and accurate genotyping identification and improving breeding efficiency.
Patent Information
- Application Number
- CN202610258249.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-04
- Publication Date
- 2026-05-29
AI Technical Summary
Current technology lacks effective methods to detect ASIC2 gene insertion/deletion markers in Shaanbei white cashmere goats, making it difficult to select high-quality cashmere goats in the early stages and affecting the genetic breeding process of growth traits.
Primer pair P5 was designed, and PCR amplification and agarose gel electrophoresis were used to detect the insertion/deletion polymorphism in the upstream regulatory region of the 5' end of the ASIC2 gene of Shaanbei white cashmere goat. The genotype was identified by electrophoresis results, and individuals with ideal genotypes were screened.
It enables rapid, accurate, and low-cost detection of ASIC2 gene polymorphism, significantly improving the accuracy and efficiency of genetic breeding of growth traits in cashmere goats and shortening the generation interval of breeding.
Smart Images

Figure CN122104935A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics technology, specifically relating to a method for detecting insertion / deletion markers of the ASIC2 gene in Shaanbei white cashmere goats and its application. Background Technology
[0002] Sheep farming holds an important position in my country, and the Shaanbei White Cashmere Goat is highly favored by farmers in the Shaanbei region due to its advantages such as tolerance to roughage, ease of feeding, and strong adaptability. With social progress and driven by the continuous growth of market demand, the selective breeding of high-efficiency growth traits for the Shaanbei White Cashmere Goat is currently the core goal and top priority of the industry's development.
[0003] Modern animal breeding technology mainly consists of two branches: conventional breeding techniques that rely on phenotypic values, and molecular breeding techniques based on DNA polymorphism. Marker-assisted selection (MAS) is an important component of the latter. It indirectly screens for ideal genotypes by analyzing molecular markers linked to target genes. Compared to traditional methods, this technology has the advantages of: overcoming environmental limitations to perform early selection, effectively shortening generation intervals, and significantly improving genetic gain and breeding precision.
[0004] Insertion and deletion (InDel) are important structural variations ubiquitous in biological genomes, specifically referring to the insertion or deletion of one or more nucleotides at a specific location in the DNA sequence relative to a reference genome. As a key genetic marker, InDels are characterized by high polymorphism, widespread distribution throughout the genome, and codominant inheritance (capable of directly distinguishing between heterozygous and homozygous genotypes). Furthermore, with the widespread adoption of high-throughput sequencing technology, efficient and low-cost genotyping of InDels can be achieved through techniques such as PCR amplification and electrophoresis, demonstrating significant application value in genetic research.
[0005] Current research on Indel in livestock includes the following reports: Lu et al. reported that the 12bp InDel site of the MGAM gene showed a significant correlation with multiple traits such as chest depth, body weight, body height, and chest circumference in Haimen goats at weaning and 6 months of age (Lu et al., 2025); Guo et al. found that the IGF1R gene was significantly correlated with chest width, body height, chest circumference, and cannon bone circumference in Dezhou donkeys (Guo et al., 2025); Wang et al. found that the 40bp InDel site of the MFSD13A gene was significantly correlated with body weight, body height, and chest circumference in Xia'nan and Nanyang cattle (P<0.05) (Wang et al., 2025). All of these studies indicate that InDel mutations have research value and reference significance for molecular-assisted breeding of livestock.
[0006] Acid-sensitive ion channel 2 (ASIC2) is a member of the acid-sensitive ion channel family (ASIC), which belongs to the degradation / epithelial sodium channel (ENaC / DEG) superfamily. It is involved in maintaining systemic homeostasis and promoting cell migration. Currently, there are no reports on the relationship between the cashmere goat ASIC2 gene and growth traits. Therefore, there is an urgent need to provide a convenient and accurate method for detecting ASIC2 gene insertion / deletion in goats, laying the foundation for early selection of growth traits in goats. Summary of the Invention
[0007] The purpose of this invention is to provide a method for detecting ASIC2 gene insertion / deletion markers in Shaanbei white cashmere goats, thereby accelerating the establishment of a local cashmere goat population with excellent genetic resources.
[0008] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a method for detecting the insertion / deletion polymorphism of the ASIC2 gene in Shaanbei white cashmere goats, the method comprising the following steps: Using the whole genome DNA of the Shaanbei white cashmere goat to be tested as a template, and primer pair P5 as primer, PCR was used to amplify the fragment containing the upstream regulatory region of the 5' end of the goat ASIC2 gene. The amplification products were subjected to electrophoresis, and the genotype of the insertion / deletion polymorphism site was identified based on the electrophoresis results.
[0009] Preferably, the primer pair P5 is as shown in nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2.
[0010] Preferably, the upstream regulatory region fragment at the 5' end of the ASIC2 gene is the insertion / deletion sequence 16746415-16746441 of the ASIC2 gene in accession number NC_030826.1; the insertion / deletion sequence is shown in nucleotide sequence SEQ ID NO.3.
[0011] Preferably, according to the electrophoresis detection results, the insertion / deletion polymorphism site shows an insertion / insertion genotype as a single band of 340 bp, the insertion / deletion genotype shows two bands of 340 bp and 313 bp, and the deletion / deletion genotype DD shows a single band of 313 bp.
[0012] Preferably, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 10 min, and storage at 4℃.
[0013] This invention also provides an application of a method for detecting insertion / deletion polymorphism sites in the ASIC2 gene of Shaanbei white cashmere goats in assisting in improving the growth traits of Shaanbei white cashmere goats. The insertion / deletion polymorphism site in the ASIC2 gene of Shaanbei white cashmere goats is the insertion / deletion sequence at sequence 16746415-16746441 of the ASIC2 gene with accession number NC_030826.1; the insertion / deletion sequence is shown in nucleotide sequence SEQ ID NO.3.
[0014] Preferably, the growth traits of the Shaanbei white cashmere goat are the height of the cross-shaped part and the depth of the chest.
[0015] The present invention also provides a detection kit for insertion / deletion polymorphism of the ASIC2 gene in Shaanbei cashmere goats. The kit includes a primer pair for PCR amplification of the insertion / deletion polymorphic site at position 16746415-16746441del of the cashmere goat ASIC2 gene with accession number NC_030826.1; the primer pair is primer pair P5; the primer pair P5 is shown in the nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2.
[0016] This invention also provides an application of a method for detecting the insertion / deletion polymorphism of the ASIC2 gene in Shaanbei white cashmere goats in the genetic breeding of Shaanbei white cashmere goats, wherein the genetic breeding aims to improve the growth traits of offspring Shaanbei white cashmere goats; The growth traits of the Shaanbei White Cashmere Goat are the height of the cross and the depth of the chest; and the ID genotype is significantly higher than the II and DD genotypes.
[0017] Preferably, in the breeding of sheep, individuals with insertion / deletion genotypes at the deletion polymorphic sites are selected, and individuals with insertion / insertion and deletion / deletion genotypes are eliminated.
[0018] The beneficial effects of this invention are: This invention designs primers based on the cashmere goat ASIC2 gene and uses cashmere goat genomic DNA as a template. Through PCR amplification, agarose gel electrophoresis, and direct sequencing, it can accurately, rapidly, and cost-effectively detect the insertion / deletion polymorphism at position NC_030826.1:g.16746415_16746441 of the cashmere goat ASIC2 gene. This invention utilizes PCR amplification technology to detect the insertion / deletion polymorphism of the cashmere goat ASIC2 gene and performs genotype and allele frequency analysis. For the first time, it has discovered a significant correlation between the ASIC2 gene and the growth trait of Shaanbei white cashmere goats, making it an effective DNA marker for the genetic breeding of growth traits in Shaanbei white cashmere goats. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 for Figure 1 The product of primer pair P5 amplification of the cashmere goat ASIC2 gene was obtained by 3% agarose gel electrophoresis; where M represents Marker I; Figure 2 The sequence diagram shows the PCR amplification product of the ASIC2 gene. The part marked by the black box represents the 27 bp insert sequence: NC_030826.1:g.16746415_16746441; the sequencing sequence is the 27 bp insert sequence: TGTTCACCAGTGGACCCTTTATCTTTT (SEQ ID NO.3). Detailed Implementation
[0021] This invention provides a method for detecting insertion / deletion markers of the ASIC2 gene in cashmere goats and its application, which helps to select early growth traits of goats through screening and molecular marker-assisted breeding. Preferably, the goat is the Shaanbei White Cashmere Goat.
[0022] The present invention discloses a method for detecting insertion / deletion polymorphism of the GNG4 gene in cashmere goats, comprising using the whole genome of the cashmere goat to be tested as a template, PCR amplifying fragments containing insertion / deletion polymorphisms at mutation sites in the 5' regulatory region of the ASIC2 gene, performing agarose gel electrophoresis on the PCR amplification products, and identifying the genotype of the insertion / deletion polymorphism at the mutation sites based on the electrophoresis results.
[0023] The primer pair (p5) is as follows: Upstream primer (P5-F): 5'-ACCACAACCTGACAAGGAAGG-3' (SEQ ID NO.1); Downstream primer (P5-R): 5'-GCGATGAGATATTCCAGGGCT-3' (SEQ ID NO.2).
[0024] The PCR reaction procedure for the primer pair p5 is as follows: Pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; extension at 72℃ for 10 min, and storage at 4℃. The insertion / deletion polymorphic site at position 16746415_16746441del shows a single band of 340 bp for insertion / deletion genotype II, two bands of 340 bp and 313 bp for insertion / deletion genotype ID, and a single band of 313 bp for deletion / deletion genotype DD; the electrophoresis is performed using a 3% agarose gel.
[0025] The present invention also provides a detection kit for insertion / deletion polymorphism of cashmere goat ASIC2 gene, the kit comprising primer pairs for PCR amplification of insertion / deletion polymorphic sites at positions 16746415-16746441 of cashmere goat ASIC2 gene and PCR reaction solution.
[0026] Preferably, the primer pair includes primer pair P5 as follows: Upstream primer (P5-F): 5'-ACCACAACCTGACAAGGAAGG-3' (SEQ ID NO.1); Downstream primer (P5-R): 5'-GCGATGAGATATTCCAGGGCT-3' (SEQ ID NO.2).
[0027] Application of ASIC2 gene NC_030826.1:g.16746415_16746441 insertion / deletion as a molecular marker in cashmere goat early growth trait-assisted selection breeding.
[0028] The results of the embodiments of the present invention show that the insertion / deletion polymorphism that may be caused by the mutation at the 16746415-16746441 site of the goat ASIC2 gene (NC_030826.1) can be detected by PCR and agarose gel electrophoresis, and the correlation between the mutation and the growth traits of goats can be analyzed to verify that it can be used as a molecular marker for auxiliary selection of growth traits in goats.
[0029] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0030] The proteinase K used in this invention was purchased from Huamei Engineering Biotechnology Co., Ltd.; the Taq DNA polymerase was purchased from Fermantas (MBI); Marker I was purchased from Tiangen Biotech (Beijing) Co., Ltd.; and the general reagents were purchased from Huamei Engineering Biotechnology Co., Ltd., and were imported and repackaged products.
[0031] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.
[0032] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.
[0033] Example 1 1.1 Experimental reagents and materials (1) Biochemical and biological reagents: proteinase K, Taq DNA polymerase and Marker I.
[0034] (2) Common reagents: glucose, Kcl, citric acid, EDTA, sodium citrate, Tris, NaCl, Na2HPO4, KH2PO4, sucrose, Tris saturated phenol, isoamyl alcohol, bromophenol blue, chloroform, sodium dodecyl sulfonate (SDS), anhydrous ethanol, NaOH, sodium acetate, ethidium bromide (EB), dimethyl phenyl cyanide FF, boric acid, acetic acid, agarose, etc.
[0035] (3) Solutions and buffer solutions: All solutions and buffer solutions were prepared using deionized ultrapure water. Autoclaving conditions were 15 bf / in (1.034 × 10⁻⁶). 5 Pa), 25 min.
[0036] The reagent preparation methods were all based on "Molecular Cloning: A Laboratory Manual" edited by Sambrook et al.
[0037] (4) Solution used for extracting DNA from tissue samples ① Common solution used for extracting genomic DNA; ②2 mol / L NaCl: 11.688 g dissolved in water, brought to a final volume of 100 mL, and then autoclaved at high temperature; ③ Tissue DNA extraction solution (100 mL): 1 mL of 1 mol / L Tris-HCl (pH 8.0), 5 mL of 2 mol / L NaCl, 20 mL of 0.5 mol / L EDTA (pH 8.0), bring the volume to 100 mL.
[0038] (5) Solutions used for agarose gel electrophoresis analysis ① 0.5X TBE buffer: Take 50 mL of 10X TBE and bring the volume to 1000 mL; ② Sample loading buffer: containing 0.25% bromophenol blue and 0.25% dimethylphenyl cyanide FF, in a 40.0% (w / v) sucrose aqueous solution.
[0039] 1.2 Design of primers for the InDel site of the ASIC2 gene in cashmere goats The sequence of the goat ASIC2 gene was retrieved from NCBI. Primers capable of amplifying the DNA fragment of the candidate InDel site of the ASIC2 gene were designed using Primer 5.0. Among them, the primer pair that can amplify the InDel site of the 5' regulatory region of the cashmere goat ASIC2 gene at position 16746415-16746441 is P5. The primer sequences are shown in Table 1.
[0040] Table 1 Primer list for candidate InDel sites of the ASIC2 gene in cashmere goats
[0041] 1.3 PCR amplification of the 5' regulatory region fragment of the ASIC2 gene in cashmere goats to be tested 1.3.1 Collection of ear tissue samples from cashmere goats The animals used in the experiment were selected from Shaanbei white cashmere goats raised on a sheep farm in Yulin City, Shaanxi Province, totaling 1332 samples. Ear tissue samples about the size of a soybean were cut from the experimental goats using ear clippers, preserved in 70% ethanol, and then stored in an ice box at -80°C after being brought back to the laboratory.
[0042] 1.3.2 Extraction of genomic DNA from tissue samples Referencing Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2002), and the following reference: Bai Yangyang. Study on mRNA expression, InDel and CNV detection of PPP3CA and PPP6C genes in Shaanbei white cashmere goats and their association with important economic traits [D]. Northwest A&F University, 2023. DOI:10.27409 / d.cnki.gxbnu.2022.000902.
[0043] 1.3.3 Agarose gel electrophoresis for DNA detection Refer to *Molecular Cloning: A Laboratory Manual*, edited by Sambrook et al. (2002).
[0044] 1.3.4 DNA purification Refer to *Molecular Cloning: A Laboratory Manual*, edited by Sambrook et al. (2002).
[0045] 1.3.5 Spectrophotometric Detection of DNA The OD values of the extracted DNA samples at 260 nm and 280 nm were measured using a UV spectrophotometer. The DNA content and OD values were calculated. 260 / OD 280 The ratio. For example, OD. 260 / OD 280 If the ratio is less than 1.6, it indicates that the sample contains a large amount of protein or phenol and should be purified; if the ratio is greater than 1.8, RNA removal and purification should be considered.
[0046] DNA concentration (ng / μL) = 50 × OD 260 Value × dilution factor.
[0047] After DNA testing is completed, a certain amount is taken out, diluted to 20 ng / μL, and stored in a -20℃ freezer for later use. The remaining sample is stored in a -80℃ freezer.
[0048] 1.3.6 PCR Amplification The PCR reaction adopted the mixed loading method. Based on the required amount of each component in each reaction system and the number of PCR reactions required for one reaction, the total amount of each reaction component was calculated, mixed into a 2 mL centrifuge tube, thoroughly mixed by pipetting, and then briefly centrifuged. The mixture was then aliquoted into 0.2 mL PCR tubes, and template DNA was added sequentially. After brief centrifugation, PCR amplification was performed.
[0049] The PCR reaction system consisted of 6.5 μL of 2×Taq SuperMix (containing Taq DNA polymerase and dNTPsHE-optimized reaction buffer at a concentration of 2X), 0.3 μL each of forward and reverse primers (each at 10 pmol / μL), 0.7 μL of genomic DNA (at a concentration of 20 ng / μL), and 5.2 μL of deionized water, for a total PCR amplification volume of 13 μL.
[0050] 1.3.7 PCR Reaction Procedure The PCR reaction program for primer pair P5 was as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 10 min, and storage at 4℃. 1.3.8 PCR product agarose gel electrophoresis detection and analysis Prepare a 3% agarose gel, stain with ethidium bromide (EB) nucleic acid dye, spot 6 μL of the sample and electrophoresis at 120 V for 45 min; After DNA fragments of different molecular weights were clearly separated, they were imaged using the Invitrogen iBright gel imaging system. Genotyping was analyzed based on the results of agarose gel electrophoresis. PCR amplification of cashmere goat genes using primer pair P5 was successful, amplifying a fragment containing the 5' regulatory region NC_030826.1:g.16746415_16746441 of the cashmere goat ASIC2 gene. The electrophoresis results of the amplified fragment are shown in the figure. Figure 1 (II represents the insertion / insertion genotype, characterized by a single band of 340 bp; ID represents the insertion / deletion genotype, characterized by two bands of 340 bp and 313 bp; DD represents the deletion / deletion genotype, characterized by a single band of 313 bp; sequencing identification of the amplified fragment revealed (sequencing results as shown in...) Figure 2 As shown in the figure, the expected sequencing sequence was an insertion / deletion of 27 bp TGTTCACCAGTGGACCCTTTATCTTTT (SEQ ID NO.4), but the actual sequencing sequence was an insertion / deletion of 27 bp TGTTCACCAGTGGACCCTTTATCTTTT (SEQ ID NO.3).
[0051] 1.3.9 Statistical analysis of the frequency of the InDel locus in the ASIC2 gene of cashmere goats Genotype frequency refers to the proportion of a certain genotype in a population relative to the total number of individuals.
[0052] The genotype frequencies of insertion / deletion polymorphic sites at position NC_030826.1:g.16746415_16746441 in the 5' regulatory region of the ASIC2 gene in Shaanbei white cashmere goats are shown in Table 2.
[0053] Table 2. Frequency distribution of the ASIC2 gene at positions 16746415-16746441 in cashmere goats.
[0054] Example 2: Correlation analysis of gene benefits at the InDel locus of the ASIC2 gene in cashmere goats. Genotype data: Genotypes identified by agarose gel electrophoresis and sequencing after PCR amplification.
[0055] The correlation between the InDel polymorphism site of the ASIC2 gene and the growth morphology of Shaanbei white cashmere goats was analyzed using SPSS 26.0 software. During data processing, considering individual effects, gene interactions, and genotype effects, one-way tests were used for correlation analysis.
[0056] The results of the correlation analysis are shown in Table 3.
[0057] As shown in Table 3, there are significant differences in the height of the cross (P=0.045) and the depth of the chest (P=0.013) among different genotypes at positions 16746415-16746441 of the ASIC2 gene.
[0058] Table 3. Results of Correlation Analysis
[0059] This invention utilizes PCR amplification to detect the insertion / deletion polymorphism site at position NC_030826.1:g.16746415_16746441 of the ASIC2 gene in cashmere goats, and performs correlation analysis with the growth traits of Shaanbei white cashmere goats, finding that it can serve as an effective molecular marker for genetic breeding of goat growth traits.
[0060] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A method for detecting insertion / deletion polymorphism in the ASIC2 gene of Shaanbei white cashmere goats, characterized in that, The method includes the following steps: Using the whole genome DNA of the Shaanbei white cashmere goat to be tested as a template, and primer pair P5 as primer, PCR was used to amplify the fragment containing the upstream regulatory region of the 5' end of the goat ASIC2 gene. The amplification products were subjected to electrophoresis, and the genotype of the insertion / deletion polymorphism site was identified based on the electrophoresis results.
2. The method according to claim 1, characterized in that, The primer pair P5 is shown in nucleotide sequences SEQ ID NO.1 and SEQ ID NO.
2.
3. The method according to claim 1, characterized in that, The upstream regulatory region fragment at the 5' end of the ASIC2 gene is the insertion / deletion sequence 16746415-16746441 of the ASIC2 gene in accession number NC_030826.1; the insertion / deletion sequence is shown in nucleotide sequence SEQ ID NO.
3.
4. The method according to claim 1, characterized in that, According to the electrophoresis results, the insertion / deletion polymorphism site showed a single band of 340 bp for the insertion / insertion genotype, two bands of 340 bp and 313 bp for the insertion / deletion genotype, and a single band of 313 bp for the deletion / deletion genotype DD.
5. The method according to claim 1, characterized in that, The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; 72℃ extension for 10 min, and storage at 4℃.
6. The application of a method for detecting insertion / deletion polymorphism sites in the ASIC2 gene of Shaanbei white cashmere goats in assisting in improving the growth traits of Shaanbei white cashmere goats, characterized in that... The insertion / deletion polymorphism site of the ASIC2 gene in Shaanbei white cashmere goats is the insertion / deletion sequence at sequence 16746415-16746441 of the ASIC2 gene with accession number NC_030826.1; the insertion / deletion sequence is shown in nucleotide sequence SEQ ID NO.
3.
7. The application according to claim 6, characterized in that, The growth traits of the Shaanbei White Cashmere Goat are its cross-shaped height and chest depth.
8. A detection kit for ASIC2 gene insertion / deletion polymorphism in Shaanbei cashmere goats, characterized in that, The kit includes a primer pair for PCR amplification of the insertion / deletion polymorphic site at position 16746415-16746441del of the cashmere goat ASIC2 gene with accession number NC_030826.1; the primer pair is primer pair P5; the primer pair P5 is shown in nucleotide sequences SEQ ID NO.1 and SEQ ID NO.
2.
9. The application of a method for detecting ASIC2 gene insertion / deletion polymorphism in Shaanbei white cashmere goats in the genetic breeding of Shaanbei white cashmere goats, characterized in that... The genetic breeding mentioned above aims to improve the growth traits of offspring Shaanbei white cashmere goats; The growth traits of the Shaanbei White Cashmere Goat are the height of the cross and the depth of the chest; and the ID genotype is significantly higher than the II and DD genotypes.
10. The application according to claim 9, characterized in that, In the breeding of breeding sheep, individuals with insertion / deletion genotypes at the aforementioned deletion polymorphic sites are selected, and individuals with insertion / insertion and deletion / deletion genotypes are eliminated.