Fast detection method, composition and kit for klebsiella oxytoca and klebsiella planticola era
By using ERA technology and fluorescence method to detect Cronobacter sakazakii and Cronobacter zurichi, the problem of requiring specialized equipment for traditional PCR technology has been solved, achieving rapid and accurate detection results, which is suitable for detection in infant formula milk powder.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINESE ACAD OF INSPECTION & QUARANTINE
- Filing Date
- 2024-11-19
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of Cronobacter sakazakii and Cronobacter zurich in infant formula, and traditional PCR technology requires specialized equipment and cannot be efficiently amplified at room temperature.
Enzymatic recombination isothermal amplification (ERA) technology was employed, and specific ERA primers and probes were designed. Fluorescence methods were used to detect Cronobacter sakazakii and Cronobacter zurichi, achieving rapid detection through single and double ERA fluorescence methods.
It enables rapid, accurate, and sensitive detection of Cronobacter sakazakii and Cronobacter zurichi at room temperature, suitable for on-site testing, applicable to water and food samples, and provides an efficient detection method.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection. Specifically, this invention relates to a fluorescence method for the simultaneous and rapid detection of *Cronobacter sakazakii* and *Cronobacter zuriensis*, an oligonucleotide primer-probe composition for the method, and a kit containing the composition. Background Technology
[0002] Kronobacter spp. ( Cronobacter sp p. ), originally named Cronobacter sakazakii ( Enterobacter sakazakii *Cronobacter sakazakii*, renamed and classified under the genus *Cronobacter* in 2008, currently comprises 7 species. It is a Gram-negative, non-spore-forming bacillus with flagella, facultatively anaerobic, and widely distributed in the natural environment. Cronobacter sakazakii *Cronobacter sakazakii* is one of the most prevalent opportunistic pathogens in this genus, causing meningitis, sepsis, and necrotizing enterocolitis in newborns and infants. It is widely found in dairy products, dried fruits, infant cereals, and herbs. Infant formula is the most common source of contamination. Due to its heat and dryness resistance, it can survive for extended periods in low-moisture environments, making it highly susceptible to contaminating infant formula during processing and production, leading to serious infections in newborns and infants.
[0003] The genus *Cronobacter* is divided into 7 species and 3 subspecies, namely *Cronobacter sakazakii* (… C. sakazakii ), Cronobacter malonate ( C. malonaticu s), Zurich Cronobacter ( C. turicensis Moginskohlii ( C. muytjensii ), Kronobacterium dublinum ( C. dublinensis (including Kronobacter berberis subspecies in infant formula) C. dublinensis subsp. Lactaridi), Cronobacter dublin subspecies of Dublin ( C. dublinensis subsp. Dublinensis and Cronobacter dublinii subspecies Lausanne ( C. dublinensis subsp. Lausannensis ), Contimonte Crohn's disease ( C. condimenti ), Univols seronobacterium ( C. universalis Currently, among the seven species, only *Cronobacter sakazakii* has a relevant detection standard: SN / T2099-2008 Detection Method for *Cronobacter sakazakii* in Exported Food, which adopts... fusA Gene sequencing method.
[0004] With the rapid development of molecular biology techniques, various molecular biology techniques for tracing biological components by identifying nucleic acids have advantages such as high specificity, high sensitivity, resistance to environmental interference, and stable results, and are increasingly widely used in the detection of foodborne pathogens. However, the currently popular PCR technology usually takes about 2 hours to detect and requires a professional temperature-controlled nucleic acid amplification instrument. In 2019, my country developed an isothermal nucleic acid amplification technology with global independent intellectual property rights—Enzymatic Recombinase Amplification (ERA). This technology can efficiently and rapidly amplify trace amounts of DNA and RNA specific fragments at room temperature of 37–42℃, hence it is also known as body temperature amplification technology, meaning that amplification can be completed in the palm or armpit of a person, without relying on temperature control equipment. Under body temperature, the recombinase and primer bind tightly to each other, forming a polymer of recombinase and primer. When the recombinase and primer polymer finds a perfectly matching complementary sequence on the template DNA, the double-stranded structure of the template DNA is opened with the help of single-stranded DNA-binding proteins. Under the action of DNA polymerase, primers extend along the 5′→3′ direction, forming new complementary DNA strands and completing the exponential growth of the amplification product. Significant breakthroughs have been achieved in its low-temperature adaptability and sensitivity, reaching international advanced levels. Compared with traditional PCR and LAMP isothermal amplification techniques, its most significant advantage is that amplification can be completed within 10-20 minutes at body temperature. This technology is rapid, convenient, and accurate, and has become a research hotspot in recent years. Summary of the Invention
[0005] The purpose of this invention is to rapidly, efficiently, accurately, and sensitively detect the components of Cronobacter sakazakii and Cronobacter zurich. This method is crucial for the detection and traceability of Cronobacter sakazakii and Cronobacter zurich in infant formula milk powder, ensuring the safety of newborns and infants.
[0006] The inventors of this invention used the outer membrane protein X gene of *Cronobacter sakazakii* and *Cronobacter zurich* from the NCBI database. ompX ), recombination and repair protein gene, recN ), and the virulence gene direct hemolysin gene (thermostable direct hemolysin, tdhMeanwhile, gene sequences of five other species in the genus *Cronobacter* were retrieved: *Cronobacter malondiophilus*, *Cronobacter moginskoye*, *Cronobacter dublinum*, *Cronobacter univoskoye*, and *Cronobacter contimonte*. Based on the primer design principles of ERA technology, specific ERA primers and probes capable of efficiently detecting *Cronobacter sakazakii* and *Cronobacter zurichensis* were designed in the differential regions. Through a series of screening experiments, the appropriate primers and probes were finally determined. recN A rapid ERA detection method for *Cronobacter sakazakii* and *Cronobacter zurichi*.
[0007] In one aspect of the invention, oligonucleotide primers for rapid detection of *Cronobacter sakazakii* using single ERA fluorescence are provided: upstream sakazakii F1: 5′-CCAGAAGCTGCTTGAAGAGCAACAGCTC-3′ and downstream sakazakii R1: 5′-GCGTCAGTTCGCGCGCATACACTACGCG-3′. In another aspect, a probe for rapid detection of *Cronobacter sakazakii* using single ERA fluorescence is also provided: sakazakii P: 5′-GACCAGGCCGATTGCCTGGAAACGTTGACTCTGGCGGTCAACAAAC-3′, with the 3′ end of the probe blocked by a c3-spacer, the T base at position 30 modified with a fluorescent reporter group FAM, the C base at position 31 replaced with THF, and the T base at position 32 modified with a quencher group BHQ1. This probe, combined with the sakazakii F1 and sakazakii R1 primer pairs, performs single ERA fluorescence amplification to specifically recognize *Cronobacter sakazakii*. The reaction program in the qPCR instrument was set as follows: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; FAM fluorescence signal was collected during the second reaction stage.
[0008] In another aspect of the invention, oligonucleotide primers for rapid detection of *Cronobacter zurichensis* using single-base ERA fluorescence are provided: upstream Zurich F7: 5′-TGATGTGTGTGACCCACCTGCCGCAAGT-3′, and downstream Zurich R8: 5′-AGCTCTTTGGCGTTCGCCAGTGTATTGC-3′. The probe for rapid detection of *Cronobacter zurichensis*, Zurich P1-1: 5′-CGCGGGTTGCGGCCACCATCATTTCTTCGTCAGCAAAGAGACTG-3′, has its 3′ end blocked with a c3-spacer, the T base at position 27 modified with a fluorescent reporter group FAM, the G base at position 29 replaced with THF, and the T base at position 30 modified with a quencher group BHQ1. This probe, combined with the Zurich F7 and Zurich R8 primer pairs, is used for single-base ERA fluorescence amplification to specifically recognize *Cronobacter zurichensis*.
[0009] In another aspect of the invention, an oligonucleotide primer-probe combination for the simultaneous rapid detection of *Cronobacter sakazakii* and *Cronobacter zuriensis* using a dual ERA fluorescence method is provided. The primers sakazakii F1, sakazakii R1, zuriensis F7, and zuriensis R8, and the probe zuriensis P1-1, are identical to those used in the single ERA fluorescence method. However, the fluorescent reporter group modified at the 30th T base of the sakazakii P sequence is replaced with Cy5 (sakazakii P-Cy5), while other modifications are the same as those for the single ERA fluorescence probe sakazakii P. The oligonucleotide primer combination of sakazakii F1, sakazakii R1, zuriensis F7, and zuriensis R8, along with the probes zuriensis P1-1 and sakazakii P-Cy5, is used for dual ERA fluorescence amplification, enabling the simultaneous rapid detection of *Cronobacter sakazakii* and *Cronobacter zuriensis*.
[0010] In another aspect of the invention, a composition comprising the above-described oligonucleotide sequence is provided. The composition comprises the following primer and probe sequences: (1) Rapid detection of oligonucleotide primer pairs Sakazaki F1 and Sakazaki R1 and probe Sakazaki P by single ERA fluorescence method; (2) Rapid detection of oligonucleotide primer pairs Zurich F7 and Zurich R and probe Zurich P1-1 by single ERA fluorescence method for Cronobacter zurich; (3) The oligonucleotide primer pairs Sakazaki F1, Sakazaki R1, Zurich F7 and Zurich R8, as well as the probes Zurich P1-1 and Sakazaki P-Cy5, were simultaneously and rapidly detected by dual ERA fluorescence method for the simultaneous detection of Cronobacter sakazaki and Cronobacter zurich.
[0011] In one embodiment, the amplification conditions for single-dose ERA fluorescence amplification of *Cronobacter sakazakii* and *Cronobacter Zurich* are 37 °C for 1 s; 37 °C for 14 s, for 60 cycles; FAM fluorescence signal is collected during the second reaction stage. The detection results are analyzed by fluorescence curve analysis. A good amplification curve indicates a positive result, while no amplification indicates a negative result.
[0012] In another embodiment, the dual ERA fluorescence amplification conditions for *Cronobacter sakazakii* and *Cronobacter Zurich* are 37 °C for 1 s; 37 °C for 14 s, for 60 cycles; FAM / Cy5 fluorescence signals are collected separately during the second reaction stage. The detection results are analyzed by fluorescence curve analysis. If a good amplification curve is obtained in the FAM fluorescence channel, the detection result for *Cronobacter Zurich* is positive; if a good amplification curve is obtained in the Cy5 fluorescence channel, the detection result for *Cronobacter sakazakii* is positive; if both FAM and Cy5 fluorescence channels obtain good amplification curves, the detection results for both *Cronobacter sakazakii* and *Cronobacter Zurich* are positive; if neither is amplified, the detection result is negative.
[0013] In another aspect of the invention, rapid detection kits for single-effect ERA fluorescence and dual-effect fluorescence methods are provided for *Cronobacter sakazakii* and *Cronobacter zurichi*, respectively, wherein the kits contain the oligonucleotide sequence or the composition.
[0014] The kit provided by this invention includes specific primer and probe compositions for rapid detection of Cronobacter sakazakii and Cronobacter zurich using single-effect ERA fluorescence and dual-effect fluorescence methods, as well as instructions for use.
[0015] In one embodiment, the present invention comprises *Cronobacter sakazakii* and *Cronobacter zurichi*. recN The sequence is the basic sequence, and specific primers and probes are respectively located at... recN Nucleic acid sequence design for conserved regions in the sequence. In one embodiment, the kit contains the following Cronobacter sakazakii-specific amplification target sequence: CCAGAAGCTGCTTGAAGAGCAACAGCTCCTGGACGACCAGGCCGATTGCCTGGAAACGTTGACTCTGGCGGTCAACAAACATCACCAGCAGGCGCTGGCGGTAGCGCACGCGCTGCATGAAAGTCGCGTAGTGTATGCGCGCGAACTGACGC, with a target sequence length of 152 bp. The following Cronobacter zurichensis-specific amplification target sequence is: TGATGTGTGTGACCCACCTGCCGCAAGTCGCGGGTTGCGGCCACCATCATTTCTTCGTCAGCAAAGAGACTGATGGCGCGATGACCGAAACCCATATGCAGCCGCTGGATAAAAAAGCCCGCCTGCAGGAGCTGGCCCGCCTGCTGGGCGGCAGTGAGGTGACGCGCAATACACTGGCGAACGCCAAAGAGCT, with a target sequence length of 193 bp. In one specific embodiment, the kit for detecting *Cronobacter sakazakii* and *Cronobacter zuriensis* of the present invention further includes controls. Preferably, the controls include a positive control and a negative control. In one embodiment, the negative control is sterile double-distilled water.
[0016] In another embodiment, the ERA fluorescence method has a sensitivity of 1 ng / μL for detecting *Cronobacter sakazakii* and 1 ng / μL for detecting *Cronobacter zurichensis*. The dual ERA fluorescence method has a sensitivity of 10 ng / μL for detecting both *Cronobacter sakazakii* and *Cronobacter zurichensis*.
[0017] In another aspect of the invention, the invention provides the application of the composition or the kit in the detection of Cronobacter sakazakii and Cronobacter zurich in milk powder samples.
[0018] The design of amplification primers and probes is crucial for developing sensitive and rapid ERA detection methods, because primers with different sequences exhibit different behaviors in the ERA reaction, which will affect amplification efficiency and amplification speed. Therefore, primer design and screening are essential.
[0019] Because ERA technology requires unique reaction conditions of 37–42 °C, primer design is strictly regulated. Regular PCR primers are unsuitable, as ERA primers are longer than typical PCR primers, usually needing to be 28–35 nt. Primers that are too short will reduce recombination rates, affecting amplification speed and detection sensitivity. Primers that are too long may generate primer dimers or hairpin structures during amplification, thus affecting nucleic acid amplification yield. Furthermore, denaturation temperature is no longer a critical factor affecting amplification primer design when designing ERA primers.
[0020] Furthermore, to establish an ERA fluorescence method, ERA detection probes need to be designed. The probe design requires placement in the middle of the primer, complete complementarity to the template, and a length of 46–52 nucleotides, with at least 30 nucleotides at the 5′ end and at least 15 nucleotides at the 3′ end of the THF site. The fluorescent and quenching groups can only be labeled on thymine (T), with a spacing of 1–5 nucleotides between them. Larger spacing leads to higher base values and lower signal-to-noise ratios, thus reducing quenching efficiency. One nucleotide in the middle is replaced with tetrahydrofuran (THF), and the spacing between the dT-fluorophore or dT-quencher and the THF bases is 0, 1, or 2. The 3′ end of the probe needs to be modified and blocked with a blocking group, such as a C3-spacer, phosphate, amine, biotin, or tetraethylene glycol. Under the action of exonuclease II, the two groups are separated, and the fluorescence signal accumulates simultaneously with the amplification product growth, allowing for simultaneous detection of the fluorescence curve.
[0021] On the one hand, primer and probe design for ERA technology is not as mature as that for traditional PCR, and there is currently no design software available. Therefore, although the requirements for primer and probe design are known, the final selection still requires specific experimental screening and optimization, and the experimental results are not always predictable.
[0022] On the other hand, the target gene sequences of the seven species of *Cronobacter* are highly similar. Under these circumstances, designing an ERA primer-probe that does not cross-link with other *Cronobacter* species and meets the requirements for specificity and sensitivity is not anticipated. In fact, the research process did not yield results from... ompX and tdhThe gene sequencing did not involve finding a suitable primer and probe combination for ERA detection of *Cronobacter sakazakii* and *Cronobacter zurenbergi*, but rather involved multiple design and experiments. recN The gene has been found.
[0023] Furthermore, the method in this application involves the simultaneous detection of two different species, *Cronobacter sakazakii* and *Cronobacter Zurich*. Designing primers and probes for this is far more challenging than for single-species detection. Not only must the specificity and sensitivity of the primers and probes meet the requirements, but cross-reactivity among multiple primer sets in a single reaction system must be eliminated, and consistency in amplification efficiency must be ensured as much as possible. Therefore, screening suitable dual-ERA detection primers and probes is more difficult.
[0024] Based on the characteristics of Cronobacter sakazakii, the inventors used... recN For the target gene, ERA fluorescence detection primers and probes were designed: Sakazaki F1 / Sakazaki R1 / Sakazaki P; based on the characteristics of Cronobacter zosteri, using... recN For the target gene, ERA fluorescence detection primers and probes were designed as follows: (1) Zurich F1 / Zurich R1 / Zurich P1-1, (2) Zurich F7 / Zurich R1 / Zurich P1-1, (3) Zurich F1 / Zurich R8 / Zurich P1-1, and (4) Zurich F7 / Zurich R8 / Zurich P1-1. By comparing the amplification efficiency, specificity, detection limit and other parameters, the oligonucleotide primer and probe combination for rapid detection of Cronobacter sakazakii using ERA technology provided by this invention was finally determined to be Sakazaki F1 / R1 / Sakazaki P, and the oligonucleotide primer and probe combination for rapid detection of Cronobacter zurichi was determined to be Zurich F7 / Zurich R8 / Zurich P1-1.
[0025] Based on the single ERA fluorescence results, dual fluorescence ERA detection analysis was performed on Cronobacter sakazakii and Cronobacter zurichi. The probe Zurich P1-1 was still FAM fluorescence, while the probe Sakazaki P was replaced with Cy5 and ROX fluorescence, respectively.
[0026] Table 1 Primer and probe screening sequence information
[0027] Note: a This indicates that during the primer screening process, the fluorescent groups of the probes are uniformly modified with FAM-dT, and during the dual ERA fluorescence detection process, the fluorescent groups of the probes are replaced with Cy5 and ROX.
[0028] This invention cleverly utilizes the specificity of ERA technology for efficient DNA amplification and nucleic acid hybridization, establishing two rapid on-site detection methods for *Cronobacter sakazakii* and *Cronobacter zurenbergi* using single and dual fluorescence methods, respectively. These methods offer advantages such as simple operation, time and labor saving, accuracy, reliability, speed, and sensitivity. They can be used for rapid qualitative detection of *Cronobacter sakazakii* and *Cronobacter zurenbergi* in water, food, and other samples, providing excellent technical support for the rapid screening of these two bacteria. Attached Figure Description
[0029] Figure 1 This is the result of primer and probe screening for *Cronobacter sakazakii*. Strains 1-9 represent nine different *Cronobacter* species, with the following strain names and numbers: 1. *Cronobacter sakazakii* (10403.17), 2. *Cronobacter mogins* (10403.20), 3. *Cronobacter malondiamide* (15201), 4. *Cronobacter dublinii* (15203), 5. *Cronobacter univars* (30419), 6. *Cronobacter zurichii* (15202), 7. *Cronobacter montillata* (LMG26250), 8. *Cronobacter dermosyne* subsp. *mercaptos* (CICC 24181), 9. *Cronobacter dermosyne* subsp. *dublinii* (LMG 23824), and CK represents the blank control.
[0030] Figure 2 These are the results of the specific detection of common non-Cronobacter spp. pathogens in food using the above-mentioned preferred primer-probe combination Sakazaki F1 / Sakazaki R1 / Sakazaki P, where 1 is Cronobacter sakazakii, and 2-16 are respectively: 2. Pseudomonas fluorescens ATCC13525, 3. Escherichia coli O157:H7 ATCC43895, 4. Salmonella typhimurium ATCC14028, and 5. Vibrio parahaemolyticus ATCC. 33847, 6. Staphylococcus aureus ATCC27664, 7. Listeria monocytogenes ATCC13932, 8. Cronobacter sakazakii ATCC29544, 9. Shigella flexneri CMCC51571, 10. Yersinia enterocolitica ATCC27729, 11. Bacillus cereus ATCC10876, 12. Beta-hemolytic streptococcus CMCC32210, 13. Burkholderia gladioli cocovenenans CICC 25108, 14. Escherichia coli CMCC44104, 15. Pseudomonas aeruginosa ATCC25619, 16. Serratia marcescens ATCC8100, CK represents blank control.
[0031] Figure 3The results show the sensitivity analysis of the above-mentioned preferred primer-probe combination Sakazaki F1 / Sakazaki R1 / Sakazaki P against Cronobacter sakazakii using the ERA method. Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 ng / μL, CK represents the blank control, and each sample is repeated in two replicates.
[0032] Figure 4 shows the results of primer and probe screening for *Cronobacter zurichensis*. 1-9 represent nine *Cronobacter* species, with the following strain names and numbers: 1. *Cronobacter sakazakii* (10403.17), 2. *Cronobacter mogins* (10403.20), 3. *Cronobacter malondiamide* (15201), 4. *Cronobacter dublinii* (15203), 5. *Cronobacter univars* (30419), 6. *Cronobacter zurichensis* (15202), 7. *Cronobacter montillata* (LMG26250), 8. *Cronobacter berghei* subsp. *bacillus* (CICC 24181), 9. *Cronobacter zurichensis* subsp. *lausanne* (LMG 23824), and CK represents the blank control.
[0033] Figure 5 These are the results of the specific detection of common non-Cronobacter spp. pathogens in food using the above-mentioned preferred primer-probe combination Zurich F7 / Zurich R8 / Zurich P1-1, where 1 is Zurich Cronobacter, and 2-16 are respectively: 2. *Pseudomonas fluorescens* ATCC13525, 3. *Escherichia coli* O157:H7 ATCC43895, 4. *Salmonella typhimurium* ATCC14028, and 5. *Vibrio parahaemolyticus* ATCC. 33847, 6. Staphylococcus aureus ATCC27664, 7. Listeria monocytogenes ATCC13932, 8. Cronobacter sakazakii ATCC29544, 9. Shigella flexneri CMCC51571, 10. Yersinia enterocolitica ATCC27729, 11. Bacillus cereus ATCC10876, 12. Beta-hemolytic streptococcus CMCC32210, 13. Burkholderia gladioli cocovenenans CICC 25108, 14. Escherichia coli CMCC44104, 15. Pseudomonas aeruginosa ATCC25619, 16. Serratia marcescens ATCC8100, CK represents blank control.
[0034] Figure 6 The results show the sensitivity analysis of the above-mentioned preferred primer-probe combination Zurich F7 / Zurich R8 / Zurich P1-1 against Cronobacter zoster using the ERA method. Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 ng / μL, CK represents the blank control, and each sample is repeated in two replicates.
[0035] Figure 7 shows the combination of the FAM fluorescence of the above-mentioned preferred primer-probe sequence combination Zurich F7 / Zurich R8 / Zurich P1-1 with the Cy5 and ROX fluorescence of Sakazaki F1 / Sakazaki R1 / Sakazaki P, where FAM(a) represents Cronobacter Zurich. Figure 7A ROX(b) and Figure 7B The Cy5(c) fluorescence channel was used to detect Cronobacter sakazakii, and CK represented the blank control.
[0036] Figure 8 The results show the sensitivity analysis of the dual ERA method for *Cronobacter sakazakii* and *Cronobacter zurius* using the above-mentioned preferred dual primer-probe combination Sakazakii F1 / Sakazakii R1 / Sakazakii P (Cy5) and Zurich F7 / Zurich R8 / Zurich P1-1 (FAM). Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 10 -3 ng / μL, CK represents the blank control, and each sample is repeated in two replicates. Detailed Implementation
[0037] The present invention will be further described by way of examples, but the present invention is not limited to the following examples. Example 1: ERA primer and probe screening and fluorescence detection performance analysis for the detection of Cronobacter sakazakii
[0038] The primer and probe design (Table 1) was analyzed for amplification efficiency, specificity, and sensitivity, and the primer and probe combination for rapid detection of Cronobacter sakazakii using the ERA method was finally determined.
[0039] 1) DNA extraction from Cronobacter sakazakii: using PrepMan TM The Ultra Sample Preparation Reagent kit was used to extract DNA from Cronobacter sakazakii and diluted with sterile water to a concentration of 10 ng / μL for testing.
[0040] 2) Detection System: Prepare the premix for each sample according to the instructions of the Fluorescent Amplification Reagent Kit (ERA method): 20 μL solvent, 2.1 μL forward primer, 2.1 μL reverse primer, 0.6 μL probe, 1 μL template, and 22.2 μL ddH2O. Transfer the premix to a PCR tube containing the fluorescent amplification reagent, vortex to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cap the tube, centrifuge briefly to allow the activator to enter the premix, vortex briefly to mix, centrifuge again quickly, and place in a mini qPCR instrument.
[0041] 3) Reaction program: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; in the second reaction stage, select FAM for the fluorescence channel and set the threshold to the default. Use sterile water as a blank control.
[0042] 4) Result Interpretation: A blank control showing no amplification curve is considered valid; otherwise, the result is considered invalid. A clear amplification curve indicates a positive result. No fluorescence curve indicates a negative result.
[0043] like Figure 1 As shown, the designed primer-probe combination of Sakazaki F1 / Sakazaki R1 / Sakazaki P has high amplification efficiency.
[0044] like Figure 2 As shown, specificity and coverage analysis of the primer-probe combination Sakazaki F1 / Sakazaki R1 / Sakazaki P revealed that only *Cronobacter sakazakii* showed amplification, while DNA from other *Cronobacter* species and the ddH2O blank control showed no amplification. This fully demonstrates that the specific oligonucleotide primers screened in this experiment exhibit excellent specificity for the detection of *Cronobacter sakazakii*.
[0045] like Figure 3 As shown, further sensitivity analysis was performed on the screened primer-probe combination Sakazaki F1 / Sakazaki R1 / Sakazaki P. The results showed that this oligonucleotide primer combination had the highest sensitivity, and could detect a minimum concentration of 1 in Cronobacter sakazakii. ng / μL. Example 2: ERA primer and probe screening and fluorescence detection performance analysis for the detection of Cronobacter zoster in Zurich
[0046] The primer and probe design (Table 1) was analyzed for amplification efficiency, specificity, and sensitivity, and the primer and probe combination for rapid detection of Cronobacter zoster using the ERA method in Zurich was finally determined.
[0047] 1) DNA extraction from Cronobacter zinei in Zurich: Same as in Example 1 above.
[0048] 2) Detection system: Same as in Example 1 above.
[0049] 3) Reaction procedure: Same as Example 1 above.
[0050] 4) Result determination: Same as Example 1 above.
[0051] Figure 4 shows a comparison of the amplification efficiency of four combinations of candidate primers and probes detected by ERA fluorescence assay in Cronobacter zinei from Zurich. Figure 4A The results showed that the amplification efficiency of the self-designed primers and probes Zurich F1 / Zurich R1 / Zurich P1-1 was slightly lower. Figure 4B and 4CThe results showed that Zurich F7 / Zurich R1 / Zurich P1-1 and Zurich F1 / Zurich R8 / Zurich P1-1 did not amplify, while Zurich F7 / Zurich R8 / Zurich P1-1 had the highest amplification efficiency. Figure 4D The self-designed Zurich F7 / Zurich R8 / Zurich P1-1 primer-probe combination exhibited high amplification efficiency.
[0052] like Figure 5 As shown, specificity and coverage analysis of the screened primer-probe combination Zurich F7 / Zurich R8 / Zurich P1-1 revealed amplification only in *Cronobacter zurich*, while DNA from other *Cronobacter* species and the ddH2O blank control showed no amplification. This fully demonstrates the excellent specificity of the specific oligonucleotide primers screened in this experiment for the detection of *Cronobacter zurich*.
[0053] like Figure 6 As shown, further sensitivity analysis was performed on the screened primer-probe combination Zurich F7 / Zurich R8 / Zurich P1-1. The results showed that this oligonucleotide primer combination had the highest sensitivity, and could detect a minimum concentration of 1 oz. ng / μL. Example 3: Performance analysis of the preferred ERA primer and probe dual ERA fluorescence method for detecting *Cronobacter sakazakii* and *Cronobacter zuriensis*.
[0054] The performance of the selected Cronobacter sakazakii and Cronobacter zurich ERA primers and probes was further analyzed by dual ERA fluorescence method, and the primer and probe combination for rapid detection of Cronobacter sakazakii and Cronobacter zurich by dual ERA fluorescence method was finally determined.
[0055] 1) DNA extraction from *Cronobacter sakazakii* and *Cronobacter zurichi*: Same as in Example 1 above.
[0056] 2) Detection System: Prepare the premix for each sample according to the instructions of the Fluorescent Amplification Reagent Kit (ERA method): 20 μL of solvent, 1 μL each of forward and reverse primers, 0.4 μL each of probes, 1 μL each of templates, and 1.2 μL of ddH2O2. Transfer the premix to a PCR tube containing the fluorescent amplification reagent, vortex to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cap the tube, centrifuge briefly to allow the activator to enter the premix, vortex briefly to mix, centrifuge again quickly, and place in a mini qPCR instrument.
[0057] 3) Reaction program: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; during the second reaction stage, FAM / ROX / Cy5 fluorescence signals were collected separately, with the threshold set to the default value. Sterile water was used as a blank control.
[0058] 4) Result Interpretation: A blank control showing no amplification curve is considered valid; otherwise, the result is considered invalid. A clear amplification curve indicates a positive result. No fluorescence curve indicates a negative result.
[0059] As shown in Figure 7, the FAM (a) fluorescence of the above-mentioned preferred primer-probe sequence combination Zurich F7 / Zurich R8 / Zurich P1-1 was combined with the ROX (b) and Cy5 (c) fluorescence of Sakazaki F1 / Sakazaki R1 / Sakazaki P, respectively. Figure 7A and 7B Both combinations showed amplification, with the Sakazaki Cy5 and Zurich FAM combination exhibiting higher amplification efficiency. Figure 7B ).
[0060] like Figure 8 As shown, the sensitivity of the preferred dual primer-probe combination Sakazaki F1 / Sakazaki R1 / Sakazaki P (Cy5) and Zurich F7 / Zurich R8 / Zurich P1-1 (FAM) against *Cronobacter sakazakii* and *Cronobacter zurich* using the dual ERA method was further analyzed. Figures 1-6 represent template DNA concentrations of *Cronobacter sakazakii* at 100, 10, 1, and 10⁻⁶, respectively. -1 10 -2 ng / μL; af indicates that the concentration of Cronobacter zoster template DNA in Zurich is 100, 10, 1, 10 ng / μL, respectively. -1 10 -2 The results showed that this oligonucleotide primer combination could simultaneously detect *Cronobacter sakazakii* and *Cronobacter zuriensis* at a minimum concentration of 10 ng / μL. ng / μL. Example 4: Detection limits of Cronobacter sakazakii and Cronobacter zurich in artificially contaminated samples.
[0061] 1) Sample pretreatment: Take 25 mL of sterile water and prepare artificially contaminated samples of Cronobacter sakazakii and Cronobacter Zurich according to the method described in SN / T 1632.3—2013 "Test Method for Cronobacter sakazakii (Cronobacter spp.) in Exported Milk Powder". Take 25 mL of homogenized solution from 7 groups and add 10 mL of homogenized solution to each sample. 8 CFU / mL of *Cronobacter sakazakii* and *Cronobacter zurichi* were serially diluted to 10⁻⁶. 7 ~10 0 Artificially contaminated samples with CFU / mL were enriched at 37°C for 0, 2, 4, 6, and 8 h.
[0062] 2) The DNA extraction, fluorescence detection system, reaction procedure, and result interpretation steps are the same as in Example 3. Sterile ddH2O was used as a blank control during the experiment.
[0063] The results of the artificially contaminated samples are shown in Table 2. The results show that the established dual ERA fluorescence method for Cronobacter sakazakii and Cronobacter zurich can reach a minimum detection limit of 1 CFU / mL after 8 hours of pre-enrichment, and the method has high sensitivity.
[0064] Table 2 Detection results of artificially contaminated samples
Claims
1. A composition for detecting Cronobacter sakazakii by single-layer ERA fluorescence assay, characterized in that, The composition comprises specific oligonucleotide primer pairs 5′-CCAGAAGCTGCTTGAAGAGCAACAGCTC-3′ and 5′-GCGTCAGTTCGCGCGCATACACTACGCG-3′ for detecting Cronobacter sakazakii, and a probe 5′-GACCAGGCCGATTGCCTGGAAACGTTGACTCTGGCGGTCAACAAAC-3; wherein the 3′ end of the probe is blocked with a c3-spacer, the T base at position 30 is modified with a fluorescent reporter group FAM, the C base at position 31 is replaced with THF, and the T base at position 32 is modified with a quencher group BHQ1.
2. Specific oligonucleotide primer pairs 5′-TGATGTGTGTGACCCACCTGCCGCAAGT-3′ and 5′-AGCTCTTTGGCGTTCGCCAGTGTATTGC-3′, and probe 5′-CGCGGGTTGCGGCCACCATCATTTCTTCGTCAGCAAAGAGACTG-3′, for the detection of Cronobacter zosteri in Zurich by single ERA fluorescence assay; wherein, The 3′ end of the probe is blocked with a c3-spacer, the T base at position 27 is modified with the fluorescent reporter group FAM, the G base at position 29 is replaced with THF, and the T base at position 30 is modified with the quencher group BHQ1.
3. A composition for detecting Cronobacter sakazakii by dual ERA fluorescence assay, characterized in that, The composition comprises the specific oligonucleotide primer pair of claim 1 and a probe; wherein the 3′ end of the probe sequence is blocked with a c3-spacer, the T base at position 30 is modified with a fluorescent reporter group Cy5, the C base at position 31 is replaced with THF, and the T base at position 32 is modified with a quencher group BHQ1.
4. A composition for detecting *Cronobacter sakazakii* and *Cronobacter zuriensis* by dual ERA fluorescence assay, characterized in that, The composition also includes the specific oligonucleotide primer pair of claim 1, the composition of claim 2, and the probe of claim 3.
5. A method and kit for detecting Cronobacter sakazakii by single ERA fluorescence assay, said method comprising using the composition of claim 1.
6. A method and kit for detecting Cronobacter zosteri by single ERA fluorescence assay, said method comprising using the composition of claim 2.
7. A method and kit for the simultaneous detection of *Cronobacter sakazakii* and *Cronobacter zuriensis* by dual ERA fluorescence assay, said method and kit comprising using the composition of claim 4.
8. The composition according to claims 1, 2 and 4, the method and kit according to claims 5, 6 and 7, and their application in the rapid detection of Cronobacter sakazakii and Cronobacter zurichensis.