A rapid detection method, composition and kit for cronobacter dublinensis and cronobacter univans ERA
By employing ERA technology and designing specific primers and probes, we have achieved rapid and accurate detection of Kronobacter dublinum and Kronobacter univar at room temperature, solving the problems of long detection time and equipment dependence in existing technologies and ensuring food safety.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINESE ACAD OF INSPECTION & QUARANTINE
- Filing Date
- 2024-11-18
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for detecting Cronobacter are time-consuming, require specialized equipment, and are difficult to detect simultaneously and quickly and accurately both Cronobacter dublinii and Cronobacter univosk.
Enzymatic recombination isothermal amplification (ERA) technology was used to design specific ERA primers and probes. Fluorescence was used to detect *Cronobacter dublinii* and *Cronobacter univoskensis* separately or simultaneously, and rapid detection was performed using the ompX and recN genes.
It enables rapid, accurate, and sensitive detection of two strains at room temperature, and is suitable for detecting Kronobacter dublin and Kronobacter univar in infant formula, ensuring the safety of newborns and infants.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection. Specifically, this invention relates to a fluorescence method for the simultaneous and rapid detection of *Cronobacter dublinae* and *Cronobacter univoskronobacter*, an oligonucleotide primer-probe composition for the method, and a kit containing the composition. Background Technology
[0002] Kronobacter spp. ( Cronobacter sp p. ), originally named Cronobacter sakazakii ( Enterobacter sakazakii In 2008, it was renamed and classified into the genus *Cronobacter*, which currently includes 7 species. It is a Gram-negative, non-spore-forming bacillus with flagella, facultative anaerobic, and widely distributed in the natural environment.
[0003] The genus *Cronobacter* is divided into 7 species and 3 subspecies, namely *Cronobacter sakazakii* (… C. sakazakii ), Cronobacter malonate ( C. malonaticu s), Zurich Cronobacter ( C. turicensis Moginskohlii ( C. muytjensii ), Kronobacterium dublinum ( C. dublinensis (including Kronobacter berberis subspecies in infant formula) C. dublinensis subsp. Lactaridi), Cronobacter dublin subspecies of Dublin ( C. dublinensis subsp. Dublinensis and Cronobacter dublinii subspecies Lausanne ( C. dublinensis subsp. Lausannensis ), Contimonte Crohn's disease ( C. condimenti ), Univols seronobacterium ( C. universalis Currently, among the seven species, only *Cronobacter dublinii* has a relevant detection standard: SN / T2099-2008 Detection Method for *Cronobacter dublinii* in Exported Food, which uses the fusA gene sequencing method.
[0004] Kronobacter spp. is an important foodborne pathogen, detected in various foods including infant formula, meat, water, and vegetables, with infant formula being the primary route of infection. Kronobacter spp. is associated with neonatal meningitis, necrotizing enterocolitis, sepsis, bloody dysentery, and brain abscess. Therefore, timely detection of Kronobacter spp. is crucial for preventing its harmful effects.
[0005] With the rapid development of molecular biology techniques, various molecular biology techniques for tracing biological components by identifying nucleic acids have advantages such as high specificity, high sensitivity, resistance to environmental interference, and stable results, and are increasingly widely used in the detection of foodborne pathogens. However, the currently popular PCR technology usually takes about 2 hours to detect and requires a professional temperature-controlled nucleic acid amplification instrument. In 2019, my country developed an isothermal nucleic acid amplification technology with global independent intellectual property rights—Enzymatic Recombinase Amplification (ERA). This technology can efficiently and rapidly amplify trace amounts of DNA and RNA specific fragments at room temperature of 37–42℃, hence it is also known as body temperature amplification technology, meaning that amplification can be completed in the palm or armpit of a person, without relying on temperature control equipment. Under body temperature, the recombinase and primer bind tightly to each other, forming a polymer of recombinase and primer. When the recombinase and primer polymer finds a perfectly matching complementary sequence on the template DNA, the double-stranded structure of the template DNA is opened with the help of single-stranded DNA-binding proteins. Under the action of DNA polymerase, primers extend along the 5′→3′ direction, forming new complementary DNA strands and completing the exponential growth of the amplification product. Significant breakthroughs have been achieved in its low-temperature adaptability and sensitivity, reaching international advanced levels. Compared with traditional PCR and LAMP isothermal amplification techniques, its most significant advantage is that amplification can be completed within 10-20 minutes at body temperature. This technology is rapid, convenient, and accurate, and has become a research hotspot in recent years. Summary of the Invention
[0006] The purpose of this invention is to rapidly, efficiently, accurately, and sensitively detect the components of *Cronobacter dublinii* and *Unionoblastobacter spp.*. This method is crucial for the detection and traceability of *Cronobacter dublinii* and *Unionoblastobacter spp.* in infant formula milk powder, and is essential for ensuring the food safety of newborns and infants.
[0007] The inventors of this invention, based on the outer membrane protein X gene of *Cronobacter dublinum* and its two subspecies and *Cronobacter univar* from the NCBI database, [made this invention possible]. ompX ), recombination and repair protein gene, recN ), and the virulence gene the thermolysin gene (thermostable direct hemolysin, tdhMeanwhile, gene sequences of five other species in the genus *Cronobacter* were retrieved: *Cronobacter malonica*, *Cronobacter moginskoye*, *Cronobacter sakazaki*, *Cronobacter zuriense*, and *Cronobacter contimonte*. Based on the primer design principles of ERA technology, specific ERA primers and probes capable of efficiently detecting *Cronobacter dublinii* and *Cronobacter univoskornis* were designed in the differential regions. Through a series of screening experiments, the appropriate primers and probes were finally determined. ompX and recN Genetic analysis was performed using ERA rapid detection of *Cronobacter dublinii* and *Cronobacter univar*.
[0008] In one aspect of the invention, oligonucleotide primers for rapid detection of *Cronobacter dublinum* using single ERA fluorescence are provided: upstream Dublin F1: 5′-AGCTCCTTTACTTACACCGAAAAAGATC-3′, and downstream Dublin R1: 5′-ATCGCTGGTATCAGCTTTGTCGCCGTCA-3′. In another aspect, a probe for rapid detection of *Cronobacter dublinum* using single ERA fluorescence is provided: Dublin P1: 5′-CGAAGACGGCATCTACAACAAAGGCCAGTACTACGGCATCACCGCAGG-3′. The probe has a 3′ end blocked with a c3-spacer, a T base at position 29 modified with a fluorescent reporter group FAM, a C base at position 31 replaced with THF, and a T base at position 32 modified with a quencher group BHQ1. The probe Dublin P1, combined with Dublin F1 and Dublin R1, is used for single ERA fluorescence amplification to specifically recognize *Cronobacter dublinum*. The reaction program in the qPCR instrument was set as follows: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; FAM fluorescence signal was collected during the second reaction stage.
[0009] In another aspect of the invention, oligonucleotide primers for rapid detection of *Unionovask ronnobacterium* using single-base ERA fluorescence amplification are provided: upstream UnionF6: 5′-ACTGGAGCAGCGCATCTCCCGTCAAATT-3′, and downstream UnionR6-2: 5′-TGCATACTGTCGGTAATCAGCTGTGTCA-3′. The probe for rapid detection of *Unionovask ronnobacterium*, Union recN-P: 5′-GCTGGACGACCAGGCTGATTGTCTGGAAACGTTGACTCTGGCGGTCAA-3′, wherein the 3′ end of the probe is blocked with a c3-spacer, the T base at position 33 is modified with a fluorescent reporter group FAM, the G base at position 34 is replaced with THF, and the T base at position 35 is modified with a quencher group BHQ1. The probe UnionF6, combined with UnionR6-2 and Union recN-P, undergoes single-base ERA fluorescence amplification to specifically recognize *Unionovask ronnobacterium*.
[0010] In another aspect of the invention, oligonucleotide primers and probes for the simultaneous and rapid detection of *Cronobacter dublinum* and *Unionvoskronobacter* using a dual ERA fluorescence method are provided. The primers Dublin F1, Dublin R1, Union F6, and Union R6-2, as well as the probe Union recN-P, are identical to those used in the single ERA fluorescence method. However, the fluorescent reporter group modified with the T base at position 30 of the probe Dublin P1 sequence is replaced with Cy5 (Dublin P1-Cy5), while other modifications are the same as those for the single ERA fluorescence probe Dublin P1. The oligonucleotide primer pairs Dublin F1, Dublin R1, Union F6, and Union R6-2, along with the probes Dublin P1-Cy5 and Union recN-P sequences, are used together for dual ERA fluorescence amplification, enabling the simultaneous and rapid detection of *Cronobacter dublinum* and *Unionvoskronobacter*.
[0011] In another aspect of the invention, a composition comprising the above-described oligonucleotide sequence is provided. The composition comprises the following primer and probe sequences: (1) Rapid detection of oligonucleotide primer pairs Dublin F1, Dublin R1 and probe Dublin P1 by single ERA fluorescence method for Kronobacter dublin; (2) Rapid detection of oligonucleotide primer pairs Unni F6, Unni R6-2 and probe Unni recN-P of O. unni Vossrnos by single ERA fluorescence method; (3) The dual ERA fluorescence method was used to simultaneously and rapidly detect the oligonucleotide primer pairs Dublin F1 and Dublin R1, Uni F6 and Uni R6-2 of Kronobacter dublin and Kronobacter univosk. The probes Dublin P1-Cy5 and Uni recN-P were also used.
[0012] In one embodiment, the amplification conditions for single-dose ERA fluorescence amplification of *Cronobacter dublinii* and *Cronobacter univar* are 37 °C for 1 s; 37 °C for 14 s, for 60 cycles; FAM fluorescence signal is collected during the second reaction stage. The detection results are analyzed by fluorescence curve analysis; a good amplification curve indicates a positive result, while no amplification indicates a negative result.
[0013] In another embodiment, the dual ERA fluorescence amplification conditions for *Cronobacter dublinii* and *Univoc. schronobacter* are 37 °C for 1 s; 37 °C for 14 s, for 60 cycles; FAM and Cy5 fluorescence signals are collected simultaneously during the second reaction phase. Analysis of the detection results using fluorescence curves indicates a positive result for *Cronobacter dublinii* if a good amplification curve is obtained in the FAM fluorescence channel; a good amplification curve in the Cy5 fluorescence channel indicates a positive result for *Univoc. schronobacter* if both FAM and Cy5 fluorescence channels show good amplification curves; and a positive result for both *Cronobacter dublinii* and *Univoc. schronobacter* if no amplification is observed. If no amplification is observed in either channel, the results for both *Cronobacter dublinii* and *Univoc. schronobacter* are negative.
[0014] In another aspect of the invention, rapid detection kits for single-phase ERA fluorescence and dual-phase fluorescence methods are provided for *Cronobacter dublinii* and *Cronobacter univoskensis*, respectively, wherein the kits contain the oligonucleotide sequence or the composition.
[0015] The kit provided by this invention includes specific primer and probe compositions for rapid detection of Kronobacter dublin and Kronobacter univar using single-effect ERA fluorescence and dual-effect fluorescence methods, as well as instructions for use.
[0016] In one embodiment, the present invention uses *Cronobacter dublinii*. ompX The sequence is the basic sequence, and specific primers and probes are respectively located at... ompX Nucleic acid sequence design of conserved regions in the sequence; using *Univols serovar Norovirus* as an example. recN The sequence is the basic sequence, and specific primers and probes are respectively located at... recNNucleic acid sequence design for conserved regions within the sequence. In one embodiment, the kit contains a *Cronobacter dublin*-specific amplification target sequence of: AGCTCCTTTACTTACACCGAAAAAGATCGCACCGAAGACGGCATCTACAACAAAGGCCAGTACTACGGCATCACCGCAGGTCCGGCTTACCGTCTGAACGACTGGGCGAGCATCTACGGCGTAGTGGGTGTTGGCTACGGTAAAGCTCAGGCTACCGCTGACGGCGACAAAGCTGATACCAGCGAT; the target sequence length is 186 bp. The *Cronobacter dublin*-specific amplification target sequence is: The target sequence length is 252 bp. In one specific embodiment, the kit for detecting *Cronobacter dublinii* and *Cronobacter univar* of the present invention further includes controls. Preferably, the controls include a positive control and a negative control. In one embodiment, the negative control is sterile double-distilled water.
[0017] In another embodiment, the sensitivity of the ERA fluorescence method for detecting Cronobacter dublin is 10. -1 The sensitivity for detecting Univococcus roxburghii is 10 ng / μL. -1 The sensitivity of the dual ERA fluorescence method for detecting *Cronobacter dublinii* and *Cronobacter univar* was 1 ng / μL.
[0018] In another aspect of the invention, the invention provides the application of the composition or the kit in the detection of Kronobacter dublinii and Kronobacter univosk in milk powder samples.
[0019] The design of amplification primers and probes is crucial for developing sensitive and rapid ERA detection methods, because primers with different sequences exhibit different behaviors in the ERA reaction, which will affect amplification efficiency and amplification speed. Therefore, primer design and screening are essential.
[0020] Because ERA technology requires unique reaction conditions of 37–42 °C, primer design is strictly regulated. Regular PCR primers are unsuitable, as ERA primers are longer than typical PCR primers, usually needing to be 28–35 nt. Primers that are too short will reduce recombination rates, affecting amplification speed and detection sensitivity. Primers that are too long may generate primer dimers or hairpin structures during amplification, thus affecting nucleic acid amplification yield. Furthermore, denaturation temperature is no longer a critical factor affecting amplification primer design when designing ERA primers.
[0021] Furthermore, to establish an ERA fluorescence method, ERA detection probes need to be designed. The probe design requires placement in the middle of the primer, complete complementarity to the template, and a length of 46–52 nucleotides, with at least 30 nucleotides at the 5′ end and at least 15 nucleotides at the 3′ end of the THF site. The fluorescent and quenching groups can only be labeled on thymine (T), with a spacing of 1–5 nucleotides between them. Larger spacing leads to higher base values and lower signal-to-noise ratios, thus reducing quenching efficiency. One nucleotide in the middle is replaced with tetrahydrofuran (THF), and the spacing between the dT-fluorophore or dT-quencher and the THF bases is 0, 1, or 2. The 3′ end of the probe needs to be modified and blocked with a blocking group, such as a C3-spacer, phosphate, amine, biotin, or tetraethylene glycol. Under the action of exonuclease II, the two groups are separated, and the fluorescence signal accumulates simultaneously with the amplification product growth, allowing for simultaneous detection of the fluorescence curve.
[0022] Primer and probe design for ERA technology is not as mature as that for traditional PCR, and there is currently no design software available. Although the requirements for primer and probe design are known, the final selection still requires specific experimental screening and optimization, and the experimental results are not always predictable.
[0023] On the other hand, the target gene sequences of the seven species of *Cronobacter* are highly similar. Under these circumstances, designing an ERA primer-probe that does not cross-link with other *Cronobacter* species and meets the requirements for specificity and sensitivity is not anticipated. In fact, the research process did not yield results from... tdh The gene sequencing did not involve finding a suitable primer-probe combination for ERA detection of *Kronobacter dublinii* and *Kronobacter univar*, but rather involved multiple design and experiments. ompX Gene-specific identification of Kronobacter dublinis, from recN Find a primer-probe combination that specifically identifies Univococcus roxburghii.
[0024] Furthermore, the method in this application involves the simultaneous detection of two different species, *Cronobacter dublinae* and *Cronobacter univars*. Designing primers and probes for this is far more challenging than for single-species applications. Not only must the specificity and sensitivity of the primers and probes meet the requirements, but cross-reactivity among multiple primer sets in a single reaction system must be eliminated, and the consistency of amplification efficiency must be ensured as much as possible. Therefore, screening suitable dual ERA detection primers and probes is even more difficult.
[0025] Based on the characteristics of Kronobacter dublin, the inventors used... ompX For the target gene, ERA fluorescence detection primers and probes were designed: (1) Dublin F1 / Dublin R 修 / Dublin P1、(2)Dublin F1 / Dublin R 修 / crono-P2, (3) Dublin F1 / Dublin R1 / Dublin P1, (4) Dublin F1 / Dublin R1 / crono-P2; Based on the characteristics of Univosk cronobacterium, recN For the target gene, ERA fluorescence detection primers and probes were designed as follows: (1) Uni F6 / Uni R6-2 / Uni recN-P, (2) Uni F6 / Uni R6-5 / Uni recN-P, and (3) Uni F6 / Uni R6-6 / Uni recN-P. By comparing the amplification efficiency, specificity, detection limit and other index parameters, the oligonucleotide primer and probe combination for rapid detection of Cronobacter dublin and its two subspecies using ERA technology provided by this invention was finally determined to be Dublin F1 / R1 / Dublin P1, and the oligonucleotide primer and probe combination for rapid detection of Cronobacter dublin was determined to be Uni F6 / Uni R6-2 / Uni recN-P.
[0026] Based on the single ERA fluorescence results, dual fluorescence ERA detection analysis was performed on Cronobacter dublin and Cronobacter univosk. (1) The probe univosk recN-P still used FAM fluorescence, and the probe dublin P1 was replaced with Cy5 fluorescence; (2) The probe dublin P1 still used FAM fluorescence, and the probe univosk recN-P was replaced with ROX fluorescence; (3) The probe dublin P1 was replaced with Cy5 fluorescence, and the probe univosk recN-P was replaced with ROX fluorescence.
[0027] Table 1 Primer and probe screening sequence information
[0028] Note: a This indicates that during the primer screening process, the fluorescent groups of the probes are uniformly modified with FAM-dT, and during the dual ERA fluorescence detection process, the fluorescent groups of the probes will be replaced with Cy5 or ROX fluorescence depending on the combination.
[0029] This invention cleverly utilizes the specificity of ERA technology for efficient DNA amplification and nucleic acid hybridization, establishing two rapid on-site detection methods for *Cronobacter dublinum* and *Univoc. serovar. dublin* using single and dual fluorescence methods. These methods offer advantages such as simple operation, time and labor saving, accuracy, reliability, speed, and sensitivity. They can be used for rapid qualitative detection of *Cronobacter dublinum* and *Univoc. serovar. dublinum* in water, food, and other samples, providing excellent technical support for the rapid screening of these two bacteria. Attached Figure Description
[0030] Figure 1 shows the results of primer and probe screening for *Cronobacter dublinus*. Nine strains of *Cronobacter* are listed as 1-9, with the strain name and strain number as follows: 1. *Cronobacter dublinus* (15203), 2. *Cronobacter dermatologica* subsp. *milk powder* (CICC24181), 3. *Cronobacter dermatologica* subsp. *Lossan* (LMG 23824), 4. *Cronobacter sakazakii* (10403.17), 5. *Cronobacter univarskola* (30419), 6. *Cronobacter zurichensis* (15202), 7. *Cronobacter monte* (LMG26250), 8. *Cronobacter mogins* (10403.20), 9. *Cronobacter malonide* (15201). CK represents the blank control.
[0031] Figure 2 These are the results of the specific detection of common non-Cronobacter spp. pathogens in food using the above-mentioned preferred primer-probe combination Dublin F1 / Dublin R1 / Dublin P1, where 1 is Cronobacter dublin, and 2-16 are respectively: 2. Pseudomonas fluorescens ATCC13525, 3. Escherichia coli O157:H7 ATCC43895, 4. Salmonella typhimurium ATCC14028, and 5. Vibrio parahaemolyticus ATCC. 33847, 6. Staphylococcus aureus ATCC27664, 7. Listeria monocytogenes ATCC13932, 8. Cronobacter dublinum ATCC29544, 9. Shigella flexneri CMCC51571, 10. Yersinia enterocolitica ATCC27729, 11. Bacillus cereus ATCC10876, 12. Beta-hemolytic streptococcus CMCC32210, 13. Burkholderia gladioli cocovenenans CICC 25108, 14. Escherichia coli CMCC44104, 15. Pseudomonas aeruginosa ATCC25619, 16. Serratia marcescens ATCC8100, CK represents blank control.
[0032] Figure 3The results show the sensitivity analysis of the preferred primer-probe combination Dublin F1 / Dublin R1 / Dublin P1 against Cronobacter Dublin using the ERA method. Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 ng / μL, CK represents the blank control, and each sample is repeated in two replicates.
[0033] Figure 4 shows the results of primer and probe screening for *Cronobacter univar*. 1-9 represent nine *Cronobacter* species, with the following strain names and numbers: 1. *Cronobacter sakazakii* (10403.17), 2. *Cronobacter mogins* (10403.20), 3. *Cronobacter malondiamide* (15201), 4. *Cronobacter dublinii* (15203), 5. *Cronobacter univar* (30419), 6. *Cronobacter zurichii* (15202), 7. *Cronobacter montillata* (LMG26250), 8. *Cronobacter berberine* subsp. *milk powder* (CICC 24181), 9. *Cronobacter dublinii* subsp. *lausanne* (LMG 23824). CK represents the blank control.
[0034] Figure 5 These are the results of the specific detection of common pathogenic bacteria (non-Cronobacter spp.) in food using the above-mentioned preferred primer-probe combination, UniF6 / UniR6-2 / UnirecN-P. Specifically, 1 represents UniValskronobacter, and 2-16 represent: 2. *Pseudomonas fluorescens* ATCC13525, 3. *Escherichia coli* O157:H7 ATCC43895, 4. *Salmonella typhimurium* ATCC14028, and 5. *Vibrio parahaemolyticus* ATCC. 33847, 6. Staphylococcus aureus ATCC27664, 7. Listeria monocytogenes ATCC13932, 8. Cronobacter dublinum ATCC29544, 9. Shigella flexneri CMCC51571, 10. Yersinia enterocolitica ATCC27729, 11. Bacillus cereus ATCC10876, 12. Beta-hemolytic streptococcus CMCC32210, 13. Burkholderia gladioli cocovenenans CICC 25108, 14. Escherichia coli CMCC44104, 15. Pseudomonas aeruginosa ATCC25619, 16. Serratia marcescens ATCC8100, CK represents blank control.
[0035] Figure 6 The results show the sensitivity analysis of the above-mentioned preferred primer-probe combination, UniF6 / UniR6-2 / UnirecN-P, to ERA assays for *Univos spp.*. Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 ng / μL, CK represents the blank control, and each sample is repeated in two replicates.
[0036] Figure 7 shows the combination of the above-mentioned preferred primer-probe sequence combinations Dublin F1, Dublin R1, and FMA-modified Dublin P1 and Dublin P1-Cy5 with Uni F6, Uni R6-2, and FMA-modified Uni recN-P and recN-P-ROX fluorescence, respectively. Figure 7A The FAM(a) assay targets *Cronobacter dublinii*, and the ROX(d) assay targets *Cronobacter univoskensis*. Figure 7B The Cy5(b) fluorescence channel was used to detect *Cronobacter dublinae*, and the FAM(c) channel was used to detect *Cronobacter univoskella*. Figure 7C The Cy5(b) fluorescence channel was used to detect Cronobacter dublin, the ROX(d) channel was used to detect Cronobacter univos, and CK represented the blank control.
[0037] Figure 8 The results show the sensitivity analysis of the dual ERA method against *Cronobacter dublinum* and *Cronobacter von Willebrandi* using the preferred dual primer-probe combinations Dublin F1 / Dublin R1 / Dublin P1-Cy5 and Unilever F6 / Unilever R6-2 / Unilever recN-P. Template concentrations were 100, 10, 1, and 10⁻⁶. -1 10 -2 10 -3 ng / μL, CK represents the blank control, and each sample is repeated in two replicates. Detailed Implementation
[0038] The present invention will be further described by way of examples, but the present invention is not limited to the following examples. Example 1: ERA primer and probe screening and fluorescence detection performance analysis for the detection of Cronobacter dublinis.
[0039] The primer and probe design (Table 1) was analyzed for amplification efficiency, specificity, and sensitivity, and the primer and probe combination for rapid detection of Cronobacter dublin using the ERA method was finally determined.
[0040] 1) DNA extraction from Kronobacter dublin: using PrepMan TM The Ultra Sample Preparation Reagent kit was used to extract DNA from Cronobacter dublin and diluted with sterile water to a concentration of 10 ng / μL for testing.
[0041] 2) Detection System: Prepare the premix for each sample according to the instructions of the Fluorescent Amplification Reagent Kit (ERA method): 20 μL solvent, 2.1 μL forward primer, 2.1 μL reverse primer, 0.6 μL probe, 1 μL template, and 22.2 μL ddH2O. Transfer the premix to a PCR tube containing the fluorescent amplification reagent, vortex to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cap the tube, centrifuge briefly to allow the activator to enter the premix, vortex briefly to mix, centrifuge again quickly, and place in a mini qPCR instrument.
[0042] 3) Reaction program: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; in the second reaction stage, select FAM for the fluorescence channel and set the threshold to the default. Use sterile water as a blank control.
[0043] 4) Result Interpretation: A blank control showing no amplification curve is considered valid; otherwise, the result is considered invalid. A clear amplification curve indicates a positive result. No fluorescence curve indicates a negative result.
[0044] Figure 1 shows a comparison of the amplification efficiency of four combinations of candidate primers and probes detected by ERA fluorescence assay in *Cronobacter dublinis*. Figure 1A The results showed that the designed primers and probes Dublin F1 / Dublin R 修 / Dublin P1 amplified Cronobacter dublinum and its two subspecies, Cronobacter dublinum subsp. dublin and Cronobacter dublinum subsp. Lausanne, with good amplification effect; Figure 1B and Figure 1D The results showed that the self-designed primers and probes Dublin F1 / Dublin R 修 / crono-P2 and Dublin F1 / Dublin R1 / crono-P2 amplified Cronobacter dublinis and its two subspecies, but were not specific to Cronobacter contimonte. Figure 1C The results showed that the designed primer-probe combination Dublin F1 / Dublin R1 / Dublin P1 amplified both *Cronobacter dublinii* and its two subspecies, with the best amplification effect. The self-designed primer-probe combination Dublin F1 / Dublin R1 / Dublin P1 had the best amplification efficiency.
[0045] like Figure 2 As shown, specificity and coverage analysis of the primer-probe combination Dublin F1 / Dublin R1 / Dublin P1 revealed that only *Cronobacter dublinensis* showed amplification, while DNA from other *Cronobacter* species and the ddH2O blank control showed no amplification. This fully demonstrates that the specific oligonucleotide primers screened in this experiment exhibit excellent specificity for the detection of *Cronobacter dublinensis*.
[0046] like Figure 3As shown, further sensitivity analysis was performed on the screened primer-probe combination Dublin F1 / Dublin R1 / Dublin P1. The results showed that this oligonucleotide primer combination had the highest sensitivity, and could detect a minimum concentration of 10-1 of Kronobacter dublinis. -1 ng / μL. Example 2: ERA primer and probe screening and fluorescence detection performance analysis for the detection of Univococcus yunnanense.
[0047] By analyzing the amplification efficiency, specificity, and sensitivity of the designed primers and probes (Table 1), the primer and probe combination for rapid detection of Univococcus yunnanense using the ERA method was finally determined.
[0048] 1) Extraction of DNA from *Univols serovar Noroc*: Same as in Example 1 above.
[0049] 2) Detection system: Same as in Example 1 above.
[0050] 3) Reaction procedure: Same as Example 1 above.
[0051] 4) Result determination: Same as Example 1 above.
[0052] Figure 4 shows a comparison of the amplification efficiency of candidate primers and probes detected by ERA fluorescence assay for three combinations of *U. univos serovar Norodomibacterium*. Figure 4A The results showed that the designed primers and probes UniF6 / UniR6-2 / UnirecN-P had high amplification efficiency. Figure 4B The results showed that UniF6 / UniR6-5 / Uni recN-P had poor amplification efficiency, and UniF6 / UniR6-6 / Uni recN-P showed no amplification. Figure 4C The designed UniF6 / UniR6-2 / UnirecN-P primer-probe combination exhibits high amplification efficiency.
[0053] like Figure 5 As shown, the specificity and coverage of the screened primer-probe combination UniF6 / UniR6-2 / UnirecN-P were analyzed. The results showed that only *Univos skronoa* was amplified, while DNA from other *Cronobacter* species and the ddH2O blank control were not amplified. This fully demonstrates that the specific oligonucleotide primers screened in this experiment showed excellent specificity for the detection of *Univos skronoa*.
[0054] like Figure 6 As shown, further sensitivity analysis was performed on the screened primer-probe combination UniF6 / UniR6-2 / UnirecN-P. The results showed that this oligonucleotide primer combination had the highest sensitivity, and could detect a minimum concentration of 10-1 of Univos serovar Norodomibacterium. -1 ng / μL. Example 3: Performance analysis of preferred dual ERA fluorescence detection method using ERA primers and probes for *Cronobacter dublinii* and *Cronobacter univar*.
[0055] The performance of the selected ERA primers and probes for Kronobacter dublin and Kronobacter univarskola was further analyzed by dual ERA fluorescence detection, and the primer and probe combination for rapid detection of Kronobacter dublin and Kronobacter univarskola was finally determined.
[0056] 1) DNA extraction from Kronobacter dublin and Kronobacter univosk: Same as in Example 1 above.
[0057] 2) Detection System: Prepare the premix for each sample according to the instructions of the Fluorescent Amplification Reagent Kit (ERA method): 20 μL of solvent, 1 μL each of forward and reverse primers, 0.4 μL each of probes, 1 μL each of templates, and 1.2 μL of ddH2O2. Transfer the premix to a PCR tube containing the fluorescent amplification reagent, vortex to mix, and centrifuge briefly. Add 2 μL of activator to the tube cap, carefully cap the tube, centrifuge briefly to allow the activator to enter the premix, vortex briefly to mix, centrifuge again quickly, and place in a mini qPCR instrument.
[0058] 3) Reaction program: 37 ℃ for 1 s; 37 ℃ for 14 s, 60 cycles; during the second reaction stage, FAM / ROX / Cy5 fluorescence signals were collected separately, with the threshold set to the default value. Sterile water was used as a blank control.
[0059] 4) Result Interpretation: A blank control showing no amplification curve is considered valid; otherwise, the result is considered invalid. A clear amplification curve indicates a positive result. No fluorescence curve indicates a negative result.
[0060] As shown in Figure 7, the preferred primer-probe sequence combination described above, consisting of FAM (a) and Cy5 (b) of Dublin F1 / Dublin R1 / Dublin P1, was combined with FAM (c) and ROX (d) fluorescence of Uni F6 / Uni R6-2 / Uni recN-P, respectively. Figure 7A In the study, FAM(a) detected *Cronobacter dublinii*, and ROX(d) detected *Cronobacter univoskensis*, and neither showed amplification. Figure 7B The Cy5(b) fluorescence channel was used to detect Cronobacter dublin, and the FAM(c) channel was used to detect Cronobacter univosk. Both showed good amplification effects. Figure 7C The Cy5(b) fluorescence channel detected *Cronobacter dublinii*, while the ROX(d) channel detected *Cronobacter univos*. Only the univos ROX channel showed amplification. The combination of Dublin Cy5 and univos FAM showed higher amplification efficiency. Figure 7B ).
[0061] like Figure 8 As shown, the sensitivity of the preferred dual primer-probe combinations Dublin F1 / Dublin R1 / Dublin P1 (Cy5) and Uni F6 / Uni R6-2 / Uni recN-P (FAM) against *Cronobacter dublinus* and *Cronobacter von Willeckernsis* using the dual ERA method was further analyzed. Figures 1-6 represent *Cronobacter dublinus* template DNA concentrations of 100, 10, 1, and 10⁻⁶, respectively. -1 10 -2 ng / μL; af indicates that the concentration of *Rhodotorula univar* template DNA is 100, 10, 1, 10, respectively. -1 10 -2 ng / μL. The results showed that this oligonucleotide primer combination could simultaneously detect *Cronobacter dublinii* and *Cronobacter univar* at a minimum concentration of 1 ng / μL. ng / μL. Example 4: Limit of detection for rapid detection of *Cronobacter dublinum* and *Cronobacter univar* in artificially contaminated samples.
[0062] 1) Sample pretreatment: Take 25 mL of sterile water and prepare artificially contaminated samples of Cronobacter dublin and Cronobacter univar from milk powder according to the method described in SN / T 1632.3—2013 "Test Method for Cronobacter dublinis (Cronobacter spp.) in Exported Milk Powder". Take 25 mL of homogenized solution from 7 groups and add 10 mL of homogenized solution to each sample. 8 CFU / mL of Kronobacter dublin and Kronobacter univovsk were serially diluted to 10. 7 ~10 0 Artificially contaminated samples with CFU / mL were enriched at 37°C for 0, 2, 4, 6, and 8 h.
[0063] 2) The DNA extraction, fluorescence detection system, reaction procedure, and result interpretation steps are the same as in Example 3. Sterile ddH2O was used as a blank control during the experiment.
[0064] The results of the artificially contaminated samples are shown in Table 2. The results show that the established dual ERA fluorescence method for *Cronobacter dublinii* and *Cronobacter univar* can achieve a detection limit of 1 CFU / mL 8 h before enrichment, and the method has high sensitivity.
[0065] Table 2 Detection results of artificially contaminated samples
Claims
1. A composition for detecting *Cronobacter dublinii* by singlet ERA fluorescence assay, characterized in that, The composition comprises the *Cronobacter dublin*-specific oligonucleotide primer pairs 5′-AGCTCCTTTACTTACACCGAAAAAGATC-3′ and 5′-ATCGCTGGTATCAGCTTTGTCGCCGTCA-3′, and the probe 5′-CGAAGACGGCATCTACAACAAAGGCCAGTACTACGGCATCACCGCAGG-3′; wherein the 3′ end of the probe sequence is blocked with a c3-spacer, the T base at position 29 is modified with a FAM fluorescent group, the C base at position 31 is replaced with THF, and the T base at position 32 is modified with a BHQ1 quencher group.
2. A composition for detecting *Univols schoenleinii* by single-layer ERA fluorescence assay, characterized in that, The composition comprises specific oligonucleotide primer pairs for *U. univoskroniobacillus*, 5′-ACTGGAGCAGCGCATCTCCCGTCAAATT-3′ and 5′-TGCATACTGTCGGTAATCAGCTGTGTCA-3′, and a probe 5′-GCTGGACGACCAGGCTGATTGTCTGGAAACGTTGACTCTGGCGGTCAA-3′; wherein the 3′ end of the probe sequence is blocked with a c3-spacer, the T at position 33 is modified with a FAM fluorescent group, the G at position 34 is replaced with THF, and the T at position 35 is modified with a BHQ1 quencher group.
3. A composition for detecting Kronobacter dublinis by dual ERA fluorescence assay, characterized in that, The composition comprises the specific oligonucleotide primer pair of claim 1 and a probe; wherein the 3′ end of the probe sequence is blocked with a c3-spacer, the T base at position 29 is modified with a Cy5 fluorescent group, the C base at position 31 is replaced with THF, and the T base at position 32 is modified with a BHQ1 quencher group.
4. A composition for the simultaneous detection of *Cronobacter dublinii* and *Cronobacter univar* by a dual ERA fluorescence method, characterized in that, The composition also includes the specific oligonucleotide primer pair of claim 1, the composition of claim 2, and the probe of claim 3.
5. A method and kit for detecting Kronobacter dublinis by single ERA fluorescence assay, said method comprising using the composition of claim 1.
6. A method and kit for detecting Univocorticella univar by single ERA fluorescence assay, said method comprising using the composition of claim 2.
7. A method and kit for the simultaneous detection of *Cronobacter dublinii* and *Cronobacter univos* by dual ERA fluorescence assay, said method and kit comprising using the composition of claim 4.
8. The composition of claims 1, 2 and 4, the method and kit of claims 5, 6 and 7, for use in the rapid detection of Kronobacter dublinii and Univoskronobacter.