A special primer combination and method for detecting intestinal flora 16s rRNA based on ngs and multiplex amplification

By designing primer combinations covering the entire V1-V7 region and employing multiplex amplification technology, the problems of insufficient species coverage and limited resolution in 16S rRNA gene sequencing technology were solved, enabling efficient and accurate detection of gut microbiota.

CN122104958APending Publication Date: 2026-05-29NANKAI UNIV +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANKAI UNIV
Filing Date
2026-03-25
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing 16S rRNA gene sequencing technology suffers from insufficient species coverage and limited species resolution, resulting in the omission of some species and the inability to achieve species-level differentiation.

Method used

We designed a dedicated primer combination covering the entire V1-V7 region of the 16S rRNA gene. Combining multiplex amplification and NGS technology, we achieved efficient amplification through the synergistic effect of 16S Primer Mix 1 and 16S Primer Mix 2. We optimized primer design to avoid interference and ensure uniform amplification of each region.

Benefits of technology

It improves species coverage and resolution, enabling efficient and accurate detection of gut microbiota, and can more accurately distinguish closely related species, meeting the needs of clinical and scientific research for the detection of low abundance microbiota.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104958A_ABST
    Figure CN122104958A_ABST
Patent Text Reader

Abstract

The application discloses a special primer combination and method for detecting intestinal flora 16S rRNA based on NGS and multiplex amplification, and relates to the fields of flora detection and NGS. The primer combination comprises 16S Primer Mix 1 and 16S Primer Mix 2, and covers V1-V7 variable regions of 16S rRNA genes, and the primer sequences are SEQ ID NO. 1-13. The detection method comprises the steps of extracting nucleic acids from a fecal sample, amplifying a 16S multiple target region, merging and purifying amplification products, amplifying a tag primer, purifying a library and performing high-throughput sequencing. Through multi-section joint amplification, the application solves the problems of insufficient species coverage and low resolution in traditional 16S detection, realizes accurate annotation at the species level, and each section is uniformly amplified, the detection limit reaches 167 CFU / mL, and the application is suitable for accurate detection of intestinal flora, and provides technical support for disease diagnosis and treatment and health management.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of gut microbiota detection and NGS (next-generation sequencing), specifically to a primer combination and method for detecting 16S rRNA of gut microbiota based on NGS and multiplex amplification. Background Technology

[0002] As the most complex and crucial microbial community in the human body, the gut microbiota's composition and function require precise analysis for understanding disease mechanisms, achieving precision diagnosis and treatment, and managing health. In this exploration, metagenomic sequencing (mNGS) and 16S rRNA gene sequencing technologies have become the core twin engines driving gut microbiota research, jointly constructing a panoramic perspective from microbial surveys to functional analysis. Among them, 16S rRNA gene sequencing technology, due to its lower data requirements and stronger microbiota detection capabilities, is gradually becoming the main technology for gut microbiota detection.

[0003] The core principle of traditional 16S rRNA gene sequencing technology is that all bacteria and archaea carry the 16S rRNA gene, and the specific variable region sequence of this gene is species-specific. Based on this characteristic, by designing universal primers to amplify the target variable region (commonly such as V3-V4 or V4 region), performing high-throughput sequencing on the amplified products, and aligning the sequences to a reference database, the relative abundance analysis of species in the gut microbiota structure can be completed. However, current mainstream 16S microbiota detection technologies still have two key issues that urgently need optimization: 1. Insufficient species coverage: Due to the limitations of NGS sequencing platforms on insert read length, most existing 16S detection technologies only select regions with relatively high coverage, such as V3-V4, for amplification. However, the 16S rRNA gene contains nine variable regions, V1-V9. Studies have confirmed that different variable regions have significantly different amplification preferences for different species. Relying solely on the V3-V4 region for amplification will lead to the omission of some species, failing to fully reflect the true composition of the gut microbiota.

[0004] 2. Limited Species Resolution: Metagenomic sequencing technology can achieve species-level resolution, while existing 16S technology based on V3-V4 region sequencing can only annotate most species at the genus level. This is because the accuracy of species annotation depends on the specific sequence information provided by amplified variable regions. The interspecific differences of some species exist only in variable regions outside V3-V4, and effective species-level differentiation cannot be achieved solely through sequences from the V3-V4 region.

[0005] Recent studies have provided important support for solving the above problems: The study in Nature Methods (2020) confirmed that by using multiplex amplification to cover the entire V1-V7 region and performing joint analysis, the species annotation accuracy can be significantly improved from the genus level to the species level (such as successfully distinguishing Escherichia coli from Shigella), with a species level coverage of 97.3%, while the species level coverage of single V4 region sequencing is only 82%; The "Peregrine" primer pool developed by Nucleic Acids Research (2021) achieved balanced amplification of 7 variable regions through degenerate base optimization design, with an amplification deviation CV of <15%, providing key methodological support for the primer design of this invention.

[0006] Based on the shortcomings of existing technologies and related research foundations, this invention designs a special primer combination covering the key variable regions of the 16S rRNA gene V1~V7, and combines multiplex amplification and NGS technology to construct a gut microbiota detection method with both high species coverage and high resolution, effectively solving the core pain points of traditional technologies. Summary of the Invention

[0007] This invention provides a primer set for detecting 16S rRNA of gut microbiota based on NGS and multiplex amplification, including two primer mixtures, 16S Primer Mix 1 and 16S Primer Mix 2. The two primers are designed for different variable regions of the 16S rRNA gene, and work together to achieve efficient amplification of the entire V1 to V7 region.

[0008] 1. Primers and sequences (5'-3') contained in 16S Primer Mix 1 V1-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGAGTTTGATCMTGGC (SEQ ID NO.1) V3-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG (SEQ ID NO.2) V1-R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTACTCACCCGTCCGCCACT (SEQ IDNO.3) V3-R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACCGCGGCKGCTGGC (SEQ ID NO.4) V4-F: ACACTCTTTCCCTACACGACCGCTTCCGATCTACTGGGYGTAAAGCG (SEQ ID NO.5) V4-1F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTGGGYGTAAAGGG (SEQ ID NO.6) V4-R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGACTACHVGGGTATCTAAT (SEQ IDNO.7) 2. Primers and sequences (5'-3') contained in 16S Primer Mix 2 V5-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGMTTAGATACCCBDGTA (SEQ ID NO.8) V5-R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGTCAATTCCTTTRAGTTT (SEQ IDNO.9) V2-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTGGCGGACGGGTGAGTAA (SEQ IDNO.10) V6V7-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCGAAGAACCTTACC (SEQ IDNO.11) V2-R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGCTGCCTYCCGTA (SEQ ID NO.12) V6V7-R: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGTCATCCMCACCTTCCTC (SEQ IDNO.13) The design basis for the above primer combination is as follows: Based on the species coverage ratio analysis of each variable region in the SILVA database, the V1~V7 variable regions with high species coverage were selected for primer design. In light of the PE150 sequencing mode's limitation of ≥30bp double-ended overlap region for amplicon length, primer binding sites were optimized to ensure that the amplified product length matches the sequencing requirements. By analyzing the base composition, Tm value, and binding position of each primer using multiple primer design principles, we can avoid primer dimer formation or mutual interference and ensure uniform amplification performance of each segment.

[0009] This invention also provides a method for detecting 16S rRNA of gut microbiota based on the above primer combination, specifically including the following steps: Step 1: Nucleic acid extraction from fecal samples Nucleic acid was extracted from fecal samples using a commercially available fecal sample nucleic acid extraction kit. The commercially available kit could be the Microbial DNA Extraction Kit (SL-M00122) from Shenzhen Sailu Medical Technology Co., Ltd., or other commercially available fecal DNA extraction kits with equivalent functions. The key requirement is that it can efficiently extract total microbial DNA from fecal samples, and that the purity of the extracted product meets the requirements for subsequent PCR amplification.

[0010] Step 2: 16S Multiplex Target Amplification The DNA extracted in step 1 was amplified in the first round using 16S Primer Mix 1 and 16S Primer Mix 2, respectively, in two parallel reaction systems: System 1 (16S Primer Mix 1 amplification): 12.5 μL PCR reaction solution, 5 μL 16S Primer Mix 1, X μL sample DNA solution containing 10 ng sample DNA, and the total volume is adjusted to 25 μL according to the sample DNA solution volume; System 2 (16S Primer Mix 2 amplification): 12.5 μL PCR reaction solution 1, 5 μL 16S Primer Mix 2, X μL sample DNA solution containing 10 ng sample DNA, and bring the total volume to 25 μL.

[0011] Among them, PCR reaction solution and PCR reaction solution 1 are special PCR buffers suitable for multiplex amplification, containing dNTPs, high-fidelity DNA polymerase and auxiliary factors required for amplification, which can be adapted to multiple primers for simultaneous amplification and reduce non-specific amplification.

[0012] The first round of amplification procedures are set as follows: First, pre-denaturate at 99℃ for 2 minutes, repeating this step once; then proceed to 28 cycles, each cycle including denaturation at 99℃ for 15 seconds and annealing at 58℃ for 2 minutes; after the cycle, extend at 72℃ for 10 minutes, and finally hold at 4℃, repeating this step once.

[0013] Step 3: Merging and purifying amplification products The amplification products from the two parallel reaction systems in step 2 were directly combined to obtain 50 μL of mixed amplification product. 0.9X volume (45 μL) of purification magnetic beads were added to the mixed product, and the procedure was followed according to the standard nucleic acid purification process using magnetic beads to remove unbound primers, dNTPs, and non-specific amplification products, resulting in purified multiplex amplification products. The purification magnetic beads used are specialized magnetic beads for nucleic acid purification using the magnetic bead method, requiring a binding efficiency of ≥95% between the magnetic beads and nucleic acids to ensure effective recovery of the amplification products.

[0014] Step 4: Tag Primer Amplification A second-round amplification system was prepared to add a specific index tag to each sample for sample differentiation in subsequent sequencing data. The components of the second-round amplification system are as follows: The second-round reaction system includes PCR reaction solution 2, adapter primers, and purified products. The volume of PCR reaction solution 2 is 12.5 μL, the volume of adapter primers is 2.5 μL, and the volume of purified products is 10 μL.

[0015] Among them, the adapter primers are universal adapter primers with sample-specific index tags, and their sequences include a universal sequence adapted to the sequencing platform and a sample-unique index sequence; PCR reaction solution 2 is a PCR buffer adapted to the tag primer amplification. Compared with the buffer used in the first round of amplification, the enzyme concentration and buffer composition have been optimized to meet the needs of short fragment amplification.

[0016] The second round of amplification procedures are set as follows: First, pre-denaturate at 98°C for 45 seconds, repeating this step once; then proceed to 7 cycles, each cycle consisting of denaturation at 98°C for 15 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds; after the cycle, extend at 72°C for 1 minute, and finally hold at 4°C, repeating this step once.

[0017] Step 5: Library purification Add 0.9X volume (22.5 μL) of purification magnetic beads to the amplification product (25 μL) from step 4, and perform the magnetic bead purification procedure to remove residual primers and primer dimers. After purification, use a Qubit 4.0 nucleic acid quantification instrument to determine the library concentration to ensure that the library concentration meets the sequencing requirements (usually ≥50 ng / μL).

[0018] Step 6: High-throughput sequencing The purified sample library from step 5 was sequenced using the Caillou PRL-PE150-25M kit and a Caillou Nimbo sequencer with PE150 double index sequencing. After sequencing, bioinformatics analysis was performed on the data, including sequence quality control, primer sequence removal, OTU clustering, species annotation, and abundance analysis, ultimately yielding the species composition and relative abundance results of the gut microbiota.

[0019] Beneficial effects:

[0020] The primer combination and detection method of the present invention have the following significant advantages over the prior art: 1. High amplification efficiency and excellent detection limit performance: Compared with traditional single-primer amplification using V4 or V3~V4, this invention uses multiplex amplicon sequencing to control the amplification length of each target region within the range suitable for PE150 sequencing, reducing amplification difficulty and improving amplification efficiency. Experimental verification shows that the detection limit for Clostridium difficile can reach 167 CFU / mL, meeting the needs of clinical and research for the detection of low-abundance bacterial communities.

[0021] 2. Good uniformity of amplification across all regions: By optimizing primer design and amplification system, common problems in multiplex amplification, such as inter-primer interference and region amplification bias, were solved. Experimental results show that the amplification product proportions of each variable region from V1 to V7 are balanced, with no single region exhibiting excessively high or low amplification efficiency, thus avoiding species detection bias caused by amplification bias.

[0022] 3. Broad species coverage and high resolution: The primer combination is designed based on species coverage analysis of the SILVA database, covering key variable regions V1 to V7. Compared with traditional V4 region amplification, the species coverage is significantly improved. Multi-segment joint analysis provides richer species-specific sequence information, which improves the species annotation accuracy from the traditional genus level to the species level, and can more accurately distinguish closely related species. Attached Figure Description

[0023] Figure 1 is a comparison of species coverage in different segments of the Silva database, showing that the species coverage of multiple segments V1-V7 combined is significantly higher than that of a single V3-V4 or V4 region. Figure 2 shows the peak diagram of the 16S multi-segment detection library, which shows that there are six obvious main peaks in the library, corresponding to the fragment lengths of the amplified products of each target region. Figure 3 is a statistical chart of the amplification uniformity of each segment of the sample, showing that the proportion of amplification products in each variable region from V1 to V7 is balanced, with no obvious amplification bias. Figure 4 is a comparison of the number of species detected by the 16Sv1v7 and 16Sv4 processes, showing that the overall number of species detected by the method of the present invention is higher than that of the traditional V4 region detection. Figure 5 is a comparison of species-level annotation rates of the detected species in the 16Sv1v7 and 16Sv4 processes, showing that the species-level annotation rate of the method of the present invention is significantly higher than that of the traditional V4 region detection. Detailed Implementation

[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Experimental Objective To verify the feasibility of the primer combination and detection method of the present invention, and to observe the amplification uniformity and library quality of each segment.

[0026] Experimental materials 1. Samples: 14 fecal samples from healthy college students (collected using Kangwei Century sampling tubes; commercially available fecal sampling tubes can be substituted), and 1 ZymoBiomics® D6331 standard as a positive control; 2. Reagents: Microbial DNA Extraction Kit (SL-M00122) from Shenzhen Sailu Medical Technology Co., Ltd., PCR reaction solution, PCR reaction solution 1, PCR reaction solution 2, adapter primers, purification magnetic beads, and 16S Primer Mix 1 and 16S Primer Mix 2 as described in this invention; 3. Instruments: Qubit4.0 nucleic acid quantification instrument, PCR instrument, QSEP-100 fully automated nucleic acid and protein analysis system, and Sailu Nimbo sequencer.

[0027] Experimental steps 1. Nucleic acid extraction from fecal samples: Total DNA was extracted from 14 fecal samples and a positive control according to the instructions of the SL-M00122 kit, with 3 technical replicates for each sample; 2. Nucleic acid concentration determination: The nucleic acid concentration of the extracted product was determined using Qubit4.0; 3. First round of amplification: Prepare the reaction solution according to the system in Tables 1 and 2, and perform PCR amplification according to the procedure in Table 3;

[0028]

[0029]

[0030] 4. Merging and purification of amplification products: Merge the 16S Primer Mix 1 and 16S Primer Mix 2 amplification products of each sample and purify them by adding 0.9X purification magnetic beads; 5. Second round of amplification: Prepare the reaction solution according to the system in Table 4, and perform tag primer amplification according to the procedure in Table 5;

[0031]

[0032] 6. Library purification and quality control: The second-round amplification products were purified using 0.9X purification beads, and one sample was selected for peak detection using QSEP-100. 7. High-throughput sequencing: PE150 double-index sequencing was performed using the CELOL PRL-PE150-25M kit and the CELOL Nimbo sequencer to analyze species detection and amplification performance of each segment.

[0033] Experimental results 1. Sample extraction and library construction information: The nucleic acid extraction concentration of the 14 samples and positive controls was between 26 and 45 ng / uL, and the library output concentration was between 112 and 128 ng / uL, all of which met the sequencing requirements (Table 6).

[0034] 2. Library peak plot detection: The library peak plot of the selected sample showed six obvious main peaks, located at 257bp, 274bp, 296bp, 317bp, 348bp and 386bp respectively, which are consistent with the designed fragment lengths of each target region (Figure 2). 3. Uniformity of segment amplification: Statistical analysis of the data after the test showed that the amplification products of each variable region from V1 to V7 were balanced, and there was no obvious case of excessively high or low amplification efficiency of a single segment, indicating that the multiplex amplification performance was good (Figure 3).

[0035] Example 2: Experimental Objective The detection method of the present invention was verified to detect low abundance of intestinal flora, and the detection limit of the method was determined.

[0036] Experimental materials 1. Sample: ZymoBiomics® D6331 standard (with known bacterial concentration and component proportion), with Clostridium difficile (a typical harmful intestinal bacterium) selected as the LOD validation target; 2. Reagents: Same as in Example 1; 3. Instruments: Same as in Example 1.

[0037] Experimental steps 1. Sample serial dilution: Based on the percentage (1.1%) and total concentration (3.94 × 10^9 cells / mL) of Clostridium difficile in the D6331 standard, the initial concentration of Clostridium difficile was calculated to be 4.33 × 10^7 cells / mL. Serial dilutions were performed using physiological saline according to the method in Table 7, with three Levels of Difference (LOD) points: 1.67 × 10^4 cells / mL, 1.67 × 10^3 cells / mL, and 1.67 × 10^2 cells / mL. Five technical replicates were set up for each LOD point.

[0038] 2. Nucleic acid extraction and sequencing: Nucleic acid extraction, two rounds of amplification, library purification, and high-throughput sequencing were performed according to the steps in Example 1; 3. Results analysis: The detection status and relative abundance of Clostridium difficile at each LOD point were statistically analyzed.

[0039] Experimental results 1. Sample extraction and library construction information: The library extraction concentration of samples from each LOD site was between 95 and 125 ng / uL, which met the sequencing requirements; the nucleic acid extraction concentration of some low-concentration LOD sites was too low (TOO LOW), but it did not affect subsequent amplification and sequencing (Table 8).

[0040] 2. Detection limit results: Based on the detection data in Table 9, the relative abundance of Clostridium difficile at the LOD point of 1.67×10² cells / mL (corresponding to 167 CFU / mL) in the five technical replicates was 0.01%~0.03%, all of which were higher than the detection threshold of 0.005%. Therefore, the detection limit was determined to be 167 CFU / mL, and the performance met the market application requirements (Table 9).

[0041] Table 9. Detection results of Clostridium difficile at various LOD points

[0042] Example 3: Experimental Objective The advantages of this invention are verified by comparing the number of species detected and the species-level annotation rate of the method of this invention with the traditional V4 region 16S detection method.

[0043] Experimental materials 1. Samples: 20 retrospective stool samples (results obtained by conventional V4 region 16S detection); 2. Reagents: Same as in Example 1; 3. Instruments: Same as in Example 1.

[0044] Experimental steps 1. Sample processing and detection: Twenty retrospective samples underwent nucleic acid extraction, two rounds of amplification, library purification, and high-throughput sequencing according to the procedure in Example 1; 2. Data Comparison and Analysis: The number of species detected by the method of this invention is counted and compared with the results of traditional V4 region detection; the species-level annotation rate of the method of this invention (the proportion of species that can be annotated at the species level to the total number of detected species) is calculated and compared with the species-level annotation rate of traditional V4 region detection.

[0045] Experimental results 1. Sample extraction and library construction information: The nucleic acid extraction concentration of the 20 samples ranged from 0.7 to 13.9 ng / uL, and the library output concentration ranged from 54.1 to 125.6 ng / uL, all of which met the sequencing requirements (Table 10).

[0046] 2. Comparison of species detection count: Among the 20 samples, 19 samples had a higher number of species detected by the method of this invention than the traditional V4 segment detection method, and only 1 sample had a slightly lower number of species detected than the traditional method (as shown in Figure 4). 3. Comparison of species-level annotation rates: The species-level annotation rate of the method of this invention is significantly higher than that of traditional V4 region sequencing, enabling more accurate fine classification of species (as shown in Figure 5). The primer combinations and detection methods of this invention can be directly applied to the development of gut microbiota detection kits, suitable for multiple scenarios such as clinical diagnosis, health management, and scientific research. Through the industrial-scale production of these kits, efficient and accurate detection of gut microbiota can be achieved, providing key technical support for disease mechanism research, precision treatment formulation, and health risk assessment, demonstrating significant industrial application value and market prospects.

[0047] The scope of protection of this invention is not limited to the specific embodiments described above. All equivalent substitutions or modifications made based on the technical solutions and inventive concepts of this invention should be included within the scope of protection of this invention.

Claims

1. A primer combination specifically for detecting 16S rRNA of gut microbiota based on NGS and multiplex amplification, characterized in that, It includes two primer mixtures: 16S Primer Mix 1 and 16S Primer Mix 2; 16S Primer Mix 1 contains the following primers: V1-F: The sequence is as shown in SEQ ID NO.1, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGAGTTTGATCMTGGC; V3-F: The sequence is as shown in SEQ ID NO.2, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTACGGGNGGCWGCAG; V1-R: The sequence is as shown in SEQ ID NO.3, 5'-3' is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTACTCACCCGTCCGCCACT; V3-R: The sequence is as shown in SEQ ID NO.4, 5'-3' is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACCGCGGCKGCTGGC; V4-F: The sequence is as shown in SEQ ID NO.5, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTGGGYGTAAAGCG; V4-1F: The sequence is as shown in SEQ ID NO.6, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTGGGYGTAAAGGG; V4-R: The sequence is as shown in SEQ ID NO.7, 5'-3' is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGACTACHVGGGTATCTAAT; The 16S Primer Mix 2 contains the following primers: V5-F: The sequence is as shown in SEQ ID NO.8, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGMTTAGATACCCBDGTA; V5-R: The sequence is as shown in SEQ ID NO.9, 5'-3' is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGTCAATTCCTTTRAGTTT; V2-F: The sequence is as shown in SEQ ID NO.10, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTGGCGGACGGGTGAGTAA; V6V7-F: The sequence is as shown in SEQ ID NO.11, 5'-3' is ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCGAAGAACCTTACC; V2-R: The sequence is as shown in SEQ ID NO.12, 5'-3' is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGCTGCCTYCCGTA; V6V7-R: The sequence is as shown in SEQ ID NO.13, with 5'-3' being GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGTCATCCMCACCTTCCTC.

2. A method for detecting 16S rRNA of gut microbiota based on NGS and multiplex amplification, characterized in that, Includes the following steps: Step 1, Nucleic acid extraction from fecal samples: Nucleic acid was extracted from fecal samples using a commercially available fecal sample nucleic acid extraction kit; Step 2, 16S Multiplex Target Amplification: The sample DNA extracted in Step 1 was amplified in the first round using 16S Primer Mix 1 and 16S Primer Mix 2 as described in claim 1. The first round of amplification included two parallel reaction systems: System 1 consisted of 12.5 μL of PCR reaction solution, 5 μL of 16S Primer Mix 1, and X μL of sample DNA solution containing 10 ng of sample DNA; System 2 consisted of 12.5 μL of PCR reaction solution 1, 5 μL of 16S Primer Mix 2, and X μL of sample DNA solution containing 10 ng of sample DNA. The amplification program was as follows: 99℃ pre-denaturation for 2 min, followed by 28 cycles of 99℃ denaturation for 15 sec, 58℃ annealing for 2 min, and finally 72℃ extension for 10 min, followed by incubation at 4℃. Step 3, Combining and Purifying Amplification Products: The amplification products from the two parallel reaction systems in Step 2 are directly combined, and the combined amplification products are purified using 0.9X volume of purification magnetic beads. Step 4, Tag Primer Amplification: Prepare the second-round amplification system, which contains 12.5 μL PCR reaction solution 2, 2.5 μL adapter primers and 10 μL of the purified product from step 3; the amplification program is as follows: 98℃ pre-denaturation for 45 seconds, followed by 7 cycles of 98℃ denaturation for 15 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, and finally 72℃ extension for 1 min, followed by incubation at 4℃. Step 5, Library purification: The amplification product from step 4 was purified using 0.9X volume purification magnetic beads, and nucleic acid quantification was performed using Qubit 4.0; Step 6, High-throughput sequencing: Using the CELUN PRL-PE150-25M kit and the CELUN Nimbo sequencer, the purified samples from Step 5 were subjected to PE150 dual-index sequencing to complete the detection of 16S rRNA in the gut microbiota.

3. The detection method according to claim 2, characterized in that, The commercial fecal sample nucleic acid extraction kit mentioned in step 1 is the Microbial DNA Extraction Kit SL-M00122 or other commercially available fecal DNA extraction kits with equivalent functions.

4. The detection method according to claim 2, characterized in that, The PCR reaction solution and PCR reaction solution 1 mentioned in step 2 are PCR buffers suitable for multiplex amplification, containing dNTPs, DNA polymerase and auxiliary factors required for amplification.

5. The detection method according to claim 2, characterized in that, The adapter primers mentioned in step 4 are universal adapter primers with sample-specific index tags, used to distinguish sequencing data from different samples.

6. The detection method according to claim 2, characterized in that, The purified magnetic beads mentioned in steps 3 and 5 are special magnetic beads for nucleic acid purification using the magnetic bead method, and the binding efficiency between the magnetic beads and nucleic acids is ≥95%.

7. The use of the primer combination of claim 1 in the preparation of intestinal flora 16SrRNA detection reagents or kits.

8. The application according to claim 7, characterized in that, The kit also includes one or more of the following: PCR reaction solution, PCR reaction solution 1, PCR reaction solution 2, adapter primers, and purification magnetic beads.