Molecular marker on chromosome 3 associated with plant height of alfalfa regrowth after cutting and application thereof
By developing the InDel molecular marker Ms_Chr3_11664425 on chromosome 3 of alfalfa, and combining it with PCR amplification and electrophoresis detection, the problem of difficulty in identifying the height of regenerated alfalfa plants after harvesting was solved, achieving efficient and economical breeding screening and identification.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LANZHOU UNIV
- Filing Date
- 2026-03-23
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are insufficient for effectively screening and identifying highly relevant traits in alfalfa regenerated plant height after mowing, which affects its yield and overwintering ability.
The InDel molecular marker Ms_Chr3_11664425 located on chromosome 3 of alfalfa was developed, and the corresponding primer pairs Ms_Chr3_11664425-F and Ms_Chr3_11664425-R were designed. The height of regenerated alfalfa plants was identified by PCR amplification and electrophoresis.
This method enables rapid and accurate identification of the height of regenerated alfalfa plants after mowing, improving the efficiency of marker-assisted selection breeding, saving costs, and simplifying the material screening process.
Smart Images
Figure CN122104984A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker located on chromosome 3 that is highly correlated with the height of alfalfa regenerated plants after mowing and its application. Background Technology
[0002] alfalfa ( Medicago sativa Alfalfa (L.) is an important legume forage crop, and its yield and quality are crucial to the high-quality development of animal husbandry. Due to its high yield and strong environmental adaptability, alfalfa is widely cultivated in my country. The number of mowing cycles not only affects the yield and quality of alfalfa but also significantly impacts its overwintering ability. Excessive mowing reduces its regeneration capacity, preventing it from overwintering properly; conversely, insufficient mowing leads to a decline in both yield and quality.
[0003] Genome-wide association study (GWAS), also known as association mapping or linkage disequilibrium mapping (LD), is a highly efficient method for determining the relationship between a target trait and genetic markers or candidate genes by analyzing the associations between high-density molecular markers (usually SNPs) and a target trait in a natural population. GWAS offers advantages such as high resolution, broad coverage, and the ability to reveal the genetic basis of complex traits more comprehensively. Through GWAS analysis, genetic loci associated with target traits can be efficiently located, candidate genes associated with target traits can be screened, and the molecular regulatory networks of trait formation can be deeply revealed. Therefore, developing molecular markers associated with the high regeneration capacity of alfalfa plants is of great significance for breeding high-yielding, regenerating alfalfa. Summary of the Invention
[0004] One of the objectives of this invention is to provide an InDel molecular marker that is correlated with the height of regenerated alfalfa plants after mowing.
[0005] A second objective of this invention is to provide the application of the InDel molecular markers mentioned above that are related to the height of regenerated alfalfa plants after mowing.
[0006] To achieve the above objectives, the present invention adopts the following technical solution: The InDel molecular marker disclosed in this invention, which is associated with the height of regenerated alfalfa plants after mowing, is located on chromosome 3 of alfalfa. The molecular marker is named Ms_Chr3_11664425, and its nucleotide sequence is shown in SEQ ID NO.4 or SEQ ID NO.5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 3 of the alfalfa reference genome.
[0007] Primer pairs were used to amplify the InDel molecular marker, which is highly associated with alfalfa regenerated plants. The primer pair sequence corresponding to the molecular marker Ms_Chr3_11664425 is as follows: Ms_Chr3_11664425-F: CTCAAGACTTTCGCTTCGTG (shown in SEQ ID NO.1); Ms_Chr3_11664425-R: GATTTAACAGACCCTTTTTGGC (shown as SEQ ID NO.2).
[0008] This invention also discloses the application of the aforementioned molecular marker primer pairs in height-assisted breeding of alfalfa regenerated plants after mowing. In other words, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage and detecting the presence of the molecular markers of this invention, the height-related traits of alfalfa regenerated plants after mowing can be identified, thereby determining the height of the regenerated plants. The detection can be performed using PCR, specifically using the aforementioned molecular marker primer pairs, or it can be performed using sequencing methods.
[0009] This invention also discloses the application of the aforementioned molecular markers in marker-assisted breeding of alfalfa, particularly in the screening and identification of the height of regenerated alfalfa plants after mowing. Specifically, the specific steps for identifying the height of regenerated alfalfa plants after mowing are as follows: (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Ms_Chr3_11664425. The PCR amplification reaction system is shown in Table 1: Table 1. Reaction system for PCR amplification
[0010] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 24 s, extension at 72℃ for 24 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.
[0011] (2) Detection of PCR products by agarose gel electrophoresis: Take 4 μL and judge the height of the regenerated plant after cutting alfalfa based on the band results.
[0012] PCR amplification was performed using primers Ms_Chr3_11664425-F and Ms_Chr3_11664425-R. If the PCR amplification product contained only one characteristic band of 250 bp as shown in SEQ ID NO.4, then the alfalfa was a dwarf type after mowing (a type with a high regenerated plant height). If there was both a characteristic band of 250 bp as shown in SEQ ID NO.4 and a characteristic band of 212 bp as shown in SEQ ID NO.5, then the alfalfa was a tall type after mowing (a type with a low regenerated plant height).
[0013] Furthermore, this invention also protects a kit for identifying the height trait of alfalfa regenerated plants after mowing, the kit containing primer pairs Ms_Chr3_11664425-F and Ms_Chr3_11664425-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.
[0014] The kit of this invention can rapidly identify the height of alfalfa plants after mowing and can also rapidly identify the plant height genotype of alfalfa. The specific method follows the steps for identifying whether alfalfa exhibits a tall or short stalk trait. By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product contains only one characteristic band of 250 bp as shown in SEQ ID NO. 4, then the alfalfa is homozygous for a short stalk genotype after mowing; if the PCR amplification product contains both one characteristic band of 250 bp as shown in SEQ ID NO. 4 and one characteristic band of 212 bp as shown in SEQ ID NO. 5, then the alfalfa is heterozygous for a tall stalk genotype after mowing.
[0015] The present invention has the following advantages: (1) The inventors of this invention screened out a molecular marker Ms_Chr3_11664425 that is associated with the height of alfalfa regenerated plants after cutting. This molecular marker is located on chromosome 8. Using the molecular marker Ms_Chr3_11664425 of this invention, the height of alfalfa regenerated plants after cutting can be quickly and accurately identified.
[0016] (2) Using markers that are highly linked to the regenerated plants after cutting for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.
[0017] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity. They can be easily, quickly and with high throughput applied to the high-altitude breeding practice and material identification of alfalfa regenerated plants. Attached Figure Description
[0018] Figure 1 The genome-wide association analysis results for the height of alfalfa regenerated plants after mowing are obtained from a Manhattan plot based on EMMAX software. The red dots indicate the InDel positions associated in this invention.
[0019] Figure 2 This is a box plot showing the plant height distribution of the Ms_Chr3_11664425 locus in the alfalfa population of Example 1 of this invention. 0 / 0 indicates a homozygous dwarf genotype at the Ms_Chr3_11664425 locus, and 0 / 1 indicates a heterozygous tall genotype at the Ms_Chr3_11664425 locus. Dots represent extreme values, and **** represents... P <0.0001.
[0020] Figure 3 This is a partial sequence alignment result of the regenerated plant height-related region between dwarf and tall materials.
[0021] Figure 4 Electrophoresis images of amplified molecular markers at the Chr3_11664425 site in 16 alfalfa germplasm resources. The concentration of agarose gel was 2%.
[0022] In the diagram, M represents a DNA marker. Detailed Implementation
[0023] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.
[0024] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.
[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0026] Example 1: Development of molecular markers associated with height of regenerated plants four weeks after alfalfa harvesting This invention measures the height of regenerated alfalfa plants four weeks after initial flowering. A higher value indicates taller alfalfa, while a lower value indicates shorter alfalfa. The height of regenerated plants was measured four weeks after cutting, and GWAS analysis located an InDel locus in the alfalfa. Figure 1 The red locus, named Ms_Chr3_11664425, is located at locus 11664425 on chromosome 3 of the alfalfa reference genome (downloadable from https: / / figshare.com / articles / dataset / Medicago_sativa_genome_and_annotation_files / 12623960; the downloaded file "ZhongmuNo.1_genome.fasta.gz" is the alfalfa genome sequence). The first allele is 0 / 0, and the second allele is 0 / 1. A box plot showing the plant height distribution corresponding to the genotypes at locus Ms_Chr3_11664425 in the population is shown. Figure 2 This indicates that the height of alfalfa lines with genotype 0 / 0 regenerated four weeks after mowing was significantly different from that of alfalfa lines with genotype 0 / 1. An insertion / deletion fragment ATTTTATTTATATTTCAAAAGTTTTTAAATATATTTTT (shown in SEQ ID NO. 3) was found at locus 11664425 on alfalfa chromosome 3. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the regeneration height of alfalfa four weeks after mowing. Alfalfa with the fragment shown in SEQ ID NO.3 is a dwarf alfalfa that regenerates four weeks after mowing; alfalfa without the fragment shown in SEQ ID NO.3 is a tall alfalfa that regenerates four weeks after mowing.
[0027] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using NCBI (https: / / www.ncbi.nlm.nih.gov / ): Ms_Chr3_11664425-F: CTCAAGACTTTCGCTTCGTG (shown in SEQ ID NO.1); Ms_Chr3_11664425-R: GATTTAACAGACCCTTTTTGGC (shown as SEQ ID NO.2).
[0028] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous dwarf alfalfa sample regenerated four weeks after mowing had only a 250bp characteristic band, while the PCR product of the heterozygous tall alfalfa sample regenerated four weeks after mowing had both a 250bp characteristic band and a 212bp characteristic band.
[0029] Example 2: Accuracy verification of the molecular markers described in this invention 128 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2: Table 2. Genotypes of 128 materials based on the Ms_Chr3_11664425 locus and height of regenerated plants four weeks after mowing.
[0030]
[0031] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product; The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2 × Taq PCR Master Mix, and deionized water to a final volume of 20 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 55℃ annealing for 24 s, 72℃ extension for 20 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃. Separation is performed by electrophoresis on a 3.5% agarose gel. After loading, the samples are electrophoresed at 120V DC for 60 min, and the PCR banding patterns of each sample are then read.
[0032] 2) Determine the plant height of alfalfa based on the size of the PCR product: When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is a dwarf alfalfa. When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, the alfalfa to be identified is a tall alfalfa regenerated after cutting. Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 250bp (SEQ ID NO.4), then the alfalfa to be identified is a dwarf alfalfa regenerated after cutting.
[0033] SEQ ID The sequence of NO.4 is as follows: CTCAAGACTTTCGCTTCGTGAGCCGCTACCGCTTGTGGTACTTGTGGTGTGTTGTAAATTTTATTTATATTTCAAAAGTTTTTAAATATATTTTTTTCCCTCATTTTTAGTTGAAAATAT TTTGGTAGAAATATTTCTATTATTATTATTGAGTATTTTGATTAGTAGAAAGTATTACTATTATTCCTGTTACATAATATTCCTTGTCGGTTCTAAATCCTAGGCTTGCCAAAAAGGGTCTGTTAAATC.
[0034] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 212bp (SEQ ID NO.5), then the alfalfa to be identified is a tall-stemmed alfalfa regenerated after cutting.
[0035] The sequence of SEQ ID NO. 5 is as follows: CTCAAGACTTTCGCTTCGTGAGCCGCTACCGCTTGTGGTACTTGTGGTGTGTTGTAATTCCCTCATTTTTAGTTGAAAATATTTTGGTAGAAATATTTCTATTATTATTGAGTATTTTGATTAGTAGAAAGTATTACTATTATTCCTGTTACATAATATTCCTTGTCGGTTCTAAATCCTAGGCTTGCCAAAAAGGGTCTGTTAAATC.
[0036] If the PCR product of the alfalfa to be identified consists of two bands, one with the inserted fragment shown in SEQ ID NO.3 and the other with the deleted fragment shown in SEQ ID NO.3, and one band is 250 bp in length and the other is 212 bp, then the alfalfa to be identified is a heterozygous tall alfalfa.
[0037] Furthermore, Table 2 shows that among the 128 alfalfa germplasm accessions identified in this study, 78 accessions had a genotype of 0 / 0 at the Chr3_11664425 locus, and their average plant height was 45.60 cm, classifying them as dwarf alfalfa. The remaining 50 accessions had a genotype of 0 / 1 at the Chr3_11664425 locus, and their average plant height was 63.53 cm, classifying them as tall alfalfa. Analysis of variance showed that the difference in plant height between tall and dwarf alfalfa was highly significant. P <0.0001). Sixteen germplasm accessions were selected ('CF040401', 'CF040694', 'CF049817', 'CF049818', 'CF040656', 'Zhongmu No. 4', 'Chaoyang Alfalfa', 'Longmu 809', 'CF039888', 'CUF101', 'Liangmu', 'Mufeng', 'Nanmu 601', 'Common', 'Zhongmu No. 6', 'HunterField').
[0038] PCR testing was performed, and the results were consistent with the genotype at the Chr3_11664425 locus and the actual plant height measurement results. Figure 4 Therefore, the InDel molecular marker of the present invention can effectively identify the plant height of alfalfa and can be used for the prediction and screening of tall alfalfa materials after mowing.
[0039] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. A molecular marker associated with the height of regenerated plants after alfalfa cutting, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 and SEQ ID NO.
5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 3 of the alfalfa reference genome. The primer pair sequence for amplifying the molecular marker is as follows: Ms_Chr3_11664425-F: CTCAAGACTTTCGCTTCGTG; Ms_Chr3_11664425-R: GATTTAACAGACCCTTTTTGGC.
2. The application of the molecular marker described in claim 1 in identifying or assisting in the identification of the height of alfalfa regenerated plants after cutting.
3. A method for identifying the height of alfalfa regenerated plants after harvesting, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) The determination shall be made based on the electrophoresis bands and / or sequencing results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr3_11664425-F and Ms_Chr3_11664425-R. If the PCR amplification product contained only one characteristic band of 250 bp as shown in SEQ ID NO.4, then the alfalfa was a dwarf type regenerated after mowing. If there was both a characteristic band of 250 bp as shown in SEQ ID NO.4 and a characteristic band of 212 bp as shown in SEQ ID NO.5, then the alfalfa was a tall type regenerated after mowing.
4. The application of a reagent kit in identifying the genotype of tall plants regenerated from alfalfa after cutting, characterized in that... The kit contains primer pairs corresponding to the molecular markers described in claim 1. The method for identifying the high-height genotype of alfalfa regenerated plants after mowing using the kit is as follows: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products; (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification products have only one characteristic band of 250 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous dwarf genotype after mowing; if the PCR amplification products have both one characteristic band of 250 bp as shown in SEQ ID NO.4 and one characteristic band of 212 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous tall genotype after mowing.