Use of a product for promoting expression of gpx3 in preparation of a medicine for inhibiting early ferroptosis of transplanted pancreatic islets

By promoting GPX3 gene overexpression, using GPX3 overexpression vectors or islet cell lines overexpressing GPX3, early ferroptosis in transplanted islets was inhibited, solving the problem of massive islet cell loss and improving islet survival and function.

CN122124249APending Publication Date: 2026-06-02THE FIRST AFFILIATED HOSPITAL OF MEDICAL COLLEGE OF XIAN JIAOTONG UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE FIRST AFFILIATED HOSPITAL OF MEDICAL COLLEGE OF XIAN JIAOTONG UNIV
Filing Date
2026-04-27
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Early ferroptosis in transplanted islets leads to a large loss of islet cells, affecting the efficacy of transplantation. Current technologies have failed to effectively inhibit non-cysteine-dependent cell death pathways, especially ferroptosis.

Method used

By promoting GPX3 gene overexpression, using GPX3 overexpression vectors or islet cell lines overexpressing GPX3, early ferroptosis in transplanted islets can be inhibited, thereby improving islet survival.

Benefits of technology

It improved the survival rate of transplanted islets, maintained the activity of transplanted islet cells, and improved the islet transplantation effect in diabetic patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122124249A_ABST
    Figure CN122124249A_ABST
Patent Text Reader

Abstract

This invention relates to the field of islet transplantation technology, specifically disclosing methods for promoting... GPX3 The application of the expressed product in the preparation of drugs that inhibit early ferroptosis in transplanted pancreatic islets. The present invention provides a promoting... GPX3 The expressed product is used to inhibit early ferroptosis in transplanted islets, improve the survival rate of transplanted islets, and maintain the activity of transplanted islet cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of islet transplantation technology, specifically to promoting... GPX3 The application of the expressed product in the preparation of drugs that inhibit early ferroptosis in transplanted pancreatic islets. Background Technology

[0002] With the implementation of the Edmonton protocol and the rapid development of clinical islet transplantation, research from the International Islet Transplant Registry has confirmed that islet transplantation is one of the most effective treatments for type 1 diabetes mellitus complicated by severe hypoglycemia, and can correct hemoglobin HA1C, improving overall glycemic control in diabetic patients. However, the current survival rate of transplanted islets is low, requiring most recipients to have multiple organ donors and a cumulative islet implant mass ≥ 10,000 islet equivalents (IEQ) per kilogram of recipient body weight to achieve insulin-independent therapeutic effects for a period of time. Analysis of the reasons for the low long-term survival rate of transplanted islets indicates that a large number of islets are lost during islet separation and transplantation. Specifically, this manifests in the complex enzymatic process of mechanically separating islet cells from their extracellular matrix in the early stage of transplantation, the purification and culture steps after separation, and the process of transplanting islet cells to the hypoxic intrahepatic portal vein site. It is estimated that up to 70% of transplanted islets are lost in the acute and transplantation phases. Therefore, acute islet cell death in the early stage of islet transplantation causes severe damage to graft function and is one of the main factors affecting the long-term efficacy of islet transplantation. Acute islet cell death is an unavoidable factor in islet transplantation. As the gap between donor and recipient demand widens, the proportion of organs from marginal donors with poor hypoxia tolerance is significantly increasing, leading to a marked decline in insulin independence rate and duration after islet transplantation. Many patients require multiple infusions of islet cells from different donors to achieve insulin independence. Therefore, mitigating early transplant islet loss, improving tolerance to oxidative stress and ischemia-hypoxia after islet transplantation, and increasing transplant islet survival rate and prolonging survival time are pressing issues in the field of islet transplantation.

[0003] To address this issue, numerous studies have reported that strategies to inhibit caspase-dependent cell death can improve the survival and long-term function of transplanted islets, including the administration of interleukin-1β receptor agonists, vitamin A, and caspase-specific inhibitors. Therefore, apoptosis has been identified as a key factor in programmed cell death in experimental and clinical studies of islet transplantation. However, recent identification and expansion of cell death patterns in other disease states suggest that islet cells may also be susceptible to non-caspase-dependent regulatory cell death, although reports on the impact of non-caspase-dependent regulatory cell death on the efficacy of transplanted islets are relatively rare.

[0004] Ferroptosis is one of the main non-caspastoside-dependent modes of pancreatic islet cell death. First proposed in 2012 by Dr. Brent R. Stockwell of Columbia University, ferroptosis is a unique non-apoptotic form of iron-dependent regulated necrosis, distinct from apoptosis morphologically, biochemically, and genetically. Its main characteristics are increased oxidative stress and lipid peroxidation dependence. Ferroptosis primarily induces cell death by promoting the high expression of unsaturated fatty acids on the cell membrane through ferrous iron or ester oxygenases, leading to lipid peroxidation. It also decreases the activity of glutathione peroxidase 4 (GPX4), a core enzyme in the antioxidant system (glutathione system). Lipid oxides cannot catalyze the glutathione reductase reaction via GPX4, subsequently leading to the oxidation of lipids by ferrous ions, producing reactive oxygen species (ROS), thus promoting ferroptosis. During islet cell isolation and transplantation, large amounts of ROS are generated, causing ferroptosis in islet cells and impairing their viability and function. Therefore, ferroptosis is one of the main causes of significant islet loss during islet cell isolation, culture, and transplantation, ultimately affecting the efficacy of transplantation. Thus, identifying more targets for islet ferroptosis and inhibiting ferroptosis in transplanted islets is of great significance for post-transplant islet survival. Summary of the Invention

[0005] To suppress early ferroptosis in transplanted islets, this invention provides a method to promote... GPX3 The application of the expressed product in the preparation of drugs that inhibit early ferroptosis in transplanted islets. This invention inhibits early ferroptosis in transplanted islets by promoting GPX3 overexpression, thereby improving the survival rate of transplanted islets and maintaining the activity of post-transplanted islet cells.

[0006] This invention provides a way to promote GPX3 The application of the expressed product in the preparation of drugs that inhibit early ferroptosis in transplanted pancreatic islets.

[0007] This invention promotes the function of pancreatic islet cells GPX3 Overexpression of the gene inhibited early ferroptosis in transplanted islets, thereby improving post-transplant survival and maintaining the activity of islet cells. This improved the early survival rate of islet transplantation in diabetic patients.

[0008] Furthermore, the promotion GPX3 The product being expressed is GPX3 Overexpression vector or overexpression GPX3 The pancreatic islet cell line.

[0009] Furthermore, the aforementioned GPX3 Overexpression vectors are used to express... GPX3The gene was obtained by inserting it into the pcDNA3.1-EGFP vector.

[0010] Furthermore, the aforementioned GPX3 Overexpression vector from GPX3 The gene and the linearized pcDNA3.1-EGFP vector were obtained through homologous recombination.

[0011] Furthermore, the overexpression GPX3 The pancreatic islet cell line is made from GPX3 Obtained by transfecting pancreatic islet cells with an overexpression vector.

[0012] Furthermore, the drug is resuspended in cold Hanks balanced salt solution for overexpression. GPX3 The pancreatic islet cell line was obtained.

[0013] Furthermore, the recipient of the transplanted pancreatic islets is a mammal or human suffering from diabetes.

[0014] Furthermore, the drug is used to inhibit ferroptosis in transplanted pancreatic islets and improve the survival rate of transplanted islet cells.

[0015] This invention also provides a product that inhibits early ferroptosis in transplanted islets, wherein the product inhibiting early ferroptosis in transplanted islets is the aforementioned product. GPX3 Overexpression vector or overexpression GPX3 The pancreatic islet cell line.

[0016] Furthermore, the aforementioned GPX3 Overexpression vector from GPX3 The gene and the linearized pcDNA3.1-EGFP vector were obtained through homologous recombination.

[0017] The present invention also provides an shRNA targeting GPX3, wherein the shRNA is selected from any one of SEQ ID NO.1 to SEQ ID NO.3.

[0018] The present invention also provides a lentivirus containing the shRNA or an INS-1 cell line with GPX3 knocked down.

[0019] This invention also provides the application of GPX3-targeting shRNA, lentivirus, or GPX3-knockout INS-1 cell lines in the preparation of drugs that promote pancreatic islet cell ferroptosis.

[0020] Furthermore, the lentivirus is obtained by inserting shRNA into the target lentiviral vector GV493.

[0021] The present invention also provides the application of the aforementioned GPX3-targeting shRNA, lentivirus, or GPX3-knockout INS-1 cell line in the construction of an animal model of islet transplantation iron death.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: In this invention, by promoting GPX3 It reduces the sensitivity of islet cells to ferroptosis, thereby inhibiting ferroptosis in transplanted islets; it also regulates the glutathione metabolism level in islet cells, thereby improving transplanted islet function and increasing the survival rate of transplanted islet cells. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 Image of the lentiviral vector GV493 for target use.

[0025] Figure 2 To knock down pancreatic islet cells GPX3 back, GPX3 Expression at the RNA and protein levels; In the diagram, A represents knockdown. GPX3 Post-islet cells GPX3 mRNA expression levels; among them, INS-1, shNC, shGPX3-1, shGPX3-2, and shGPX3-3 represent pancreatic β cell lines, INS-1 cells transfected with empty transfection plasmid lentivirus, and cells transfected with interference, respectively. GPX3 INS-1 cells expressing sequence 1 lentivirus, transfected with interference GPX3 INS-1 cells expressing sequence 2 lentivirus, transfected with interference GPX3 INS-1 cells expressing sequence 3 lentivirus; B represents knockdown. GPX3 Expression levels of GPX3 protein in pancreatic islet cells; where INS-1, shNC, shGPX3-1, shGPX3-2, and shGPX3-3 represent pancreatic β-cell lines, INS-1 cells transfected with empty transfection plasmid lentivirus, and cells transfected with interference, respectively. GPX3 INS-1 cells expressing sequence 1 lentivirus, transfected with interference GPX3 INS-1 cells expressing sequence 2 lentivirus, transfected with interference GPX3 INS-1 cells expressing sequence 3 lentivirus.

[0026] Figure 3 To knock down GPX3 The effect on the sensitivity of pancreatic islet cells to ferroptosis; Figure 2 In the diagram, A represents knockdown. GPX3 Expression of LDH, SOD, GHS, and MDA in post-pancreatic islet cells; shNC represents transfection interference. GPX3 INS-1 cells expressing sequence 1 lentivirus, and shGPX3 as a transfection interference. GPX3 INS-1 cells expressing a lentivirus sequence; B represents Fe in pancreatic islet cells after GPX3 knockdown. 2+ The expression status; where shNC represents transfection interference. GPX3 INS-1 cells expressing sequence 1 lentivirus, and shGPX3 as a transfection interference. GPX3 INS-1 cells expressing a lentivirus sequence; C represents mitochondrial damage in pancreatic islet cells after GPX3 knockdown; shNC represents transfection interference. GPX3 INS-1 cells expressing sequence 1 lentivirus, and shGPX3 as a transfection interference. GPX3 INS-1 cells expressing lentivirus sequences.

[0027] Figure 4 To knock down pancreatic islet cells GPX3 Subsequently, the expression of the ferrodegeneration marker GPX4 was investigated.

[0028] Figure 5 For knockdown or overexpression GPX3 Iron death of transplanted pancreatic islet cells 7 days after subcapsular renal transplantation in diabetic rats.

[0029] Figure 6 The sequencing results are for the pcDNA3.1-EGFP-GPX3 overexpression vector.

[0030] Figure 7 This is a vector map of the pcDNA3.1-EGFP plasmid.

[0031] Figure 8 For overexpression GPX3 LDH, SOD, GHS, MDA, and Fe in post-pancreatic islet cells 2+ The expression situation; In the diagram, A represents overexpression. GPX3 LDH expression in post-pancreatic islet cells; B represents overexpression. GPX3 SOD expression in post-pancreatic islet cells; C represents overexpression. GPX3 GHS expression in post-pancreatic islet cells; D indicates overexpression. GPX3 MDA expression in post-pancreatic islet cells; E represents overexpression. GPX3Fe in post-pancreatic islet cells 2+ The expression situation; F represents overexpression of INS-1. GPX3 Subsequently, the expression of the ferrodegeneration marker GPX4 was investigated. Among them, oeNC represents INS-1 cells transfected with the empty vector sequence plasmid, and oeGPX3 represents cells transfected with overexpressing the empty vector sequence plasmid. GPX3 INS-1 cells expressing sequence plasmids. Detailed Implementation

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0033] Example 1: GPX3 The impact of early ferroptosis in transplanted pancreatic islets.

[0034] I. In vitro experiments 1. Isolation and purification of pancreatic islet cells from Lewis inbred rats 1.1. Isolation of pancreatic islet cells: After successfully anesthetizing donor rats using a small animal anesthesia machine, the skin was disinfected with 75% alcohol. An abdominal midline incision was then made to expose the common bile duct. The bile duct's entry into the duodenum and the confluence of intrahepatic bile ducts into the common bile duct were ligated. 1 mg / mL collagenase P was injected into the common bile duct via a scalp needle until the pancreatic tissue was completely filled and turned pink. The perfusion was then stopped. The pancreatic tissue was carefully separated using ophthalmic forceps and placed in an Erlenmeyer flask containing 5 mL of Hank's solution in an ice bath.

[0035] The conical flask was then placed in a 38°C water bath for 12 min to digest the tissue until it became slightly viscous and no longer stuck to forceps. Residual adipose tissue was removed. The tissue was transferred to a 250 mL conical flask and dispersed by shaking. Fetal bovine serum (FBS) was added to terminate the digestion, and then pre-chilled Hank's solution was added for dilution. The mixture was filtered through a 20-mesh filter, and the filtrate was centrifuged at 1000 rpm for 2 min at 4°C. The supernatant was discarded, and the precipitate was washed twice with pre-chilled Hank's solution. The precipitate was resuspended in 5 mL of lymphocyte separation medium with a density of 1.084, and 5 mL of room-temperature Hank's solution was carefully added. The mixture was centrifuged at 2250 rpm for 20 min at 20°C. Islet cells located in the middle layer were aspirated, pre-chilled Hank's solution was added, and the mixture was centrifuged at 1000 rpm for 2 min at 4°C. The supernatant was discarded. This process was repeated three times to obtain highly purified islet cells.

[0036] 1.2. Purity identification of pancreatic islet cells: 10 mg of dithizone (DTZ) powder was dissolved in 10 mL of dimethyl sulfoxide (DMSO), diluted with Hank's solution, and filtered to obtain a staining solution. This staining solution was added to isolated pancreatic islet cells and incubated at room temperature for 10 min. The red islet cell clusters were observed under a microscope to assess purity.

[0037] 1.3. Islet Cell Viability Identification (AO / PI Staining Method): Acridine orange / propidium iodide (AO / PI) staining is the main method for detecting islet cell viability and apoptosis. Detailed experimental procedures are as follows: 1) Prepare staining buffer: Mix sterile double-distilled water with reagent C at a ratio of 9:1 to ensure accurate staining solution preparation and set aside; reagent C is 10x cell buffer (Hanks solution). 2) Under a microscope, pancreatic islet cells from different experimental groups were selected to ensure that the number of pancreatic islet cells in each group was 200 IEQ (islet equivalents) to ensure the consistency of the experiment; 3) Transfer pancreatic islet cells into 15mL centrifuge tubes, wash with pre-cooled PBS, centrifuge at 4 ℃, 1200 rpm for 2 min, repeat twice, and discard the supernatant; 4) Add 500 μL of the above staining buffer to resuspend the cells and prepare a pancreatic islet cell suspension; 5) Add 5 μL of acridine orange (AO) staining solution and 10 μL of propidium iodide (PI) staining solution to each tube in sequence, and mix gently. 6) The mixed cell suspension was incubated at 4 ℃ in the dark for 20 min to ensure the best staining effect; 7) After incubation, centrifuge at 4℃, 1200 rpm for 2 min, discard the supernatant, retain the precipitate, and wash twice with PBS; 8) Observe the staining of pancreatic islet cells using a fluorescence microscope and take representative images; 9) Perform quantitative analysis on representative images using Image J.

[0038] 2. Constructing an in vitro ferroptosis model using Erastin Pancreatic islet cells were treated with 50 μM Erastin to create an environment inducing ferroptosis. Cell viability was assessed using the following methods: LDH assay to detect lactate dehydrogenase (LDH) levels in the cell supernatant; CCK-8 assay to detect cell viability; and Western blot, RT-qPCR, and ELISA to detect the expression levels of ferroptosis-related proteins, confirming that Erastin induces ferroptosis in pancreatic islet cells.

[0039] 3. Construct knockdown GPX3 INS-1 cell line 3.1 Targeting GPX3 shRNA design and lentiviral vector construction Target vector: GV493 lentiviral vector (GV493 pattern as shown) Figure 1 (As shown).

[0040] shRNA target design: targeting rats GPX3 Three shRNA sequences were designed from the CDS region (152 bp ~ 832 bp) of the gene (NM_022525.4) (see Table 1 for details): shGPX3-1: 5'-GCTTCCCTTGCAACCAATTTG-3'; shGPX3-2: 5'-GGGAGAAAGAGCAGAAGTTCT-3'; shGPX3-3: 5'-GGGCCAGATGGCATACCAATT-3'.

[0041] Table 1 GPX3 RNAi target information of genes Oligonucleotide synthesis: Complementary sense and antisense oligonucleotides (with Age I / EcoRI restriction sites and loop sequences) were synthesized for each target sequence, as shown in Table 2.

[0042] Table 2 Targets GPX3 Sensitive and antisense strands of RNAi target sequences 3.2 Constructing Knockout GPX3 Lentiviral knockdown GPX3Virus construction: (1) Vector digestion: According to Table 3, the GV493 vector plasmid was digested with Age I and EcoRI and reacted at 37℃ for 3 hours. The linearized vector fragment was recovered by agarose gel electrophoresis.

[0043] Table 3 Enzyme digestion system (2) Anneal the synthesized oligonucleotides to form double-stranded DNA.

[0044] (3) Use T4 DNA ligase to ligate the annealed double-stranded DNA with the linearized vector and react at 16°C for 2 hours: After synthesis, the paired target gene primer powder is dissolved in annealing buffer, water bath at 90°C for 15 min, and naturally cooled to room temperature. The double-digested linearized vector and annealed double-stranded DNA are ligated by T4 DNA ligase and ligated at 16°C for 2 hours.

[0045] Transformation and sequencing validation: 10 μL of the ligation product was added to 100 μL of competent cells, gently tapped against the tube wall several times to mix, and incubated on ice for 30 min. The mixture was then heat-shocked at 42℃ for 90 s and incubated in an ice-water bath for 2 min. 500 μL of LB medium was added, and the mixture was incubated at 37℃ with shaking for 1 h. An appropriate amount of the bacterial culture was evenly spread onto a plate containing the corresponding antibiotic and incubated upside down in a constant temperature incubator for 15 h. The identified positive clones were inoculated into an appropriate amount of LB liquid medium containing the corresponding antibiotic and incubated at 37℃ for 15 h. An appropriate amount of the bacterial culture was then sequenced. The sequencing results were compared and analyzed with the target gene sequence.

[0046] Lentiviral Packaging: Transfect the correctly sequenced bacterial culture into 50 mL of LB broth containing the appropriate antibiotics and incubate overnight at 37°C. Extract plasmids using the AmMag Quatro Plasmid Purification Kit-24 prep (water elution) to obtain qualified plasmids. Add the prepared DNA solutions (20 μg GV493 vector plasmid, 15 μg pHelper 1.0 vector plasmid, and 10 μg pHelper 2.0 vector plasmid) to a sterile centrifuge tube, mix thoroughly with the corresponding volume of Gilead transfection reagent, and adjust the total volume to 1 mL. Incubate at room temperature for 15 min. Slowly add the transfection system dropwise to the culture medium of HEK293T cells, mix well, and incubate at 37°C in a cell culture incubator containing 5% CO2. After 8 hours of culture, discard the culture medium containing the transfection mixture, add 10 mL of PBS buffer to wash once, gently shake the culture dish to wash away any remaining transfection mixture, and then discard. Slowly add 12 mL of cell culture medium containing 2% serum, and incubate at 37°C in a 5% CO2 incubator for 48 hours. Based on the cell state, collect the supernatant of HEK293T cells 48 hours after transfection; centrifuge at 4000 g for 10 min at 4°C to remove cell debris and impurities; filter the supernatant through a 0.45 μm filter into 40 mL ultracentrifuge tubes; balance the samples, and place each ultracentrifuge tube containing the virus supernatant into a Beckman ultracentrifuge, setting the centrifugation parameters to 25000 rpm, centrifugation time to 2 h, and centrifugation temperature to 4°C; after centrifugation, discard the supernatant, remove as much liquid as possible from the tube wall, add the corresponding volume of PBS for the virus, and gently and repeatedly pipette to resuspend the pellet. After thorough dissolution, centrifuge at 10000 rpm for 5 min, then aliquot the supernatant as required. This yielded titers of 2 × 10⁻⁶. 9 TU / mL of shGPX3-1 lentivirus, shGPX3-2 lentivirus, shGPX3-3 lentivirus and negative control lentivirus (shNC).

[0047] 3.3 Establish Knockout GPX3 The INS-1 cell line was constructed using lentiviruses to knock down [the virus]. GPX3 The specific steps for processing pancreatic islet cells are as follows: INS-1 cells were loaded at 5 × 10 4 Seeds were grown at a density of 20% or higher in 24-well plates. Once the cell density reached over 20%, negative control lentivirus (shNC) and knockdown virus were added at an MOI of 100:1. GPX3Lentiviral viruses (shGPX3-1, shGPX3-2, shGPX3-3) were added to the corresponding six-well plates, and 0.5 ml of complete culture medium was used for inoculation. 24 h later, 0.5 ml of complete culture medium was added to each well. 48 h after transfection, the medium was replaced with 1 ml of fresh complete culture medium. After 72 h of transfection, when the cells reached 20% confluency, 5 μg / ml puromycin was added to begin screening for stable transfected cells for subsequent experiments.

[0048] 3.4. Validation of knockdown efficiency (protein and mRNA levels) (1) Protein extraction and Western Blot: Cell samples were collected using a cell scraper and pre-cooled extraction buffer was added: RIPA cell lysis buffer + 1% protease inhibitor + 1% phosphatase inhibitor. The samples were lysed by sonication until clear, centrifuged at 12000 g for 15 min at 4℃, and the supernatant was obtained. 20 μL of the supernatant was used for subsequent protein concentration detection, and the remainder was added to 5× loading buffer. The samples were boiled in a metal bath at 100℃ for 10 min and then stored in a refrigerator at -80℃.

[0049] Western blotting: Preparation of 1.0 mm 12.5% ​​PAGE gel: Take 2.7 mL of equal volumes of the lower gel solution and lower gel buffer in a disposable gel preparation cup, add 60 μL of coagulant, mix well, and pour into a glass plate. Then carefully add an appropriate amount of ddH2O and let stand for 20 min. After the lower gel solidifies, remove as much water as possible. Then take 0.75 mL of equal volumes of the upper gel solution and colored upper gel buffer in a disposable gel preparation cup, add 15 μL of coagulant, mix well, and pour into a glass plate. Insert a 15-tooth comb and let stand for 15-20 min until the upper gel solidifies. Take one packet of electrophoresis buffer powder in an Erlenmeyer flask, add 1 L of ddH2O, and use a magnetic stirrer to completely dissolve it. Install the prepared gel in the electrophoresis tank, and fill the inner tank with electrophoresis buffer. Load the sample according to the protein quantification results, add protein markers, and pour the remaining electrophoresis buffer into the outer tank. Perform electrophoresis at 80 V. Take one packet of transfer buffer powder into an Erlenmeyer flask, add 0.2 mL of methanol and 0.8 mL of ddH2O, and stir with a magnetic stirrer until completely dissolved. Soak the cut PVDF membrane in methanol for 10 min. Use the wet transfer method with a "sandwich" structure for transfer, i.e., from negative to positive electrode: sponge, two layers of filter paper, PAGE gel, PVDF membrane, two layers of filter paper, and sponge. Transfer at 200 mA for 2 h, positive electrode to positive electrode, negative electrode to negative electrode. Block with prepared 5% BSA for 30 min. Cut the membrane according to the molecular weight of the target protein and incubate overnight at 4°C with primary antibody. Take one packet of TBS powder into an Erlenmeyer flask, add 2 L of ddH2O, and stir with a magnetic stirrer until completely dissolved. Add 1 mL of Tween-20 per 1 L of TBS powder and mix well to obtain TBST. Wash the membrane with 50 mL of TBST on a rapid shaker for 5 min, repeating 5 times. The membrane was then incubated with the secondary antibody at room temperature for 1 hour, followed by washing with 50 ml of TBST five times. Imaging was then performed using chemiluminescent buffer.

[0050] (2) RNA extraction and RT-qPCR: Total RNA was extracted using a kit and its purity and concentration were determined.

[0051] After cell collection, 350 μL of Buffer RLS lysis buffer was added, followed by 7 μL of 50× DTT Solution to obtain the sample lysis buffer. Purification: At room temperature, 357 μL of 70% ethanol was added to the lysis buffer, and the mixture was repeatedly pipetted and mixed before being transferred to a Universal RNA Mini Column. The column was centrifuged at 12000 rpm for 1 min, and the filtrate was discarded. 600 μL of RWA buffer was added, and the column was centrifuged for 1 min, and the filtrate was discarded. 650 μL of RWB buffer was added, and the column was centrifuged for 1 min, and the filtrate was discarded. The above steps were repeated, using a new collection tube, centrifuged for 2 min, and the filtrate was discarded. The column was then placed in an RNase-free 1.5 mL EP tube, and 50 μL of RNase-free water was added to the center of the membrane for elution. After standing for 5 min, the column was centrifuged for 2 min to obtain the RNA solution. The purity and concentration of the RNA were then analyzed.

[0052] The reverse transcription system was prepared according to the contents of Table 4 in a 0.2 mL RNase-free EP tube.

[0053] Table 4 Reverse Transcription System The reaction conditions were: 37℃ for 15 min; 85℃ for 5 sec; 4℃.

[0054] cDNA can be obtained after the reaction is complete.

[0055] Real-time quantitative polymerase chain reaction (RT-qPCR): Prepare the reaction solution in the eight-pack according to the contents of Table 4. Table 4 Real-time quantitative PCR system The reaction conditions were: 95℃, 30 sec; [95℃, 5 sec + 60℃, 30 sec] for 40 cycles; 4℃.

[0056] 4. Experimental Grouping Control group (shNC): INS-1-shNC+erastin, INS-1 cells transfected with empty control virus (shNC) and treated with 50 μM Erastin; Experimental group (shGPX3): INS-1-shGPX3+erastin, INS-1 cells transfected with shGPX3-1 virus and treated with 50 μM Erastin.

[0057] 5. Key testing indicators Cell viability assay: Cells and supernatants from each group were collected for CCK8 and LDH assays. Lipid oxidation level detection: The ROS content in cells of each group was detected by ELISA, and the changes in GSH and MDA indicators were detected by kits. Intracellular iron levels: The iron content in live cells was detected using the PGSK probe; Detection of reactive oxygen species (ROS) levels: The levels of ROS in cells of each group were detected using the C11-BODIPY probe. Ferritin-related factor detection: Changes in the RNA and protein levels of ferroptosis-related factors, such as GPX4, in each group of cells were detected by qPCR / Western Blot. Transmission electron microscopy: Direct observation of mitochondrial morphology in cells.

[0058] II. In vivo experiments 1. Establishment of a diabetic rat model Male Lewis rats weighing 100g–150g were selected as recipients of islet transplantation and randomly divided into two groups: the shNC transplantation group and the shGPX3 transplantation group. Initial blood glucose and body weight were recorded for each group, and ear tags were applied. After a 12-hour fast (no water or food allowed), each group of rats was intraperitoneally injected within 30 minutes with a freshly prepared 10 mg / mL streptozotocin (STZ) solution (55 mg / kg) in 0.1 mM sodium citrate buffer (pH 4.5). The rats were then allowed to resume their normal diet. Random blood glucose and body weight were recorded every two days. A successful rat diabetic model was established when blood glucose exceeded 16.7 mmol / L three times consecutively, accompanied by the typical symptoms of "three highs and one low" (hypertension, hyperlipidemia, hyperglycemia, and hypoglycemia).

[0059] 2. Experimental Grouping A total of 12 diabetic rats were constructed and randomly divided into 2 groups of 6 rats each. The experimental groups are as follows: shNC transplantation group: Pancreatic islet cells transfected with empty vector lentivirus GV493 were transplanted under the renal capsule of diabetic rats in 2000IEQ.

[0060] shGPX3 transplantation group: transfection knockdown GPX3 The lentivirus plasmid shGPX3-1 was transplanted into pancreatic islet cells 2000IEQ into the subcapsular renal cells of diabetic rats.

[0061] 3. Constructing a pancreatic islet transplantation model According to the above grouping, 6 rats were in each group. The specific transplantation process of pancreatic islet cells for each group was as follows: The diabetic rats in each group were anesthetized using a small animal anesthesia machine, placed in a prone position, and their limbs were fixed. The fixed rats were prepared, disinfected, draped, and the surgical field was exposed. The cells were prepared and injected into PE 50 tubes and placed on ice for later use. The rats were positioned with their heads facing the surgeon, and a small incision was made in the renal capsule at the upper pole of the kidney with a syringe needle (the action was gentle and should not damage the renal parenchyma). Through the small incision in the renal capsule, the transplanted cells from each group were injected into the renal capsule of the different groups of diabetic rats through the PE 50 tubes. The kidneys with transplanted cells were returned to the abdominal cavity, the muscle layer was closed, the skin was sutured, the wound was disinfected and bandaged. After recovery from anesthesia, the rats were returned to their cages for continued rearing.

[0062] Three days after transplantation, grafts were obtained for histopathological observation: graft tissue specimens from each group were fixed in 10% neutral buffered formaldehyde, embedded in paraffin, and cut into 4 mm thick sections. Immunofluorescence of insulin and ferroptosis-related protein GPX4 was performed to detect the level of ferroptosis in the grafts.

[0063] III. Experimental Results 1. Lentiviral knockdown of pancreatic islet cells GPX3 Detection at RNA and protein levels GPX3 The expression situation This invention uses lentivirus transfection to knock down INS-1 cells. GPX3 Expression was assessed to detect cell transfection efficiency; protein and mRNA levels in INS-1 cells were detected using wett blotting and RT-qPCR. GPX3 The level of expression, such as Figure 2 As shown, compared to shGPX3-2 and shGPX3-3, shGPX3-1 significantly inhibited INS-1 cells. GPX3 The expression level was determined. Therefore, shGPX3-1 was identified as the knockdown sequence for subsequent experiments.

[0064] 2. Knockdown GPX3 This subsequently increases the sensitivity of pancreatic islet cells to ferroptosis. This invention uses lentivirus transfection to knock down INS-1 cells. GPX3 Express, and in knockdown GPX3 Based on this, changes in cellular iron death-related oxidative stress markers were detected. For example... Figure 3 As shown, in the Erastin-induced β-cell ferroptosis model, the shGPX3 group showed decreased cell viability and increased ferrous ion levels compared to the control group shNC cells. Simultaneously, electron microscopy was used to examine mitochondrial morphological changes, and LDH, SOD, GSH, and MDA levels were used to reflect intracellular glutathione metabolism. The results all showed… GPX3Knockdown can increase the sensitivity of pancreatic islet cells to ferroptosis.

[0065] 3. Knockdown GPX3 Post-transplantation islet iron death level To observe the survival of transplanted islet cells, we carefully collected samples 7 days after transplantation, maintaining the integrity of the capsule, and observed the insulin secretion of transplanted islet cells using immunofluorescence staining.

[0066] The results are as follows Figures 4-5 As shown, compared to transplanted shNC islet cells, subcapsular transplantation of shGPX3 islet cells resulted in a significant decrease in insulin-positive areas, accompanied by a decrease in GPX4 expression levels. This result indicates that knockdown of shGPX3 islet cells... GPX3 It can significantly reduce the survival rate of transplanted islets and increase ferrodeogenesis in transplanted islets.

[0067] Example 2: Overexpression GPX3 Application in the preparation of drugs that inhibit early ferroptosis in transplanted pancreatic islets.

[0068] A pancreatic islet transplantation model was constructed according to the method in Example 1. GPX3 Gene overexpression vector (pcDNA3.1-EGFP-GPX3), such as Figure 7 Studies have shown that expression GPX3 The effects on ferroptosis levels and islet cell survival rates in transplanted pancreatic islets were investigated. The specific methods are as follows.

[0069] 1. Construction GPX3 Overexpression vector Using homologous recombination cloning technology, rats GPX3 The gene sequence was inserted into the linearized pcDNA3.1-EGFP vector.

[0070] (1) Primer design Primers were designed based on the vector multiple cloning site: Vector-F shown in SEQ ID NO.6 and Vector-R shown in SEQ ID NO.7, to introduce homologous arms at both ends of the target insertion site.

[0071] SEQ ID NO.6: TGGGGGCCAGAGGGAAGTAACTGATGCCCTACCC; SEQ ID NO. 7: AAGGATCCGGGCCATGGATCCGAGCTCGGTACCAA.

[0072] (2) PCR amplification High-fidelity PCR was performed using pcDNA3.1-EGFP plasmid as a template to obtain a linearized vector backbone.

[0073] PCR reaction system: Total system 50 µL, 1 µL each of 10 µM Vector-F and Vector-R primers, 4 µL of 2.5 mM dNTP Mixture, 1 µL of PrimeSTAR GXL DNA Polymerase, 10 µL of 5× PrimeSTAR GXL Buffer, 1 µL of template plasmid, and the remainder ddH2O.

[0074] PCR reaction program: 98℃ for 5 min; 98℃ for 10 s, 65℃ for 15 s, 68℃ for 9 min, 30 cycles; 68℃ for 15 min, 4℃ for 10 min.

[0075] 2. Target gene ( GPX3 Fragment preparation (1) Primer design According to rats GPX3 Specific primers were designed based on the gene coding sequence (CDS, GenBank accession number NM_022525): RAT GPX3-F (SEQ ID NO.8) and RAT GPX3-R (SEQ ID NO.9). Homologous sequences that perfectly match both ends of the linearized pcDNA3.1-EGFP vector were added to the 5' end of the primers to achieve homologous recombination.

[0076] SEQ ID NO.8: CTCGGATCCATGGCCCGGATCCTT; SEQ ID NO.9: GTAGGGCATCAGTTACTTCCCTCTG.

[0077] (2) PCR amplification: PCR amplification was performed using pUC57-GPX3 plasmid as a template. The pUC57-GPX3 plasmid is a recombinant plasmid constructed by inserting the coding sequence of GPX3 into the pUC57 vector.

[0078] 50 µL PCR system: containing 1 µL each of 10 μM RAT GPX3-F and RAT GPX3-R primers, and 4 µL of 2.5 mM dNTP™ inclusions. Taq DNA Polymerase 1 µL, 10×buffer 5 µL, template 1 µL.

[0079] PCR reaction conditions: 95℃ for 10 min; 95℃ for 30 sec, 60℃ for 30 sec, 72℃ for 1 min, 30 cycles; 72℃ for 15 min, 4℃ for 4 min.

[0080] (3) Electrophoresis verification: The PCR product was electrophoresed on an agarose gel and a single bright band was observed at the expected size (about 2000 bp).

[0081] 3. Purification and recombination of the product The two PCR products were subjected to agarose gel electrophoresis, and the target bands were excised and purified using the gel. The purified linearized vector and... GPX3 Gene fragments are recombined and linked.

[0082] Recombination system: 1.5 µL of linearized vector, GPX3 8 µL of fragment, 4 µL of 5× CE II Buffer, 2 µL of Exnase II, and ddH2O to bring the total to 20 µL.

[0083] Reaction conditions: 37℃, reaction time 30 minutes.

[0084] 4. Transformation and positive clone screening The recombinant product was transformed into DH5α competent cells. The transformed bacterial culture was spread on LB solid medium containing ampicillin and incubated overnight at 37°C with the culture inverted position. Single colonies were picked and inoculated into LB liquid medium containing ampicillin and incubated overnight at 37°C with shaking.

[0085] 5. Validation and preparation of recombinant plasmids Sequencing Validation: Extract bacterial culture and send it for sequencing. Sequencing is performed using universal primers or gene-specific primers, and the results are compared with those from rats. GPX3 The inserted sequence was compared with a gene reference sequence to confirm that it was correct, the reading frame was accurate, and there were no mutations.

[0086] Large-scale plasmid extraction: High-purity, endotoxin-free plasmids were extracted from the positive clone bacterial culture that had been verified by sequencing for subsequent cell transfection experiments.

[0087] 6. Cell transfection experiment (1) Preparation of pancreatic islet cells Following the method described in Example 1, rat pancreatic β-cell lines (such as INS-1 cells) were cultured routinely in RPMI-1640 complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a 5% CO2 incubator. After the cells stabilized, they were used for transfection experiments.

[0088] (2) Experimental group setup oeGPX3 group: transfected with overexpression plasmid pcDNA3.1-EGFP-GPX3; oeNC group (negative control group): transfected with empty vector plasmid pcDNA3.1-EGFP; Blank control group: treated only with transfection reagent, without adding any plasmid.

[0089] (3) Liposome-mediated transient transfection Transfection was performed using Lipofectamine™ 3000 transfection reagent, and the procedure is as follows: Plating: Place well-grown pancreatic islet cells or INS-1 cells at a density of 5 × 10⁶ cells per well. 4 Cells were seeded at a density of 1,000 μL in 24-well plates, with 500 μL of complete culture medium added to each well. The plates were incubated overnight, and transfection was performed when the cells reached 70% confluence.

[0090] Preparation of the transfection complex (taking a single well as an example): Solution A: Take 1 μg of plasmid (oeGPX3 or oeNC) and dilute it in 50 μL of Opti-MEM® serum-free medium. Mix gently, then add 2 μL of P3000™ enhancer and mix again.

[0091] Solution B: Dilute 1.5 μL of Lipofectamine™ 3000 transfection reagent in 50 μL of Opti-MEM® serum-free medium and let stand at room temperature for 5 minutes.

[0092] Gently mix solution A and solution B, and incubate at room temperature for 15-20 minutes to form a DNA-liposome complex.

[0093] Transfection: Add 100 μL of the transfection complex dropwise evenly to each well of the cell culture medium that has been replaced with 200 μL of fresh Opti-MEM® medium. Gently shake the culture plate to mix.

[0094] Culture: After culturing the culture plate in a 37°C, 5% CO2 incubator for 8 hours, carefully aspirate the culture medium containing the transfection complex and replace it with 500 μL of fresh complete culture medium. Continue culturing for 72 hours for subsequent experiments.

[0095] (5) In vivo transplantation experiment Using the above overexpression GPX3 The pancreatic islet cells (oeGPX3) and their control cells (oeNC) were used entirely according to the method described in Part II (In vivo experiments) of Example 1: A streptozotocin (STZ)-induced diabetic model in Lewis rats was established. Experimental groups were divided into an oeGPX3 transplantation group (transplantation of oeGPX3 islet cells) and an oeNC transplantation group (transplantation of oeNC islet cells). 2000 IEQ cells were transplanted into the subcapsular region of the kidneys of diabetic rats to construct the islet transplantation model. Samples were collected 3 days post-transplantation for subsequent analysis.

[0096] 7. Experimental Results The results are as follows Figure 1 As shown, the vector was successfully constructed: GPX3 Specific bands were obtained from both PCR amplification of the gene and vector linearization. Sequencing and alignment confirmed the successful construction of the gene. GPX3 The gene overexpression vector (pcDNA3.1-EGFP-GPX3) was used, and the sequencing results of this overexpression vector are as follows: Figure 6 As shown, GPX3 The gene has been correctly inserted into the N-terminus of EGFP.

[0097] The extracted plasmids, after being tested for concentration, purity (A260 / A280 ratio) and endotoxin levels, all met the requirements for cell transfection experiments.

[0098] The results are as follows Figure 5 As shown, compared to islet cells transplanted with oeNC, islet cells transplanted under the renal capsule with oeGPX3 resulted in a significant increase in insulin-positive areas, accompanied by an increase in GPX4 expression levels. This result indicates that overexpression of oeGPX3 in islet cells... GPX3 It can significantly improve the survival rate of transplanted islets and inhibit ferroptosis in transplanted islets.

[0099] The results are as follows Figure 8 As shown, compared to pancreatic β cells transplanted with oeNC, pancreatic islet cells transplanted with oeGPX3 had lower levels of LDH, MDA, and Fe. 2+ The expression level of GPX4 decreased, accompanied by increased expression levels of SOD and GHS, while the expression level of GPX4 protein increased in pancreatic islet cells transplanted with oeGPX3. This result indicates that overexpression of GPX4 in β cells... GPX3 It can significantly improve the resistance of pancreatic islet cells to ferroptosis.

[0100] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0101] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Promote GPX3 The application of the expressed product in the preparation of drugs that inhibit early ferroptosis in transplanted pancreatic islets.

2. The application according to claim 1, characterized in that, The promotion GPX3 The product being expressed is GPX3 Overexpression vector or overexpression GPX3 The pancreatic islet cell line.

3. The application according to claim 2, characterized in that, The GPX3 Overexpression vectors are used to express... GPX3 The gene was obtained by inserting it into the pcDNA3.1-EGFP vector.

4. The application according to claim 3, characterized in that, The GPX3 Overexpression vector from GPX3 The gene and the linearized pcDNA3.1-EGFP vector were obtained through homologous recombination.

5. The application according to claim 2, characterized in that, The overexpression GPX3 The pancreatic islet cell line is made from GPX3 Obtained by transfecting pancreatic islet cells with an overexpression vector.

6. The application according to claim 5, characterized in that, The drug was overexpressed by resuspension in cold Hanks balanced salt solution. GPX3 The pancreatic islet cell line was obtained.

7. The application according to claim 1, characterized in that, The recipients of the transplanted pancreatic islets are mammals or humans suffering from diabetes.

8. The application according to claim 1, characterized in that, The drug is used to inhibit ferroptosis in transplanted pancreatic islets and improve the survival rate of transplanted islet cells.