Application of agents targeting and inhibiting OXCT1 in combination with BHB or pharmaceutically acceptable salts in the preparation of anti-HCC drugs
By targeting and inhibiting OXCT1 in combination with BHB, the functional contradiction of BHB in HCC treatment was resolved, achieving precise regulation of HCC cell metabolic pathways and producing synergistic anti-tumor effects, providing a new treatment approach for OXCT1-overexpressing HCC.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- AFFILIATED HOSPITAL OF JINING MEDICAL UNIV
- Filing Date
- 2026-04-27
- Publication Date
- 2026-06-02
AI Technical Summary
The role of BHB in HCC is contradictory in the current technology. Some studies show that it promotes tumor progression, while others show that it has a tumor-suppressing effect, which limits its application in HCC treatment. It is unclear whether OXCT1 is the key factor determining BHB function, and there are no reports of the combined use of OXCT1-targeted therapy and BHB in anti-HCC treatment.
Agents that target and inhibit OXCT1 (such as siRNA, shRNA, antisense nucleic acid, gene editing reagents, small molecule inhibitors, peptides, antibodies, or fusion proteins) are combined with BHB or a pharmaceutically acceptable salt thereof (such as NaBHB) to prepare anti-HCC drugs for treatment via various routes of administration.
This approach enables precise intervention in the metabolic pathways of HCC cells, producing a significant synergistic anti-tumor effect, enhancing the inhibition of HCC cell proliferation, migration, and invasion, providing a new treatment option, and broadening the application prospects of ketone body metabolism regulation in tumor treatment.
Smart Images

Figure CN122124254A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of liver disease research and biomedicine, and specifically relates to the pharmaceutical use of a pharmaceutical composition, particularly the use of an agent that targets and inhibits OXCT1 in combination with BHB or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating hepatocellular carcinoma. Background Technology
[0002] Primary liver cancer is the sixth most common type of cancer and the third leading cause of death worldwide, with hepatocellular carcinoma (HCC) being the predominant type, accounting for approximately 75% to 85%. Statistics show that China accounts for about half of the world's new HCC cases annually, making it a significant threat to the health of the Chinese population. Early-stage HCC can be treated surgically, but due to its insidious onset and rapid progression, 70% to 80% of patients are already in the middle or late stages at initial diagnosis, and the 5-year recurrence and metastasis rate after HCC resection remains as high as 50% to 70%. Currently, advanced HCC is mainly treated with drugs and radiotherapy, but their efficacy is limited and the prognosis is poor. Therefore, finding effective treatment methods is a crucial clinical issue that urgently needs to be addressed.
[0003] Metabolic reprogramming, or altered metabolic patterns in tumor cells to meet rapid proliferation demands and adapt to microenvironmental stress, is a key characteristic of malignant tumors. In recent years, various tumor-specific metabolic pathways, including those involving abnormal glucose, lipids, and amino acids, have been discovered, with ketone body metabolism proven to be closely related to HCC progression. Liver hepatic ketone bodies (BHB) are the main component of ketone bodies synthesized in the liver, accounting for approximately 78% of total ketone bodies. They are not only important energy substrates but also act as endogenous signaling molecules, participating in the regulation of various biological processes such as oxidative stress, inflammatory responses, and cellular senescence. However, the function of BHB in HCC progression remains controversial. Some studies suggest that BHB can promote malignant tumor progression, while others show that BHB intervention has anti-cancer effects. Current explanations for the contradictory functions of BHB largely focus on factors such as differences in signaling pathways or changes in the tumor microenvironment, failing to fully explain the completely contradictory biological phenomena observed in different studies. This functional uncertainty severely limits the clinical translational application of BHB and its metabolic pathways in HCC treatment.
[0004] OXCT1 is a key rate-limiting enzyme catalyzing the entry of ketone bodies into the tricarboxylic acid cycle, determining the cell's ability to metabolize and utilize ketone body glycosides (BHB). Normal hepatocytes express OXCT1 at extremely low levels, making it difficult to effectively utilize BHB. However, hepatocellular carcinoma (HCC) cells can highly express OXCT1 in stressful microenvironments such as nutrient deprivation, activating the ketone body catabolism pathway to adapt to microenvironmental stress and maintain a malignant proliferative phenotype. Current research suggests that abnormal OXCT1 expression may be related to the metabolic characteristics and biological behavior of tumors, but its specific role in regulating the effects of BHB on HCC cells remains unclear. Existing research on OXCT1 mainly focuses on its mechanism of action in tumor metabolic adaptation; there are no clear technical solutions for using OXCT1 as an intervention target to regulate ketone body metabolism for HCC treatment. In particular, existing studies have failed to clarify whether OXCT1 expression level is a key factor determining whether BHB exerts a pro-cancer or anti-cancer function in HCC, and there are no reports of combining targeted inhibition of OXCT1 with exogenous BHB for anti-HCC therapy.
[0005] Therefore, there is an urgent need in this field to develop a HCC treatment strategy based on ketone body metabolism regulation, which can achieve precise intervention in the metabolic pathways of liver cancer cells by targeting OXCT1 in combination with BHB, so as to solve the application obstacles caused by the functional contradiction of BHB in the existing technology and provide a new and effective approach for HCC treatment. Summary of the Invention
[0006] In existing technologies, the role of BHB in HCC is contradictory; some studies show it promotes tumor progression, while others show it has anti-cancer effects. This functional uncertainty severely limits the clinical application of BHB and its metabolic pathways in HCC treatment. Meanwhile, although existing research suggests that OXCT1, as a key rate-limiting enzyme in ketone body metabolism, is abnormally highly expressed in liver cancer cells, whether OXCT1 is the key factor determining the functional trajectory of BHB in HCC, and whether a synergistic anti-tumor effect can be achieved by targeting OXCT1 in combination with BHB, remains unclear. The technical problem this invention aims to solve is to address the deficiencies of the existing technologies by providing an application of targeted inhibition of OXCT1 combined with BHB in the preparation of anti-HCC drugs, thereby achieving precise intervention in HCC cell metabolic pathways, overcoming the functional uncertainty of BHB alone, and producing a synergistic anti-tumor effect.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] The application of agents that target and inhibit OXCT1 in combination with BHB or a pharmaceutically acceptable salt thereof in the preparation of anti-HCC drugs.
[0009] Furthermore, the reagents that inhibit OXCT1 include:
[0010] (1) Reduce OXCT1 expression with siRNA, shRNA, antisense nucleic acid, and gene editing reagents;
[0011] (2) Small molecule inhibitors, peptides, antibodies or fusion proteins that inhibit OXCT1 enzyme activity.
[0012] Furthermore, the BHB or its pharmaceutically acceptable salts, including but not limited to NaBHB.
[0013] Furthermore, the reagent targeting and inhibiting OXCT1 exists in the form of a single pharmaceutical composition with BHB, or in the form of a kit containing the two active ingredients in separate packaging.
[0014] Furthermore, the active ingredient of the anti-HCC drug includes:
[0015] (1) BHB or its pharmaceutically acceptable salt;
[0016] (2) Substances that can inhibit OXCT1 expression or inhibit OXCT1 enzyme activity.
[0017] Furthermore, the anti-HCC drug also contains pharmaceutically acceptable excipients.
[0018] Furthermore, the dosage form of the anti-HCC drug is selected from one or more of tablets, capsules, pills, oral liquid preparations, granules, powders, and injections.
[0019] Furthermore, the administration method of the anti-HCC drug is selected from one or more of oral, injection, implantation, external application, spray, and inhalation; the administration form includes simultaneous administration, sequential administration, or intermittent administration.
[0020] Furthermore, the anti-HCC drug is used to treat OXCT1-overexpressing hepatocellular carcinoma.
[0021] Furthermore, the reagent that targets and inhibits OXCT1 produces a synergistic effect when used in combination with BHB.
[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0023] 1. This invention innovatively reveals the crucial role of OXCT1 in determining the functional trajectory of BHB: It confirms that the expression level of OXCT1 is a key switch determining whether BHB exerts a pro-cancer or anti-cancer function in HCC. This discovery resolves the long-standing technical challenge of the contradictory nature of BHB function in existing technologies, providing a clear theoretical basis for HCC treatment based on ketone body metabolism.
[0024] 2. Significant synergistic anti-tumor effect: This invention achieves precise regulation of HCC cell metabolic pathways by targeting and inhibiting OXCT1 in combination with exogenous BHB. Experiments have shown that the combined drug treatment significantly enhances the inhibitory effect on the proliferation, migration, and invasion of HCC cells, and the effect is superior to using OXCT1 inhibitors or BHB alone, demonstrating a significant synergistic effect.
[0025] 3. This invention provides a new treatment option for HCC with high OXCT1 expression and poor prognosis: HCC cells with high OXCT1 expression typically have stronger proliferative and invasive capabilities, resulting in a worse prognosis for patients, and existing treatments have limited effectiveness. This invention provides a novel treatment approach for this type of liver cancer through a metabolic intervention strategy that targets and inhibits OXCT1 combined with NaBHB, and has significant clinical translational potential.
[0026] 4. Expanding the application prospects of ketone body metabolism regulation in tumor treatment: This invention not only provides a new combination of anti-HCC drugs, but also provides a new approach to the application of ketone body metabolism regulation in tumor treatment, with broad technical extensibility and application prospects. Attached Figure Description
[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0028] Figure 1 The molecular structural formula of BHB;
[0029] Figure 2 The molecular structural formula of NaBHB is given.
[0030] Figure 3 To investigate the effects of different concentrations of NaBHB intervention on HCC cell proliferation using CCK8 and plate colony assays;
[0031] Figure 4 To investigate the effect of different concentrations of NaBHB intervention on the migration ability of HCC cells using a cell scratch assay;
[0032] Figure 5 To investigate the effects of different concentrations of NaBHB on the migration and invasion abilities of HCC cells using Transwell assays;
[0033] Figure 6 Changes in the expression of apoptosis proteins in HCC cells after treatment with high concentrations of NaBHB;
[0034] Figure 7 The expression levels of OXCT1 in different HCC cell lines and the concentration-dependent effect of BHB on its expression;
[0035] Figure 8 To knock down the effect of OXCT1 on the biological function of NaBHB. Detailed Implementation
[0036] This embodiment is only used to explain the present invention and is not intended to limit its scope of protection. Unless otherwise specified, all experimental materials and reagents used in this invention are analytical grade or cell culture grade, and cell experiment-related reagents are cell culture grade or specialized kits; all experimental methods used are conventional methods in the corresponding fields.
[0037] The application of reagents targeting and inhibiting OXCT1 in combination with BHB or pharmaceutically acceptable salts thereof in the preparation of anti-HCC drugs. The reagents for inhibiting OXCT1 include: (1) siRNA, shRNA, antisense nucleic acid, or gene editing reagents that reduce OXCT1 expression; (2) small molecule inhibitors, peptides, antibodies, or fusion proteins that inhibit OXCT1 enzyme activity; the BHB or pharmaceutically acceptable salts thereof include, but are not limited to, NaBHB; the reagents targeting and inhibiting OXCT1 and BHB exist as a single pharmaceutical composition or as a kit containing two separately packaged active ingredients.
[0038] The active ingredient of the anti-HCC drug includes: (1) BHB or a pharmaceutically acceptable salt thereof; and (2) a substance capable of inhibiting OXCT1 expression or inhibiting OXCT1 enzyme activity. The anti-HCC drug also contains pharmaceutically acceptable excipients. It should be noted that the dosage form of the anti-HCC drug is selected from one or more of tablets, capsules, pills, oral liquid preparations, granules, powders, and injections; the administration method of the anti-HCC drug is selected from one or more of oral, injection, implantation, external application, spray, and inhalation; the administration method includes simultaneous administration, sequential administration, or intermittent administration.
[0039] The anti-HCC drug is used to treat hepatocellular carcinoma with high OXCT1 expression. The reagent targeting and inhibiting OXCT1 produces a synergistic effect when used in combination with BHB.
[0040] As one embodiment, the β-hydroxybutyrate provided by this invention is specifically NaBHB. The chemical structural formula of BHB described in the background section of this invention is as follows: Figure 1 As shown; the NaBHB used in this embodiment of the invention was purchased from Sigma-Aldrich, product code #54965, and the chemical structural formula of NaBHB is as follows. Figure 2As shown. A stock solution of NaBHB with a concentration of 159 mmol / L (mM) (20 mg / mL) was prepared and stored. The specific preparation method is as follows: Weigh 600 mg of NaBHB powder, add 30 mL of dd water to a 50 mL centrifuge tube, mix well, shake for 1 min, heat in a 37°C water bath for 20 min, and then sonicate for 10 min × 3 times using an ultrasonic cleaner until completely dissolved. Filter the solution using a Millex®-GP 0.22 μm syringe filter, aliquot into 1.5 mL centrifuge tubes, seal and label, and store at -80°C.
[0041] The cell lines used in this invention are: human immortalized normal hepatocyte cell line THLE-2, human hepatocellular carcinoma cell lines HepG2 and Huh7, and mouse hepatocellular carcinoma cell line Hepa1-6. Huh7 and Hepa1-6 cells were cultured in DMEM low-bicarbonate basal medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. HepG2 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. THLE-2 cells were cultured in THLE-2 complete medium (purchased from Shanghai Fuheng Biotechnology Co., Ltd., catalog number: FH-THLE-2). All culture conditions were 37℃ and 5% CO2. This invention utilizes lentivirus-mediated shRNA interference technology to construct a stably knocked-down OXCT1 HCC cell line. The lentivirus expressing shRNA used was purchased from Jikai Gene (Shanghai Jikai Biotechnology Co., Ltd.).
[0042] Example 1: Effects of different concentrations of NaBHB on the proliferation capacity of HCC cells
[0043] 1. CCK-8 (Cell Counting Kit-8) Experiment
[0044] Experimental steps: (1) Huh7, Hepa1-6 and HepG2 cells were digested with trypsin and centrifuged. The supernatant was discarded and the cells were resuspended in the corresponding cell culture medium. After counting, the cells were diluted to 1×10⁻⁶. 4(2) Add 100 μL of cell suspension to each well of a 96-well plate, and set up concentration gradient groups of 0 mM, 2 mM, 5 mM, 10 mM, 20 mM, 40 mM, 60 mM and 80 mM. Each concentration group is designed with 3 replicates, and control and blank wells are set up. (3) Place the culture plate in an incubator (37℃, 5% CO2) overnight. After the cells adhere to the wall, add 0 mM, 2 mM, 5 mM, 10 mM, 20 mM, 40 mM, 60 mM and 80 mM NaBHB to each well of the culture plate, respectively. The control group is given the same volume of physiological saline. Continue to culture in an incubator for 72 hours. (4) Add 10 μL of prepared CCK-8 solution to each well, gently shake the culture plate to mix, and incubate in an incubator for 1.5-2 hours. (5) Measure the absorbance (OD value) at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.
[0045] Experimental results are as follows Figure 3 As shown in A:
[0046] NaBHB exhibits a concentration-dependent bidirectional regulatory effect on the proliferation of Huh7 and Hepa1-6 cells, promoting proliferation at low concentrations and inhibiting proliferation at high concentrations. When the concentration is less than 20 mM, the pro-proliferative activity of NaBHB on both Huh7 and Hepa1-6 cells increases with increasing NaBHB concentration, reaching a peak at 20 mM. When the concentration of NaBHB is higher than 20 mM, its pro-proliferative activity on Huh7 and Hepa1-6 cells gradually decreases. When the concentration is further increased to exceed its inhibition threshold, it exhibits an inhibitory effect, and this inhibitory effect increases with increasing NaBHB concentration. Within the detected concentration range, NaBHB consistently shows a significant promoting effect on the proliferation of HepG2 cells.
[0047] The effects of NaBHB intervention on the proliferation capacity of Huh7 cells are shown in Table 1:
[0048] Table 1
[0049]
[0050] The effects of NaBHB intervention on the proliferation capacity of Hepa1-6 cells are shown in Table 2:
[0051] Table 2
[0052]
[0053] The effects of NaBHB intervention on the proliferation capacity of HepG2 cells are shown in Table 3:
[0054] Table 3
[0055]
[0056] 2. Plate colony formation experiment
[0057] Experimental steps: (1) Take Huh7, Hepa1-6 and HepG2 cells in the logarithmic growth phase, digest them with trypsin and pipette them into single cells. Discard the supernatant and resuspend them in the corresponding cell culture medium. (2) Dilute the cell suspension and seed them evenly in a six-well plate at an appropriate cell density (500-800 cells per well). Set up a control group and an intervention group. The intervention group was treated with 20mM and 60mM NaBHB, respectively, and the control group was treated with the same volume of physiological saline. (3) Incubate in a 37℃, 5% CO2 incubator and change the medium every 3 days. When visible clones appear in the culture dish, stop the culture. (4) Carefully wash twice with PBS, fix with 4% paraformaldehyde for 15 min, wash with PBS, add an appropriate amount of 0.1% crystal violet for 20-30 min, wash off the staining solution with dd water, and air dry. (5) Use ImageJ software to count clones and calculate the clone formation rate; clone formation rate = (number of clones / number of inoculated cells) × 100%.
[0058] Experimental results are as follows Figure 3 As shown in Figure B, compared with the control group, the number and size of Huh7 and Hepa1-6 cell colonies were significantly increased after treatment with 20mM NaBHB, while the number and size of Huh7 and Hepa1-6 cell colonies were significantly decreased after treatment with 60mM NaBHB; while the number and size of HepG2 cell colonies were significantly increased under both 20mM and 60mM NaBHB treatment conditions.
[0059] Example 2: Effects of different concentrations of NaBHB on the migration and invasion abilities of HCC cells
[0060] 1. Cell scratch assay
[0061] Experimental steps: (1) Digest Huh7, Hepa1-6 and HepG2 cells with trypsin and pipette them into single cells. Discard the supernatant and resuspend them in the corresponding cell culture medium. (2) Draw horizontal lines evenly on the back of a six-well plate with a marker, spaced about 1 cm apart. Each well should have at least 3 lines. Then, adjust the cell density and seed the cells into the six-well plate. (3) Set up a control group and an intervention group. The intervention group was given 20 mM and 60 mM NaBHB, respectively. The control group was given the same volume of physiological saline. The cells were cultured in a 37°C, 5% CO2 incubator. (4) After 3 days of intervention, when the cell density reached about 95%, use the same 200 μL pipette tip to draw lines perpendicularly in the six-well plate. Wash with PBS 3-5 times, add serum-free culture medium, and continue to culture in a 37°C, 5% CO2 incubator. (5) Take pictures under an optical microscope at 0 h, 24 h, 48 h and 72 h. Wash with PBS 3 times before each picture. (6) Use ImageJ software to calculate the migration area and migration rate: Migration area = area of 24h / 48h / 72h - area of 0h; Migration rate = migration area / area of 0h × 100%.
[0062] Experimental results are as follows Figure 4 As shown: Compared with the control group, after treatment with 20 mM NaBHB, the scratch width of Huh7 cells and Hepa1-6 cells was significantly reduced, and their migration ability was significantly enhanced; when the NaBHB concentration was increased to 60 mM, the reduction in scratch width of these two cell types decreased, and their migration ability was significantly inhibited. Figure 4 A and 4B); while HepG2 cells treated with 20mM and 60mM NaBHB showed significantly enhanced migration ability compared to the control group ( Figure 4 C).
[0063] 2. Transwell migration / invasion experiments
[0064] Experimental steps: (1) The Transwell experiment was conducted in a polycarbonate filter chamber (pore size: 8.0 μm, Corning, USA). The invasion experiment was conducted using matrix gel in addition to the filter chamber. (2) Huh7, Hepa1-6 and HepG2 cell suspensions were seeded in six-well plates. A control group and an intervention group were set up. The intervention group was treated with 20 mM and 60 mM NaBHB, respectively, and the control group was treated with the same volume of physiological saline. After 3 days of intervention, when the cell density reached about 80%, the serum was removed and starved for 12 h to remove the influence of serum. (3) The Huh7, Hepa1-6 and HepG2 cells seeded in the six-well plates were digested with trypsin and pipetted into single cells. After centrifugation and discarding the supernatant, the cells were resuspended in the corresponding serum-free medium to prepare cell suspensions. (4) 200 μL of cell suspension per well (1.5 × 10⁶ cells per well) was added to each well. 5(5) Seed cells) into the upper chamber of the Transwell, and add 500 μL of medium containing 10% FBS to the lower chamber of the Transwell, avoiding the formation of air bubbles. (6) Incubate at 37℃ in a 5% CO2 incubator for the appropriate time, and then perform fixation and staining. (7) Carefully clean the inside and outside of the chamber with PBS, fix with 4% paraformaldehyde for 15 min, wash again with PBS, and then add an appropriate amount of 0.1% crystal violet for staining for 20-30 min. (8) Clean the inside and outside of the chamber to remove crystal violet that has not bound to the cells, and gently wipe the upper side of the chamber with a cotton swab to remove cells that have not migrated or invaded. (9) After air drying, take images using an inverted microscope. (10) Use ImageJ software to perform quantitative analysis of the cells in the images.
[0065] Experimental results are as follows Figure 5 As shown: Compared with the control group, treatment with 20 mM NaBHB significantly increased the number of Huh7 and Hepa1-6 cells that penetrated the membrane, and their migration and invasion abilities were significantly enhanced; treatment with 60 mM NaBHB significantly reduced the number of these two cell types that penetrated the membrane, and their migration and invasion abilities were significantly inhibited. Figure 5 (A and 5B); while under the treatment conditions of 20mM and 60mM NaBHB, the number of HepG2 cells that penetrated the membrane increased significantly, indicating that their migration and invasion abilities were significantly improved compared with the control group (A and 5B). Figure 5 C).
[0066] Example 3: Effects of different concentrations of NaBHB on HCC cell apoptosis
[0067] To clarify the effect of high-concentration NaBHB on HCC cell apoptosis, this study used Huh7 and HepG2 cell lines as research subjects, setting up NaBHB treatment groups with different superthreshold concentrations and a saline control group. Total protein was extracted from cells in each group, and the expression levels of apoptosis-related proteins Bax, Bcl-2, and Cleaved Caspase-3 were detected by Western blotting. GAPDH was used as an internal control for semi-quantitative analysis. By comparing the changes in Bax and Bcl-2 expression and the activation level of Cleaved Caspase-3 in each treatment group, the induction effect of high-concentration NaBHB on HCC cell apoptosis was evaluated.
[0068] Protein extraction and concentration determination: (1) Cell collection. Huh7 and HepG2 cells were seeded in culture plates and treated with 0, 20, 40, 60 and 80 mM NaBHB, respectively. After 48 h, when the cell density reached about 80%, the cells were collected. (2) Protein extraction. After washing the cells twice with PBS pre-cooled at 4℃, 300 μL of pre-cooled protein lysis buffer was added to each well and lysed on ice for 30 min. Cells were scraped off with a cell scraper and transferred to a new 1.5 ml EP tube. The cells were then lysed using an ultrasonic cell disruptor. The cells were centrifuged at 4℃ and 12000 rpm for 10 min. The supernatant was transferred to a new EP tube to obtain the total protein sample. (3) Balance protein concentration using BCA method. BCA reagent was prepared, and standard protein solution and sample buffer for the protein to be tested were prepared. 200 μL of BCA working solution and 20 μL of protein system were added to a 96-well plate. The plate was incubated in a 37℃ incubator in the dark for 30 min. The OD value is read at a wavelength of 595 nm using an ELISA reader; a linear regression equation is calculated based on the standard protein concentration and the corresponding OD value; and the protein concentration of the sample is calculated based on the OD value of the protein sample and the equation.
[0069] Western Blot: (1) Gel preparation. Prepare a 12.5% PAGE gel. Add about 2.5 ml of freshly prepared lower gel mixture to the middle layer of the glass plate. Press the liquid surface with an appropriate amount of water and let it stand at room temperature for 15 min until a cross-sectional interface appears. Remove the water on the cross-sectional surface. At the same time, prepare a fresh upper gel mixture and inject it into the glass plate. Quickly insert the comb and let it stand at room temperature for 15 min. After it solidifies, slowly pull out the comb. (2) Electrophoresis. Add markers and protein samples to the corresponding wells and add an appropriate amount of electrophoresis buffer. Adjust the voltage to 80V for electrophoresis. When the protein runs out of the upper gel, adjust the voltage to 120V and continue electrophoresis. Stop electrophoresis when the electrophores are close to the bottom edge of the glass plate after about 90 min. (3) Transfer membrane. Cut a PVDF membrane of appropriate size and soak it in methanol for 2 min to activate it. In the pre-cooled transfer buffer, assemble the transfer "sandwich" structure in the following order: black clip, sponge, filter paper, gel, PVDF membrane, filter paper, sponge pad, white clip. Carefully remove all air bubbles between the gel and the PVDF membrane. Place the assembled transfer clip into the transfer tank in the correct orientation, ensuring that the black clip faces the black end of the electrode core and the white clip faces the red end. Add pre-cooled transfer buffer to the transfer tank and place an ice pack in it. Then place the entire transfer tank in an ice bath to maintain a low temperature environment. Set a constant current of 300 mA and transfer for 60 min. (4) Blocking. After the transfer is complete, remove the PVDF membrane and place it in a 5% (w / v) skim milk powder blocking solution prepared with TBST. Incubate slowly on a shaker at room temperature for 1 h to block the non-specific binding sites on the membrane. (5) Primary antibody incubation. The primary antibodies were diluted with TBST buffer: Cleaved Caspase-3 (1:800), Bax (1:800), and Bcl-2 (1:800). The dilution ratios were all based on the antibody instructions (all antibodies were purchased from Affinity). The PVDF membrane was placed in the incubation box, the diluted primary antibody was added, and it was incubated overnight on a shaker at 4°C. (6) Secondary antibody incubation. The next day, the membrane was washed three times with TBST buffer for 15 minutes each time. Then, the corresponding species of secondary antibody was added, and the membrane was incubated on a shaker at room temperature for 1 hour. After incubation, the membrane was washed three times with TBST buffer for 15 minutes each time. (7) Exposure. The developing solution was prepared, and the target band was placed face up on the developing stage, ensuring that the protein side was facing upwards. An appropriate amount of luminescent detection solution was added for development. (8) Membrane elution. After exposure, place the PVDF membrane in the elution buffer and incubate with shaking for 30 min to remove the primary and secondary antibodies bound to the membrane. After elution, wash three times with TBST for 15 min each time to completely remove residual elution buffer. (9) Block and incubate with internal control antibody.The eluted PVDF membrane was placed in 5% (w / v) skim milk blocking solution and blocked on a shaker at room temperature for 1 h. After blocking, diluted GAPDH primary antibody (CST, 1:1000) was added and incubated on a shaker at 4°C overnight. The next day, the membrane was washed three times with TBST for 15 min each time. Then, the corresponding species secondary antibody was added and incubated on a shaker at room temperature for 1 h. The membrane was then washed three times with TBST for 15 min each time. (10) Internal control exposure. The luminescent detection solution was added according to step (7), and the GAPDH band image was developed and saved. (11) The target band was analyzed for grayscale value using ImageJ software.
[0070] Experimental results are as follows Figure 6 As shown, when the NaBHB concentration exceeds the threshold of 20 mM, the expression levels of pro-apoptotic proteins Cleaved Caspase-3 and Bax in Huh7 cells tend to increase with increasing NaBHB concentration, while the expression level of anti-apoptotic protein Bcl-2 tends to decrease, and the cells exhibit a typical apoptotic phenotype. Figure 6 A). In contrast, HepG2 cells showed lower sensitivity to NaBHB-induced apoptosis, exhibiting a significantly elevated concentration threshold required for apoptosis induction, meaning the apoptotic response exhibited a delayed characteristic. Figure 6 B).
[0071] Example 4: OXCT1 expression levels in different HCC cell lines and their relationship with BHB concentration-dependent bidirectional effects.
[0072] As a key rate-limiting enzyme in the ketone body catabolism pathway, the expression level of OXCT1 may directly determine the sensitivity of different HCC cells to the functional effects of BHB. To elucidate the intrinsic regulatory relationship between OXCT1 expression and the concentration-dependent bidirectional biological effects of BHB, this study used Western blotting to detect the expression level of OXCT1 in different HCC cell lines and its expression changes under different concentrations of NaBHB treatment.
[0073] Experimental steps: (1) Cell collection. THLE-2, HepG2, Hepa1-6 and Huh7 cells were seeded in culture plates and collected under conditions with and without NaBHB intervention (treatment time 48 h). In addition, Huh7 and HepG2 cells were treated with 0, 2, 5, 10, 20, 40, 60 and 80 mM NaBHB for 48 h and collected again. (2) Protein extraction. After washing the cells twice with PBS pre-cooled at 4℃, 300 μL of pre-cooled protease inhibitor and RIPA tissue lysis buffer were added to each well and the cells were fully lysed on ice for 30 min. Cells were scraped off with a cell scraper and transferred to a new 1.5 ml EP tube. The cells were then lysed using an ultrasonic cell disruptor. The cells were centrifuged at 4℃ and 12000 rpm for 10 min. The supernatant was transferred to a new EP tube to obtain the total protein sample. (3) Balance protein concentration using the BCA method. Prepare BCA reagent, and at the same time prepare standard protein solution and sample buffer for the protein to be tested. Add 200ul of BCA working solution and 20ul of protein system to a 96-well plate. Incubate in a 37℃ incubator in the dark for 30min. After incubation, measure the OD value of each well at a wavelength of 595nm. Plot a standard curve with the protein concentration of the standard as the x-axis and the corresponding OD value as the y-axis. Calculate the protein concentration of each group of samples according to the formula of the standard curve; denature at 99℃ for 9min. (4) Gel preparation. Prepare 10% PAGE gel, add about 2.5ml of freshly prepared lower gel mixture to the middle layer of the glass plate, press the liquid surface with an appropriate amount of water, let stand at room temperature for 15min until a cross-sectional interface appears, remove the water on the cross-sectional surface; at the same time, prepare fresh upper gel mixture and inject it into the glass plate, and quickly insert the comb, let stand at room temperature for 15min, and slowly pull out the comb after it solidifies. (5) Electrophoresis. Add marker and protein sample to the corresponding well, and add an appropriate amount of electrophoresis buffer. Adjust the voltage to 80V for electrophoresis. When the protein runs out of the upper gel, adjust the voltage to 120V and continue electrophoresis. Stop electrophoresis when the electrophores are close to the bottom edge of the glass plate after about 90 minutes. (6) Transfer membrane. Cut a PVDF membrane of appropriate size and soak it in methanol for 2 minutes to activate it. In the pre-cooled transfer buffer, assemble the transfer membrane "sandwich" structure in the following order: black clamp, sponge, filter paper, gel, PVDF membrane, filter paper, sponge pad, white clamp. Carefully remove all air bubbles between the gel and the PVDF membrane. Place the assembled transfer clamp into the transfer tank in the correct direction, ensuring that the black clamp faces the black end of the electrode core and the white clamp faces the red end. Add pre-cooled transfer buffer to the transfer tank and put in an ice pack. Then place the entire transfer tank in an ice bath to maintain a low temperature environment. Set a constant current of 300 mA and transfer membrane for 60 minutes. (7) Blocking.After the transfer was completed, the PVDF membrane was removed and placed in 5% (w / v) skim milk powder blocking solution prepared with TBST. It was then placed on a shaker at room temperature for 60 min to block the non-specific binding sites on the membrane. (8) Primary antibody incubation. After blocking, the PVDF membrane was placed in a clean PE glove compartment. Based on the protein marker and the molecular weight of OXCT1 protein and GAPDH, the corresponding membrane strips were precisely cut. The primary antibody was diluted with TBST buffer: OXCT1 1:000, GAPDH 1:1000. The dilution ratio was based on the antibody instructions (the antibodies were all purchased from CST). The cut PVDF membrane was placed in an incubation box, the diluted primary antibody was added, and it was incubated overnight on a shaker at 4℃. (9) Secondary antibody incubation. The next day, the membrane was washed 3 times with TBST buffer for 15 min each time. Then, the corresponding species secondary antibody was added and incubated on a shaker at room temperature for 1 h. After incubation, the membrane was washed 3 times with TBST buffer for 15 min each time. (10) Exposure. Prepare the developing solution and keep it away from light. Place the target band face up on the developing stage, ensuring the protein side is facing upwards. Add an appropriate amount of luminescent detection solution for development, and save the full-film image. (11) Use ImageJ software to perform grayscale analysis on the target band.
[0074] The results are as follows Figure 7 A (without NaBHB intervention) and Figure 7 As shown in Figure B (20 mM NaBHB intervention), OXCT1 protein expression was extremely low in normal THLE-2 hepatocytes. In contrast, the expression level of OXCT1 protein was significantly increased in HCC cell lines such as HepG2, Hepa1-6, and Huh7. NaBHB intervention further enhanced OXCT1 expression in these HCC cell lines. Further analysis using Huh7 and HepG2 cells as subjects, with gradient concentrations of NaBHB treatment, showed that OXCT1 expression in Huh7 cells initially increased and then decreased with increasing NaBHB concentration: low concentrations of NaBHB induced OXCT1 upregulation, and when the NaBHB concentration exceeded the 20 mM threshold, OXCT1 expression was significantly downregulated. Figure 7 C); HepG2 cells showed stronger tolerance to high concentrations of NaBHB: their OXCT1 expression level increased continuously with increasing NaBHB concentration and remained at a high level over a wide concentration range; the downregulation trend of OXCT1 in these cells lagged significantly behind that in Huh7 cells, requiring even higher NaBHB concentrations to induce a decrease (C). Figure 7 D). The expression changes of OXCT1 protein described above are highly consistent with the phenotypic effects of NaBHB on Huh7 cells (promoting at low concentrations and inhibiting at high concentrations), and are also completely consistent with the functional phenotype of HepG2 cells that are continuously promoted by NaBHB.
[0075] Example 5: Effects of lentivirus-mediated shRNA-targeted knockdown of OXCT1 on the biological function of NaBHB
[0076] 1. Construction of OXCT1 knockdown HCC cell line
[0077] Experimental steps: (1) Cell seeding. HepG2 cells with the highest OXCT1 expression after NaBHB treatment were selected as the research object. After routine digestion, the cells were centrifuged and the supernatant was discarded. The cells were then resuspended in complete culture medium to prepare a single-cell suspension. The cells were counted and the cell density was adjusted to 1×10⁶ cells per well. 5 (1) Cells were seeded in six-well plates and cultured in a 37°C, 5% CO2 incubator. (2) Viral infection. After culturing for 24 hours after seeding, when the cells adhered and the density reached 20%-30%, viral infection was performed. According to the optimal multiplicity of infection (MOI) and viral titer, the medium was replaced with serum-free Opti medium containing the corresponding amount of virus, and 40 μL HiTransG A / P infection enhancement medium was added to each well. After culturing for 16 hours, the medium was replaced with complete medium. (3) Screening of stable cell lines. After culturing for another 72 hours, 2 μg / mL Puromycin was added to the complete medium for screening. During the screening period, the complete medium containing 2.00 μg / mL Puromycin was replaced every 2-3 days. The screening was continued for 2-3 weeks until the untransfected cells died completely, and a stable transfected cell line was obtained. (4) OXCT1 knockdown verification. The expression level of OXCT1 in the knockdown group (shOXCT1) and the negative control group (shNC) was detected by Western blot.
[0078] Experimental results are as follows Figure 8 As shown in Figure A, an OXCT1 gene knockdown HCC cell line was successfully constructed using lentivirus-mediated shRNA interference technology.
[0079] Three independent target sites, shOXCT1-1, shOXCT1-2, and shOXCT1-3, were designed, and their siRNA sequences are as follows:
[0080] shOXCT1-1: GGAAGGCCTGACAGTGGATGA;
[0081] shOXCT1-2: GGACACGTCGATCTGACAA;
[0082] shOXCT1-3:GCGTTTATCAATCCGGAAAGA.
[0083] Western blot results showed that, compared with the control group, the expression level of OXCT1 protein in the shOXCT1-1 and shOXCT1-2 groups was not significantly reduced, while the shOXCT1-3 group showed a significant knockdown effect. Therefore, the shOXCT1-3 cell line was used for functional studies in subsequent experiments.
[0084] 2. Effects of knockdown of OXCT1 on the biological effects of NaBHB
[0085] (1) CCK-8 experiment:
[0086] Experimental Procedure: HepG2 cells from the logarithmic growth phase of the shOXCT1 and shNC groups were routinely digested with trypsin, centrifuged, and the supernatant was discarded. The cells were resuspended in complete culture medium to prepare a single-cell suspension. Cell counts were performed, and cell density was adjusted. Cells were seeded at a density of 2000–3000 cells per well in 96-well plates, with a volume of 100 μL per well. Grouping was as follows: shNC + saline, shNC + NaBHB, shOXCT1 + saline, and shOXCT1 + NaBHB; each group had 3 replicates. 24 h after seeding, once cells had adhered, NaBHB (intervention concentration 20 mM) or saline was added according to the group. Cells were incubated at 37°C in a 5% CO2 incubator for 72 hours. 10 μL of prepared CCK-8 solution was added to each well, the plate was gently shaken to mix, and the plate was incubated for another 1.5–2 hours. The OD value at 450 nm was measured using a microplate reader.
[0087] CCK-8 assays showed that NaBHB significantly promoted the proliferation of HepG2 cells; knockdown of OXCT1 reversed this proliferative effect, and the OXCT1+NaBHB group exhibited the lowest proliferative activity. The effect of OXCT1 knockdown on the ability of NaBHB to promote HepG2 cell proliferation was as follows: Figure 8 C and Table 4 are shown.
[0088] Table 4
[0089]
[0090] (2) Plate colony formation experiment:
[0091] Experimental Procedure: HepG2 cells from the logarithmic growth phase of the shOXCT1 and shNC groups were routinely digested with trypsin, centrifuged, and the supernatant was discarded. The cells were then resuspended in complete culture medium to prepare a single-cell suspension. After counting, the cell density was adjusted to 500-800 cells per well and evenly seeded into six-well plates. The experiment consisted of four groups: shNC + saline, shNC + NaBHB, shOXCT1 + saline, and shOXCT1 + NaBHB. The NaBHB intervention concentration was 20 mM, and the control group received an equal volume of saline. Cells were cultured at 37°C in a 5% CO2 incubator, with the culture medium changed every 3 days. Culture was terminated when visible cell clones appeared in the culture dish. The culture medium was discarded, and the cells were carefully washed twice with PBS, fixed with 4% paraformaldehyde for 15 min, washed with PBS, stained with 0.1% crystal violet for 20-30 min, and slowly washed away with running water to remove excess stain. The cells were then dried at room temperature. The clones in each well were counted using ImageJ software, and the colony formation rate was calculated as follows: Colony formation rate = (number of clones / number of inoculated cells) × 100%.
[0092] Cloning experiments (such as) Figure 8 As shown in Figure B, NaBHB treatment significantly enhanced the colony-forming ability of HepG2 cells; however, knockdown of OXCT1 completely reversed the promoting effect of NaBHB, and the colony-forming rate of the OXCT1 knockdown + NaBHB group was the lowest among all groups. These results are consistent with the CCK8 assay, suggesting that OXCT1 mediates the proliferative function of NaBHB.
[0093] (3) Cell scratch test:
[0094] Experimental procedure: HepG2 cells from the logarithmic growth phase of the shOXCT1 and shNC groups were routinely digested with trypsin, centrifuged, and the supernatant was discarded. The cells were then resuspended in complete culture medium to prepare a single-cell suspension. After counting, the cell density was adjusted to approximately 5 × 10⁶ cells per well. 5Cells were seeded. Horizontal lines were evenly drawn on the back of a six-well plate using a marker, spaced approximately 1 cm apart, with at least three lines passing through each well. Cells were then seeded into the six-well plates. The experiment consisted of four groups: shNC + saline, shNC + NaBHB, shOXCT1 + saline, and shOXCT1 + NaBHB. The NaBHB intervention concentration was 20 mM. The control group received an equal volume of saline. Cells were incubated at 37°C in a 5% CO2 incubator for 72 hours (until near confluence). Scribing was then performed by drawing a straight line vertically in the center of each well using a 200 μL sterile pipette tip. Cells were gently washed with PBS to remove detached cells, and serum-free or low-serum culture medium was added. Cells were then incubated again. Images were taken under an optical microscope at 0 h, 24 h, 48 h, and 72 h (using the horizontal lines on the back as a reference to locate the same field of view). Use ImageJ software to measure the scratch area or width and calculate the scratch healing rate: Healing rate = (0 h scratch area - 24 h scratch area) / 0 h scratch area × 100%.
[0095] Cell scratch assay (e.g.) Figure 8 As shown in Figure D, NaBHB significantly promotes the migration of HepG2 cells; this effect is reversed after knockdown of OXCT1, and the migration rate is lowest in the shOXCT1+HepG2 group; this suggests that OXCT1 mediates the migration-promoting function of NaBHB.
[0096] (4) Transwell migration / invasion experiment:
[0097] Experimental Procedure: HepG2 cells from the shOXCT1 and shNC groups were routinely digested with trypsin, centrifuged, and the supernatant was discarded. The cells were resuspended in complete culture medium to prepare a single-cell suspension and seeded into six-well plates. The following groups were established: shNC + saline, shNC + NaBHB, shOXCT1 + saline, and shOXCT1 + NaBHB. The NaBHB intervention concentration was 20 mM. The control group received an equal volume of saline. Cells were incubated at 37°C with 5% CO2 for 3 days. When the cell density reached approximately 80%, serum was removed and the cells were starved for 12 hours to eliminate the influence of serum. The cells were then routinely digested with trypsin, centrifuged, and the supernatant was discarded. The cells were resuspended in serum-free culture medium to prepare a cell suspension. 200 μL of the cell suspension was added to the upper chamber of a Transwell microplate (1.5 × 10⁶ cells per well). 5(For invasion assays, Matrigel should be pre-coated at the bottom of the upper chamber of the chamber). Add 500 μL of complete culture medium containing 10% FBS to the lower chamber as a chemotactic factor. Continue incubation at 37°C, 5% CO2 for 48 h (migration) and 72 h (invasion). Remove the chamber, gently wash with PBS, fix with 4% paraformaldehyde for 15 min, wash with PBS again, and stain with 0.1% crystal violet for 20 min. Wipe away unmigrated / uninvaded cells from the upper chamber with a cotton swab, clean thoroughly, and allow to air dry at room temperature. Take photos of five randomly selected fields of view under an inverted microscope and count the cells. Quantitative analysis of the cells in the images is performed using ImageJ software.
[0098] Transwell migration / invasion experiments (such as...) Figure 8 As shown in Figure E, NaBHB significantly promotes the migration and invasion of HepG2 cells; this effect was reversed after knockdown of OXCT1, and the number of transmembrane cells was the lowest in the shOXCT1+NaBHB group; suggesting that OXCT1 mediates the migration-promoting and invasion-promoting functions of NaBHB.
[0099] In summary, this invention provides the application of targeted inhibition of OXCT1 combined with BHB in the preparation of anti-HCC drugs. This invention innovatively combines an OXCT1 inhibitor with BHB to prepare an anti-hepatocellular carcinoma drug. The two work synergistically to inhibit ketone body metabolism, enhance anti-tumor effects, and induce tumor cell apoptosis, achieving effective treatment of HCC. This has broad application prospects and significant clinical translational value.
[0100] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments without creative effort, as shown in these embodiments, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Application of reagents targeting and inhibiting OXCT1 in combination with BHB or pharmaceutically acceptable salts thereof in the preparation of anti-HCC drugs.
2. The application according to claim 1, characterized in that, The reagents that inhibit OXCT1 include: (1) Reduce OXCT1 expression with siRNA, shRNA, antisense nucleic acid, and gene editing reagents; (2) Small molecule inhibitors, peptides, antibodies or fusion proteins that inhibit OXCT1 enzyme activity.
3. The application according to claim 1, characterized in that, The BHB or its pharmaceutically acceptable salts, including but not limited to NaBHB, are mentioned.
4. The application according to claim 1, characterized in that, The reagent targeting and inhibiting OXCT1 exists as a single pharmaceutical composition with BHB, or as a kit containing the two active ingredients in separate packaging.
5. The application according to claim 4, characterized in that, The active ingredient of the anti-HCC drug includes: (1) BHB or its pharmaceutically acceptable salt; (2) Substances that can inhibit OXCT1 expression or inhibit OXCT1 enzyme activity.
6. The application according to claim 5, characterized in that, The anti-HCC drug also contains pharmaceutically acceptable excipients.
7. The application according to any one of claims 1 to 6, characterized in that, The dosage form of the anti-HCC drug is selected from one or more of the following: tablets, capsules, pills, oral liquid preparations, granules, powders, and injections.
8. The application according to claim 7, characterized in that, The administration method of the anti-HCC drug is selected from one or more of oral, injection, implantation, external application, spray and inhalation; the administration form includes simultaneous administration, sequential administration or intermittent administration.
9. The application according to claim 5, characterized in that, The anti-HCC drug is used to treat hepatocellular carcinoma with high OXCT1 expression.
10. The application according to claim 1, characterized in that, The reagent that targets and inhibits OXCT1 produces a synergistic effect when used in combination with BHB.